Fisiología Humana - Un Enfoque Integrado Silverthron Ed6.pdf [6lk921pdjxq4] (2022)

"-'> 2015. EDITORIAL MÉDICA PANAl\1I:RICANA S.A. de C.V. Hegel N" 141 "2º piso Col. Polanco V Sección, Odegac16n Miguel 1-hdalgo, C.P. 11560. Mé~ico D.F.

. . I

. --

un miembro del cuerpo docenLe de University of Te.xas. Dee cumplió rec ientemen te se is años como editora en jefe de Advances in Physiology Ed11cntion, y Lrabaja con miembros de la Unión Internacional de Ciencias Fis iológicas para mejorar la educación en esta materia en los países en desarrollo. Preside la Human Anatomy ami Physiology Society en el período 20 L2-2013. Tam bién es un miem bro activo de la American Physiological Society, de la Society for Comparatil'e a111/ lntegrative Bio/ogy, de la Association for Biology Laboratory Ed11mtio11, y de la Society for College Science Teachers. Dedica su tiempo lib re al arte Lexlil, y disfruta los paisajes de Texas con su esposo, Andy, y sus perros.

Dee Unglaub Silverthorn estudió biología de grado en el Newcomb College de Tu/eme University, donde realizó investigaciones con cucarachas. Luego de la grad uac ión comenzó a estudiar cangrejos, y recibió su doctorado en ciencias marinas en el Belle W Baruch /11stit11te for Marine 1111d Coas/al Scie11ces de University of South Carolina. Su interés se enfoca hacia el transporte epi telial, y sus Lrabajos más recientes en el laborato rio se han enfocado en las propiedades de transporte de la membrana alantoides del pollo. Su carrera docenLe comenzó en el DepanarnenlO de Fisiología de Mediml University of South Carolina, pero a lo largo de los años ha enseñado a muchos grupos de estudiantes diferentes, desde estud iantes de medicina y Olras carreras un iversi tarias, hasta aquellos en eLapas previas a la educación superior. En la University ofTexas-Austin enseña fisiología, tanto en el aula como en el laboratorio, e instruye a esLudiantes de posgrado en el desanollo capacidades de enseñanza de las ciencias natu rales. Ha recibido numerosos prem ios y hono res relacionados con la docencia, en lre ellos el Prem io de 2011 Outstm1di11g Teachi11g Award de UT

System Rege11ts', el 2009 Outstanding U11dergrad1111te Science Teacher Award de Societe for College Scie11ce Teachers, el premio Claude Bernard al d isertante y el premio Arthur C. Guyton al Educador del Año en Fisiología de la American Physiological Society, y múlliples prem ios de UT-Austin, entre ellos el Premio Burnc Orange Apple. La pr imera edició n de su lib ro de tex Lo ganó el Premio al Atito r Robert W. Hamilton en 1998 como mejor texLo publicado en [997- 1998 por

El Dr. William C. Ober (ilustrador y coordinador de arte) recibió su título de grado en 1Na.slrington and Lee University, y su doctorado en University o( Virginia. También esLUdió en el Departamento de Arle Aplicado a la Med icina en /oh/IS Hopkins University. Desp ués de su graduación, el Dr. Ober comp letó una residencia en medicina famil iar y luego formó parte del cuerpo docente de la U11iversity of Virginia, en el Departamento de Med icina Familiar y en el Depanamento de Medicina del Deporte. También se desempeñó corno Jefe de Medicina en el Martlw Jefferson Hospital en Charlouesville. Ac Lualmen Le es Profesor Invitado de Biología en la Washi11gto11 and Lee University, donde ha dictado varios cursos y dirigido viajes de estudio a las L~las Galápagos. Fo rma parle del cuerpo docente del Shoals Marine Laboratory, donde enseña ]lustració n en Biología Lodos los veranos. Los libros de texlo ilustrados por él, a Lravés de Medica/ & Scie11t~(ic Il/11stratio11, ha n ganado numerosos premios por su diseño e ilustraciones.

La en iem, era Claire W. Garrison se desempeñó en las áreas de Pediatría y Obstetricia antes de dedicarse a su carrera en la ilusLración médica. Retomó sus estudios en el ,v.fary Baldwin College donde se graduó con disLincione.s en arte. Después de 5 años de aprendizaje, ha trabajado como socia del Dr. Obe r en Medica/ and Scientific Jl/11stration desde 1986. Pertenece al cuerpo docente del Shoals Marine Labomtory y e.s profesora adjunLa en el curso de Iluslración en Biología.

Sobre el consultor clínico El Dr. Andrew C. Silverthorn se graduó en la Academia Militar de los Estados Unidos ( West Point). Sirvió en la infantería en Vietnam, y al regresar ingresó en la Facultad de Medicina de University of South Carolina en Charleston. Fue jefe residente en medicina familiar en U11iversity ofTexns, en Galveston, y actualmente se desempeña como médico de familia en su consultorio en Austin, Texas. Cuando Andrew no está ocupado con sus pacientes, se lo puede encontrar en el campo de gol[ o jugando con sus perros, Lady Godiva ( un labrador color chocolate) y Molly.

Sobre el colaborador Bruce R. Johnson es Investigador Principal Asociado en el Departamento de Nemobiología y Comportamiento de Corne/1 University. Se graduó en biologia en la Florida State U11iversity (13A), en Florida Atla11tic U11iversity (MS} y en el Marine Biologica/

Laboratory Woods Hole (PhD) a r --,.....l través del Boston University 1vfari11e Program. En Cornell dicta un curso de laboratorio de pregrado llamado Principios de Neuroíisiologia. Es coautor de Crmvdnd: a CD -ROM Jab 1--...-'. mnmial for Neurophysiology y de Laboratory 1vfmmal for Physíology, y sigue diseñando preparados modelos para los estudiantes de su laboratorio de neurociencias. Bruce ha enseñado en talleres para docentes auspiciados por NDF (Crawdad) y Faculty for U,uiergraduate neuroscience ( FUN )/Proyecto Kaleidoscope, y en cursos de laboratorio de neurociencias de grado )' de posgrado en Kebenhavns Universitet ( Universidad de Copenhague), el 1vfari11e llilogic.al Labora.tory y el Shoa/s Marine Lnboratory. Ha recibido premios por su labor en educación de Cornel/ University )' el Premio Anual FUN al Educador. Ha presidido FUN. Sus investigaciones se enfocan en los mecanismos celulares y sinápticos de la plasticidad de las redes motoras.

DEDICATORIA En me1noria de D r. Waltcr George Ungla ub, 1918-1970

Introducción a la fisiología 1 interacciones moleculares 31 Compartimentación: células y tejidos 62 4 Energía y metabolismo celular 98 S Dinámica de la membrana 129 6 Comunicación, integración y homeostasis 174 1 2 3

Introducción al sistema endocrillO 206 Propiedades de las neuronas y de las redes neurales 237 El sistema nervioso central 288 1O Fisiología sensitiva 325 11 División eferente: control autónomo y motor somático 377 12 Músculos 398 13 Fisiologia integrada I: control del movimiento corporal 441 7 8 9

Fisiología cardiovascular 462 Flujo sanguíneo y control de la presión arterial 508 La sangre 544 Mecánica de la respiración 568 Intercambio y transporte de gases 599 Los riñones 626 Fisiología integrada íl: equilibrio de líquidos y electrolitos 657

El aparato digestivo 696 Metabolismo y balwce energético 736 Control endocrinológico del crecimiento y del metabolismo 775 El sistema inmunitario 801 Fisiología integrada ITl: ejercicio 835 Reproducción y desarrollo 850

Procesos celulares básicos: integración y coordinación 1 Introducción a la fisiología

32 La mayoría de las biomoléculas contienen carbono, hidrogeno y oxígeno 38 l os electrones cumplen cuatro funciones biológicas importantes 38 Los enlaces covalentes entre los átomos crean moléculas 39 Los enlaces no covalentes facilitan interacciones reversibles

8 Temas de fisiología 8 Tema 1: la estructura y la función están íntimamente relacionadas 9 Tema 2: los organismos vivos necesitan energía 9 Tema 3: el flujo de información coordina las funciones del cuerpo

49 Interacciones proteicas 50 l as proteinas son se lectivas respecto de las moléculas a las que se une n 50 l as reacciones de unión a las proteínas son reversibles

50 l as reacciones de unión obedece n la ley de acción de masas 51 La constante de disociación ind ica la afinidad

11 La homeostasis depende del equilibrio de masas 13 La excreción elimina sustancias del organismo

15 El control local está restringido a un tejido 15 El control reflejo utiliza señales a larga distancia

16 Los bucles de respuesta comienzan co n un estímulo 17 l os bucles de retroalimentación modulan los bucles de respuesta 17 Los bucles de retroalimentación negativa son homeostáticos 18 Los bucles de retroalimentación positiva no son homeostáticos 18 El control de prealimentación permite al organismo prever los ca mbios 19 Los ritm os biológ icos so n el resultado de ca mbios en el valor de referencia

20 La ciencia de la fisiología 20 Los buenos experimentos científicos deben d iseñarse con cuidado 21 Los resultados de los experimentos en seres humanos pueden ser difíciles de interpretar 22 Gráficos

µ.,.

63 Compartimentos funcionales del cuerpo 63 l a luz de algunos órganos se comunica con el exte rior 65 funcionalmente, el cuerpo tiene tres compartimentos de líquidos

66 l as membranas están formadas principalmente por lípidos y proteínas 66 l os lípidos de membrana forman u na barrera hidrófoba

68 l as proteinas de membrana puede n estar unidas laxa o estrecha mente a la membrana

69 l os hid ratos de ca rbo no de membrana se ad hie ren a los lipidos y a las proteínas

106 l as velocidades d e reacción so:n variables 106 las e nzim as pueden ser activadas, inactivadas o moduladas 107 l as e nzim as disminuyen la ene rgía d e activación de las reacciones

69 El citoplasma incluye el citosol, las inclusiones, las fibras y los o rgán ulos

•:•.· ,"'··· ...

73 Novedades: los cilios son sensores 74 El citoesqueleto es un a ndam iaje modificable

121 El corte y empalme alt e rnativo crea múltiples proteínas a pa rtir d e una secue ncia d e ADN

89 Remodelación tisular 90 la apoptosis es una forma o rdenada de mue rte cel ula r 90 las células madre pueden crear célu las especializad as n uevas 9 1 la piel

130 Homeostasis no significa eq ui librio 130 Tema relacionado: fibrosis quística

99 La energía en los sisternas biológicos 100 l a e nerg ía se utiliza para realizar trabajo 101 l a e nerg ía se p resenta e n d os formas: cinética y pote ncial 101 l a e nerg ía pued e conve rtirse de una forma e n o tra 10 2 l a termodinámica es el estudio d e la uti lización d e la e ne rgía

102 Reacciones qtúmicas 102 l a e nergía se tra nsfiere entre las molécu las durante las reaccion es

139 Los procesos de trans porte 140 Las me mbranas cel ulares son selectivamente permeables

141 Difusión 142 las moléculas lipófilas atraviesan las me mbranas por difusión simple

144 Transporte mediado por proteínas 145 Las proteínas de membra na cumple n cuatro funciones p rincipales 146 Las proteínas de ca nal forman tú neles abiertos, rellenos d e ag ua 146 Novedades: familias de gene·s transportadores

..... ~..... .

148 Las proteínas tra nsportadoras ca mbian su conformación para movilizar moléculas

104 El cambio ne to de e ne rg ía libre dete rmina la reversibilidad de la reacción

105 Enzimas 105 las e nzi mas son proteínas 106 Biotecnología: estudiando las isoenzimas

1SO El trasporte activo moviliza sustancias e n contra de sus g radie ntes d e concentración 153 El t ransporte med iad o por tras portadores presenta especificidad, compe tició n y saturación

155 Transporte mediado por vesículas 155 La fagocitosis crea vesículas utilizando el citoesqueleto

157 Aplicación clínica: LOL: la lipoproteína letal 157 La exocitosis libera moléculas demasiado grandes para las proteínas de transportadora s

157 Transporte transepitelia1 158 El transporte tra nsepitelial puede ser paracelular o transcelular

191 La reg ulación por incremento y la regulación por disminución permiten a las células modu lar las respuestas

161 Repaso sobre la electricidad 161 la membrana celular permite la separación de las cargas eléctricas en el cuerpo

163 El potencial de membrana de reposo se debe principa lmente al potasio 166 Cambios en la permeabilidad a los iones modifican el potencial de membrana

191 Muchas enfermedades y fármacos tienen como objetivo las proteínas de transducción de señales

192 Vías reflejas homeostáticas 192 l os postulados de Cannon describen las variables reguladas y los sistemas de control

175 las un iones en hendidura forman pue ntes citoplasmáticos 175 las señales dependie ntes del contacto req uieren contacto intercelular 177 las señales paracrinas y autocri nas llevan a cabo la comunicación local 177 la comun icación a larga distancia puede ser eléctrica o química 177 las citocinas pueden actuar como seña les locales o como señales a larga distancia

178 Vías de señalización 178 los receptores proteicos están ubicados dentro de la célula o en la membrana celular

207 Tema relacionado: enfermeda,d de Graves 207 Las hormonas se conocen desde tiempos antiguos 208 Aplicación clínica: diabetes: el descubrim iento de la insulina 209 Las hormonas actúan unié ndose a receptores

181 los receptores enzimáticos tienen actividad de proteincinasa o de guanililciclasa

183 Muchas hormonas lipófobas uti lizan vías de GPCR-AMPc 183 los receptores asociados a proteínas G también utilizan seg undos mensajeros derivados de lípidos 183 los receptores tipo integrina transfieren información desde la matriz extracelular 185 las vías de señalización más rápidas modifican el flujo de iones a t ravés de canales

211 Clasificación de las honnonas 212 l a mayoría de las hormonas son pépt idos o proteínas 214 l as hormonas esteroideas derivan del colesterol 216 Algu nas hormonas derivan de ami noácidos

216 Control de la liberación hormonal 216 las hormonas pueden cla.sificar seg ún sus vías reflejas 217 La célula endocrina es el sensor en los reflejos endocri nos más simples

índice 219 Muchos reflejos endocrinos involucran el sistema nervioso 219 Las neurohormonas son secretadas en la sangre por neuronas 219 La hipófisis está formada por dos glándulas fusionadas 219 La neu rohipófisis almace na y secreta dos neurohormonas 221 La adenohipófisis secreta seis hormonas 223 Un sistema porta lleva hormonas desde el hipotálamo hasta la adenohipófisis 223 Las hormonas de la adenohipófisis controlan el crecimiento, el metabolismo y la reproducción 223 Los bucles de retroalimentación son diferentes en el eje hipotálamo-hipofisario

224 Interacciones hormonales 224 En la sinerg ia, el efecto de las hormonas que interactúan es más que ad itivo 226 Una hormona facilitadora posibilita que otra hormona ejerza su efecto pleno 226 Hormonas antagonistas tienen efectos opuestos

254 los potenciales de acción se trasladan a grandes distancías 255 El Na• y el K' atraviesan la membrana durante los potenciales de acción 257 Un potencial de acción no modifica los grad ientes de concent ración iónicos

257 los canales de Na• del axón poseen dos compuertas 258 los potenciales de acción no se disparan durante el período refractario absoluto 259 los potenciales de acción se desplazan 261 las neuronas más grandes conducen los potenciales de acción más rápidamente 261 la conducción es más rápida en los axones mie línicos 263 Biotecnología: el cableado del cuerpo 265 Factores q uímicos alteran la actividad eléctrica

266 Comunicación intercehúar en el siste1na nervioso 266 las neuronas se comunica n a través de las sinapsis 266 las neuronas secretan señales químicas 267 los neu rotra nsmisores son muy diversos 269 Aplicación clínica: miastenia ,grave

227 Patologías endocrinas 227 La hipe rsecreción exagera los efectos de una hormona 227 la hiposecreción disminuye o e limina los efectos de una hormona 228 Los problemas con el receptor o con los segu ndos mensajeros generan respuestas tisulares anormales

228 El diagnóstico de las patologías endocrinas depende de la complejidad del reflejo

270 Biotecnología: de serpientes, caracoles, arañas y sushi 273 Un estímulo más intenso libera mayor de cantidad neurotransmisor

274 las respuestas postsinápticas p ueden ser lentas o rápidas 233 Resumen del ca pítulo

281 l os trastornos de la transmisión sináptica son responsables de muchas enfermedades 282 Resume n del capítulo 284 Preg untas 286 Respuestas

239 Las neuronas transportan señales eléctricas 243 La formación de si napsis depende de señales químicas 244 Las células gliales son el sostén de las neuronas

288 El sistema nervioso central 289 Propiedades emergentes de las redes netuales 289 Tema relacionado: espasmos infantiles

248 Las señales eléctricas netuonales 248 La ecuación de Nern st permite conocer el potencial de membrana de unión individual 249 la ecuación GHK permite conocer el potencial de membrana utilizando múltiples iones

291 Anatomía del sistenia nervioso central 291 El SNC se desarrolla a partir de un tubo hueco 293 El SNC está dividido en sustancia gris y sustancia blanca

250 Los canales regulados por compuerta controlan la permeabilidad iónicas de las neuronas

293 l os hu esos y el tejido conectivo sostienen el SNC 293 El encéfalo flota en el líquido cefalorraquídeo

251 Aplicación clínica: canales mutantes 251 El flujo de corriente obedece la ley de Oh m

296 la barrera hematoencefálica protege a l encéfalo 297 El tejido nervioso tiene requerimientos metabólicos especiales 298 Aplicación clínica: diabetes: la hipoglucem ia y el encéfalo

341 El o lfato es uno de los sentidos más antig uos 344 El g usto es una combinación de cinco sensaciones básicas

301 El tronco encefálico es la parte más a ntigua del encéfalo 303 El cerebelo coordi na los movimientos

303 El diencéfalo contiene los cent ros para la homeosta sis 304 El cerebro es el lugar de asentamiento de las funciones superiores

346 la audición es nuestra percepción de los sonidos 348 la transducción del sonido es un proceso de múltiples pasos

306 La corteza cerebral está organ izada e n áreas funcionales 307 La méd ula espinal y el encéfalo integ ran la información sensitiva

352 las vías auditivas envían la información hacia la corteza auditiva nerviosa o mecá nica

309 ¿Por qué dormimos? 312 Las fu nciones fisiológicas presenta n ritmos circadianos

312 Novedades: adenosina y café 312 La emoción y la motivación involucran vías nerviosas compl ejas 314 Los estados de án imo son estados emocionales de larga du ración

354 El aparato vestibular provee información acerca del movimiento y la posición 356 los conductos semicirculares detecta n la aceleración rotacional 356 los órganos otolíticos detectan la aceleración lineal y la posición de la cabeza 356 l as vías del eq ui librio se dirigen principalmente hacia el ce rebelo

314 El aprendizaje y la memoria modifican las conexiones sinápticas en el encéfa lo

315 La memoria es la capacidad de retener y recordar información 317 El lenguaje es la conducta cognit iva más elaborada 318 La personalidad es una combinación de experiencia y herencia 320 Resu men del capítulo

358 la luz entra en el ojo a través de la pupila 359 El cristalino enfoca la luz en la reti na 361 la fototransd ucción ocurre en la retina

365 Novedades: melanopsína 365 los fotorreceptores convierten la luz en señales eléctricas

327 los receptores son sensibles a formas part iculares de energía 328 La tra nsd ucción sensitiva convierte los estímulos en potenciales locales 328 Una neurona sensitiva tiene un campo receptivo 329 El 5NC integra la información sensitiva 331 La codificación y el procesa miento distinguen las propiedades de un estímulo

335 Sentidos somáticos 335 Las vías para la percepción somática se dirigen hacia la corteza y el cerebelo 335 los receptores del tacto responden a muchos estím ulos d iferentes 337 los receptores de temperatu ra son terminaciones nerviosas libres 337 l os nociceptores inician respuestas protectoras 338 El dolor y el picor son mediados por nociceptores 340 Aplicación clínica: analgésicos naturales

.......,. -:~·

Los reflejos autónomos son importantes para la homeostasias El control antagonista es una ca racterística d istintiva de la división autónoma 380 Las vías autónomas tienen dos neuronas efe rentes en serie 381 Las ramas simpática y parasimpática se originan en regiones diferentes 383

Las vias autónomas controlan la actividad de los mú sculos liso y card íaco y de las g lándulas

Índice 385 Los receptores del sistema autónomo tienen mú ltiples subtipos 386 La méd ula suprarrenal secreta catecolami nas

429 La fosforilación de la miosina controla la contracción 431 La fosfatasa de cadenas ligeras de miosina controla la sensibilidad al Ca'+ 431 El calcio inicia la contracción de l músculo liso

387 Los agon istas y a ntagonistas autónomos son herramie ntas importantes para la investigación y la medicina

433 Algu nos músculos lisos tienen potenciales de membrana inestables 433 Seña les químicas influyen sobre la actividad del músculo liso

389 Los trastornos primarios del sistema nervioso autónomo son relativamente poco frecuentes

391 Una vía motora somática está formada por una neu rona 391 La unión neuromuscular contiene receptores nicotínicos 394 Resumen del capítulo

442 Las vías reflejas se pueden clasificar de diferen tes maneras 442 Tema relacionado: Tétanos

400 Los músculos esque léticos están formados por fibras musculares 401 Las miofibrillas son estructu ras contrácti les de la fibra muscu lar

452 El movimiento se puede clasificar como reflejo, voluntario o rítmico 454 El SNC integra los movimientos

41 O La acetilcolina inicia el acoplamiento excitación-contracción 413 La contracción del músculo esquelético requiere un suministro continuo de ATP 414 La fat iga tiene múltiples causas 415 El músculo esq uelético se clasifica segú n su velocidad y su resistencia a la fatiga 417 La longitud de la fibra en reposo afecta la tensión 417 La fuerza de contracción aumenta con la sumación

457 Los síntomas de la enfermedad de Pa rkin son reflejan las funciones de los gangl ios basales

457 Control del movimiento en los músculos v iscerales 459 Resumen del capítulo 460 Preg untas 461 Respuestas

420 La fuer.za de contracción depende de los tipos y la cantidad de unidades motoras

421 Las contracciones isotónicas mueven ca rgas; las contracciones isométricas genera n fuerza si n movimiento

421 Los huesos y los músculos alrededor de una articulación forman palancas y puntos de apoyo 423 Los trastornos musculares tienen múltiples causas

426 Músculo liso 427 El músculo liso es más variable que el músculo esquelético 429 El músculo liso carece de sarcómeros

. :;....... .. .

418 Una unidad motora está formada por una neurona motora y sus fibras musculares

449 Los reflejos miotáticos y la inhibición recíproca controlan el movimiento alrededor de una a rticu lación

407 Señales de calcio inician la contracción 408 Las cabe.zas de miosina ' caminan" a lo largo de los filamentos de actina

406 La acti na y la miosina se deslizan una con respecto a la otra durante la contracción 407 Los puentes cruzados de miosina mueven filamentos de actina

463 Aspectos generales del apara to cardiovasCLÚar 464 El aparato cardiovascu lar transporta sustancias por todo el organismo

464 El apa rato cardiovascular está formado por el corazón, los vasos sanguíneos y la sang re

512 El flujo de sangre converge en las vé nulas y las venas 512 La angiogénesis genera nuevos vasos

513 l a presión arterial es más alta en Jas arterias y me no r en las ve nas 515 l a presión arteria l refleja la presión motriz del flujo sa nguíneo

467 La presión de un líquido cambia sin modificar su volumen 467 La sangre fluye desde una zona de mayor presión hacia una de menor presión 469 La resistencia se opone al flujo 470 La velocidad depende del ca udal y del área de la sección transversal

51 5 La presión arterial se estima con u n esfigmomanometro 516 El volume n minuto y la resistencia periférica dete rminan la presión arterial med ia 518 l os cambios de la vo lem ia afectan la presión art erial 51 9 Aplicación clínica: choque

471 El corazón tiene cuatro cámaras 474 Las válvulas cardíacas aseguran el flujo en un solo sentido dentro del corazón 475 Las células muscu lares cardíacas se contraen sin inervación 477 La entrada de calcio es una caract erística del acoplamiento excitación -contracción 479 La contracción del músculo card íaco puede graduarse

51 9 l a autorregulación miogénica ajusta el flujo sanguíneo de manera automática 520 Las secreciones paracrinas afectan la contracción del múscu lo liso vascular 522 l a rama simpática controla la mayor part e del músculo liso vascular

524 Distribución de la sangre a los tejidos 524 Regulación de la ftu1ción cardiovascu.lar

485 l os marcapasos reg ulan la frecuencia ca rdíaca 485 Aplicación clínica: fibrilación

493 Las curvas de presión-volumen represe ntan un ciclo cardiaco 493 El volume n sistól ico es el volumen de sangre que se bombea en cada contracción 495 El volume n minuto es una medida del rendimiento cardíaco 495 La frecuencia card íaca está modulada por el sistema autónomo

529 l a mayor parte del intercambio en los capi lares se produce por difusión y t ranscitosis 529 La filtración y la absorción en los capilares se produce n por convección

532 El sistema linfático 533 El edema se produce por alteraciones en el intercambio capilar

498 La contractilidad es controlada por los sistemas nervioso y endocrino ••• 500 Novedades: células madre para las

......:.

..~.

,:·-r....

51 O Los vas os sang1úneos 51 O l os vasos sanguíneos contienen músculo liso vascu lar 511 l as art erias y las arteriolas llevan sangre desde el corazón 511 El intercambio se produce en los capilares

545 Plasma y elernentos celulares de la sangre 545 El plasma es la matriz extracelular 547 l os elementos celulares incl uyen eritrocitos, leucocitos y plaq uetas

583 la presión intrapleural cambia durante la ve ntilación 585 la distensibilidad y la elasticidad de los pulmones pueden cambiar e n los estados patológicos

549 las células de la sangre se producen en la médu la ósea 549 la hematopoyesis está controlada por citocinas

587 El diámetro de las vías aéreas determina su resistencia 588 l a frecuencia y la profu ndidad de la respiración determinan su eficiencia

551 la t rombopoyetina regula la producción de plaq uetas SS 1 la eritropoyetina reg ula la producción de eritrocitos

590 la composición de los gases en los alvéolos varía poco durante la respiración normal

557 las plaquetas son pequeños fragmentos de cél ulas 557 la hemostasia impide la pérdida de sangre en los vasos da ñados

560 la activación de las plaquetas comienza el proceso de coag ulación 561 la coag ulación convierte el tapón plaquetario en un coágulo 562 los anticoagulantes impiden la coagulación

604 los problemas de difusión causa n hipoxia 604 Biotecnologí a: el pulsioxímetro de pulso 605 la solubilidad de un gas afecta su difusión

608 la hemoglobina transporta la mayor parte del oxígeno a los tejidos ••• 609 Novedades: sustitutos de la sangre

570 los huesos y los músculos del tórax rodean los pulmones 570 los sacos pleu rales contienen los pulmones 571 las vías aéreas conectan los pulmones con el medio externo 571 las vías aéreas calientan, humedecen y filtra n el ai re inspirado 574 los alvéolos son el sitio de intercambio de gases 575 la circulación pulmonar tiene alto flujo y baja presión 576 Aplicación clínica: insuficiencia card íaca congestiva

..:....... ..

609 la P02 determina la unión del oxígeno a la Hb 6 10 l a unión del oxígeno se expresa como porcentaje 6 12 Varios factores modifican la un ión entre oxígeno y Hb 6 12 El dióxido de ca rbono se transporta de tres formas

615 Regulación de la ventilación 6 17 las neu ronas del bulbo raq uíde o controlan la respiración 618 El dióxido de carbono, el oxígeno y el pH influyen en la ventilación 620 Reflejos protectores cuidan los pulmones 620 los centros cerebra les superiores afectan los patrones de ventilación 622 Resumen del capítulo

578 La ventilación 578 los volúmenes pulmonares cambian d urante la ventilación 580 En la ventilación, el aire fluye debido a los gradientes de presión 580 la inspiración se produce cuando la presión alveolar disminuye 583 la espiración se produce cuando la presión alveolar aum enta

6 28 El apa rato urinario está formado por los ri ñones, los uréteres, la vejiga y la uretra 628 Aplicación clínica: infecciones urinarias

668 Balance de sodio y del volumen de LEC 669 l a ald osterona controla el bala nce de sodio 671 l a presión arteria l baja estimula la secreció n d e ald osterona

629 l os riño nes filtran, reabsorben y secretan 633 l a nefrona modifica el vo lumen de líq uidos y la osmolaridad

675 Balance de potasio 675 Mecanismos del comportamiento en el eqwlibrio de sales y agua

634 Filtración 634 El corpúsculo re nal contie ne barre ras d e filtración 636 l a presión de los capilares produce la filtració n

638 l as hormo nas y las neu ronas autónomas también influye n en la TFG 638 Novedades: nefropatía diabética

..•.....·.... :.

,.

676 Control integrado del vohunen y la osmolaridad 6 76 l a osmo laridad y el vol ume n p ue,den cambiar de forma ind ependie nte

682 l a homeostasis del pH depend e d e los reguladores, los p ulmo nes y los riño nes 683 l os sistemas reguladores incluyen proteínas, io nes fosfato yHCO,·

657 Fisiología integrada 11: equilibrio de líquidos y electrolitos 658 Homeostasis de líqtúdos y electrolitos 658 Tema relacionado: hiponatremia 658 La osmolaridad del LEC afecta el volumen celular

659 Balance de agua 660 l a ingesta diaria de agua y su excreción se equi libran 660 l os riño nes conservan agua 661 l a méd ula renal genera orina concentrada 662 Aplicación clínica: diabetes: d iuresis osmótica

699 El a parato d igestivo es u n tubo 70 2 l a pared d el tracto GI tiene c uatro capas

703 El músculo liso g astrointestinal m uestra distintos patrones d e contracció n

~.· . ¡ .

705 Secreción 705 El aparato digestivo secreta iones y ag ua 707 Las enzimas digestivas se secretan hacia la luz del tracto digestivo

710 Digestión y absorción 71 O los hidratos de carbono se absorben como monosacá ridos

739 Balance energético 739 El ingreso de energía es igual a I egreso de e nergía 740 El consu mo de energía se refleja en el uso de oxígeno

743 La energía proveniente de los alimentos ingeridos puede usarse de inmediato o alm acenarse

715 Regulación de la función gastrointestinal 717 Novedades: receptores del gusto gastrointestinales

717 El sistema nervioso entérico puede actuar en forma independiente del 5NC 718 Los GI incluyen hormonas, neuropéptidos y citocinas

719 Función integrada: la fase cefálica 719 La digestión química y mecánica comienza en la boca 720 Al degluti r, el alimento se desplaza desde la boca hasta el estómago

722 Función integrada: la fase gástrica 722 El estómago a lmacena alimentos 722 El estómago secreta ácido y enzimas 725 El estómago equilibra digestión y protección

725 Función integrada: la fase intestinal 725 El bica rbonato neutraliza e l ácido gástrico 727 La mayor parte del líquido se absorbe en el intestino delgado

745 Metabolismo posprandial 745 Los hidratos de carbono producen ATP 745 Los aminoácidos forman proteínas 745 Las grasas almacenan energía 748 El colesterol plasmático predice la cardiopatía

749 Metabolismo del aytu10 749 El glucógeno se transforma en g lucosa 749 Aplicación cl ínica: los antioxidantes protegen el organismo

750 Las proteínas pueden usarse para producir ATP 751 Los lípidos almacenan más e nergía que la g lucosa o las proteínas

753 Control ho1neostático del metabolismo 753 El páncreas secreta insu lina y g lucagón 754 El cociente insulina-glucagón regu la el metabolismo 754 La insulina es la hormona predominante del estado posprandial 755 La insulina es una hormona anabólica 759 El glucagón es la hormona predominante del ayuno

727 La mayor parte de la digestión tiene lugar en el intestino delgado 728 Aplicación cl ínica: intolerancia a la lactosa

760 La diabetes mellitus es una fam ilia de enfermedades 761 Los diabéticos de tipo 1 puede n presentar cetoacidosis

730 Funciones in.m unitarias del GI 730 Las cél ulas M regulan los contenidos intesti nales 730 El vómito es un reflejo protector 732 Resumen del capítulo 734 Preg untas 735 Respuestas

765 El síndrome metabólico representa un nexo entre la diabetes y la patología cardiovascular

765 Regulación de la temperatura corporal 765 La temperatu ra corporal equilibra la producción, la ganancia y la pérdida de ca lor 767 La temperatura corporal está regulada homeostática mente 768 El movimiento y el metabolismo producen calor

776 Revisión de principios endocrinológicos 776 Tema relacionado: hiperparatiroidismo 776 Biotecnología: modelos de ratones

781 los trastornos del cortisol son consecuencia del exceso o del déficit de la hormona 781 La CRH y la ACTH cumplen funciones fisiológicas suplementa rias •• 782 Novedades: melanocortinas y agutíes ;

~·....

811 l os fagocitos ingieren material exógeno 812 Los linfocitos citolíticos naturales eliminan células infectadas y tumorales 812 l a respuesta inflamatoria es inducida por citocinas

814 Inmtuúdad adquu·ida: respues tas antigenoespecíficas 81 4 Los linfocitos median la respuesta inmunitaria adquirida

816 Los linfocitos B se diferencia n e n células plasmáticas y células de memoria 816 l os anticuerpos son proteínas secretadas por las células plasmáticas

782 Las hormonas tiroideas contienen yodo 784 La TSH controla la glándula tiroidea 784 l as patología t iroidea afecta la cal idad de vida

788 La hormona de crecimiento humana producida por ingeniería genética plantea cuestiones éticas

821 Vías de la respuesta in1ntuútaria 821 l a invasión bacteriana causa inflamación 821 l as infecciones virales requieren meca nismos de defensas intracel ulares 824 l as respuestas alérgicas son desencadenadas por antígenos específicos

825 l as proteínas del CMH permiten el reconocimiento de tejidos exógenos 827 El sistema inmunitario debe "reconocerse a sí mismo"

792 Balance de calcio 792 El calcio plasmático está sujeto a control estricto 793 El balance de calcio está controlado por tres hormonas 795 La homeostasis del calcio y la del fosfato está n relacionadas 796 La osteoporosis es una enfermedad por pérd ida del hueso 798 Resumen del capítulo 798 Preg untas 800 Respuestas

828 Interacciones neuroendocrino.inmunitarias 829 El estrés altera la función del sistema inmunitario 830 l a medicina moderna contempla la terapéutica mente-o rganismo 831 Resumen del capítulo 833 Preguntas 834 Respuestas

867 Un ciclo menstrual dura aproximadamente un mes 867 El control hormonal del ciclo menstrual es complejo

839 Respuestas de la ventilación al ejercicio 840 Respuestas cardiovasculares al ejercicio

843 Respuestas de prealimentación al ejercicio 843 Regulación de la temperatura durante el ejercicio 844 Ejercicio y salud

885 La menopausia y la andropausia son consecuencia del envejecimiento 887 Resumen del capitulo

851 Los cromosomas sexuales determinan el sexo genético 852 La diferenciación sexual se produce en etapa.s tempranas del desarrollo 853 Aplicación clínica: trastornos hereditarios ligados al X

856 Patrones básicos de reproducción 856 Aplicación clínica: determinación del sexo

857 La gametogenla comienza en el útero 857 El cerebro dirige la reproducdón 860 Los factores ambientales Influyen sobre la reproducción

861 Los testículos producen espermatozoides y hormonas 865 La espermatogenia requiere gonadotropinas y testosterona

¡Bienvenido a la fisiología humana! En cuan to dec ide estudia r el cuerpo h uma no debe estar preparado para aprovechar al máximo los recmsos dispo nibles, incluidos a su profesor, la biblioteca, Internet y SLLlib ro de texto. Uno de m is objetivos en este libro es brindarle no solamente información sobre có mo funciona el cuerpo humano, sino también sugerencias para estudiar y resolver problemas. Muchas de estas ayudas para el estudio han sido desarrolladas a pa rtir de comen ta rios de mis alumnos.por lo q ue creo que serán especialmen te úliles para usted. En las siguien tes páginas he adjun tado un breve recorrido po r las características especiales del libro, sobre todo aquellas que usted puede no haber encon trado an tes en otros libros de texto. Po r favor, tómese unos min utos para leer de q ué se tra ta, para poder hacer un uso ó plimo d el libro al estudifLr. Una de sus tareas al estudiar será desarrollar Lma visión global del cuerpo, de sus aparatos y sistemas,)' de los muchos procesos que mantienen en funcionamien to a esos aparatos y sistemas. Esta " imagen general" es lo que los fisiólogos llamarnos integración de aparatos)' sistemas, y es un terna clave de esLe libro. Para integrar la información, sin embargo, debe hacerse más que simplemente memo rizarla. Usted tiene que comprenderla verdaderamen te, y ser capaz de usarla para resolver p roblemas que nunca ha enfrentado anLes. Si su objetivo es ser un profesional de la salud, hará esto mismo con la clín ica. Si va a seguir una carrera en la biologfa, resolverá problemas en el laboratorio, en el campo o en el aula. Analizar, sintetizar y evaluar la información son habilidades que debe desarrollar mienLras está estudiando, y espero que las características de este libro le ayuden a alcanzar ese objetivo. En esta edjció n hemos continuado con la actuali2.ación )' el enfoque en los temas y conceptos básicos de la fis io logía. El Capítulo l lo i ntroduce en los conceptos clave de la fisiología que encon Lrará repeLidamente al esLudiar los di ferentes aparatos, sistemas )' órganos. También incluye varias características espeliales: una es el mapeo, una habilidad útil para el estudio que también se usa para Lo mar decisiones en el ,lmbito cl ín ico, y la otra es la construcció n e interpretación de gráficos. El nuevo Tema Relacionado del Capitulo l le presen La las formas más eficaces de enco mrar información en Inter net.

Un elemenLo nuevo de esLa edición en cuanto a las ilustraciones son las figuras de Fundamentos y de Revisión. EsLas figuras desLacan los conceptos básicos sobre LLl1 Lema, en una o dos páginas, al igual q ue los Resúmenes Anatómicos. Mis estudiantes dicen que les resultan especialmente útiles para repasar cuando no tienen tiempo de volver a leer todo el texLo. También hemos conservado los cuatro en foques para el aprendizaje de la fisiología que han sido tan populares desde que este libro se publicó por primera vez en 1998.

1. Fisiología celular y molecular Gran parte de la invesligación acLual en fisiología se realjza a los n iveles celula r y molecular, y ha habido muchos desa rro llos impresionantes en medici na y fisiología mo lecular en los tliez afios que pasaron desde la p rimera edició n. Po r ejemplo, los cien tíficos ahora están prestando más aLención a las cilias primarias, las cilias ún icas que aparecen en la mayo ría de las cél ulas del cuer po. Se cree q ue las ci lias primarias Lienen un papel en algunas enfe.-medades renales )' de o tros órganos. 13usque vínculos similares entre la b io logía, la fisio logía y la med ici na moleculares)' las celulares, a lo largo del libro.

2. La fisiología como campo dinámico La fis io logía es una d isciplina dinám ica, con muchas pregun tas aún

si n responder que requieren fu turas investigaciones. Muchos de los "hechos" presentados en este texto son en real idad solo teo rías actua les, por lo q ue usted debe estar preparado para cambia r sus modelos men tales a medida q ue surja nueva in lormación de las investigaciones cient íficas.

3. Un énfasis en la integración Los aparatos y sisLemas del cuerpo no trabajan en forma aislada, aun que los estudiemos de a uno por vez. Para destacar la natmaleza integrada de la fis iología, Lres capítulos (los Capítulos 13, 20 y 25) abordan cómo los procesos fisiológicos de múltiples apanuos y sistemas se coordinan entre sí, especialmente cuando la homeostasia está afectada.

4. La importancia de la resolución de problemas.:::::::::::::=::::::::~::::::::~~-.:.l:::e-=~ Una de las habilidades más valiosas para la vida que deben adquirir los estudiantes es la de pensar de manera crítica y de utilizar la información para resolver problemas. A medida que estudia fisiología, usted debe prepararse para praclicar estas habilidades. Encontrará varias características en este libro, como las preguntas de Revisión y las preguntas de las figuras y gráficos, que están diseñadas pa.ra hacerle pensar de manera crítica y analizar los hechos. En cada capítulo, lea el Tema Relacionado a medida que avanza en el texto, para ver si puede aplicar lo que está leyendo al escenario clínico tk~cripto en cada caso. Además, asegúrese de consultar la parle final del texto, donde encontran\ el indice y el glosario que le permitirán ahorrar tiempo al buscar términos desconocidos. Los apéndices Lienen las respuestas a las preguntas del final de cada capítulo, así como resúmenes de física, logaritmos, y genética básica. Las últimas páginas incluyen una tabla periódica de los elementos, diagramas de las posiciones anatómicas del cuerpo y cuadros con conversiones de medidas y valores norma-

les para los componentes de la sangre. Tómese unos minutos para ver todos estos elementos, para poder aprovecharlos al máximo. Es mi esperanza qL1e, al leer este libro, usted desarrolle una visión integrada de la fisiología que le permita entrar en la profesión que eligió con respeto por la complejidad tlel cuerpo humano, y con una chtra visión del potencial de las invesligaciones fisiológicas y biomédicas. Deseo que encuentre a la fisiología tan emocionante y divertida como yo. ¡Buena suerte en sus estudios!

Cordiales saludos, Dra. Dee (con10 me llaman nus alumnos)

NUEVAS ILUSTRAOONES DE REVISIÓN que agrupan de manera visual los conceptos fundamentales, pa ra que usted pueda repasar rápidamente los temas principales.

Enlaces moleculares Cuando dos o mlls é!DmQs se unen companiendo elecimnes, """"' U111dadM llamadas mo~ulas, i.a Ollr\$1etenc,a de ele01/0ll8$ de "" • - a, otro o el heel\O de qi,e dOS 11,omos ool1'4)0ttan _,ones es UM pa11.e cñtk:a para la lormac:IIOn de kls enlaces.. qú8 son la.s uniones enl.{e los átomos EnlacO$ covakl'J'tto.

Los enlaces cova1en1e& se generan C1J:ando !OS atomos compact81'I eleict.fones. Es1os entac:e••ecperen mucha ene

e o 10rT1perse. (aj Mohkulas no polares la$ moMcutas no p«:Wafti tienen una dl511t>oolón unifo,me de electrones. P
,,.,_1'1S

béf"tdet\ a ser- no polarM

(b) Moblculas polan,s

Polo negat,vc,

l.a$ maléCVlaS PQtares 11enen reglones de carga pa,cial (¡,.. o b-). e efemplo

más 1mport1111le de una rnoléc


.

Molécula do ag~a

~~

'.t:\ ~

Enlaces"º covalenlff (e) En~ces ~leos

--

Loe «ilaces iónicos son atracclooos elf>ctrost.&it>Cas ootre iones. Un ojen-.:,lo común os el doNro de sodio.

(t[ -

........

-...

Na

Atomo do SOC:OO

•...

/

A1omo do cloro

El &Odio cede su únioo otectrón retenido debiknento al cloro. creando iones sodio y okxuro. Na• y es-,

t(N a ~ i(G=

....

)l

Ión de 800"' (No') Ión de CIOtO {Cl"l Los K)lll!S s,od10 y cloruro tienen capas externas estables que ocupadas complelamente por elldo SOiido. los enlaces l6nóoo$ IOtmM un criS1at de CIO


••'*'

{d) Puentes de hidrOQono l.os puoc,tes de hidrógeno se rorman en,,. un átomo de hidrógeno y ""ttomo cercar10 de OXJgeOO, o Mor. Emonc.s. po, ...,.,~. las reglooes pola<es de

""'ógeno

moléculas de agua actyaceotes les permi\en torfl')Br puentes de: hidrógenos entte sr.

los puentes do hldrós,eno entre las moléculas de agua son l()s responsable& de la toos.tón supe,tidal do1

agua

(•l f...,m,o de V•n der Waal• La& tuettas de va,, det Wa~s wn atracciones dablleS y no ~tficas Mtre Jos. 8tomos..

XXII

NUEVAS ILUSTRAOONES DE FUNDAMENTOS que muestran los conceptos centrales de cada capítulo, ayudándole a conectar las ideas visualmente, y a ver el cuadro general de la fisiología humana.

-·-

• FIGURA 7-3 FUNDAMENTOS

Síntesis y procesamiento de las hormonas peptídicas

"°"""""'

l.a$ pep1fdieas se""'"''""' c,c,mo o - P < ~ • ,riae1wll$ que c..,._ una sec.,encia sella!. urns o más cq,IM
(4) Ptop,ohormon..

• Je ARN mensaiero lllB -. a m i ~ ef'l los

Las p,ep,oTR H (lwmooa liberadora do ,1.,1tQpl,,a) con1Ieneo - oopias de la no,mooa TRH ce 3 amif".10éicitios.

n $0

rlboS

rma, una cadena pep4 ldloa

oa.rnada p,ec:,rohof'rnQoa.

1.11 cad"'1a es ool'ld..,ióa hJ)cia. la lut del RE (X>I' una secl.Jenao aeñal for..

endoplasmótico (RE)

1! (1001)0 ProproTRH (242 aminoioldos)

m.ld• pot' erninoáadot..

procgs,a pan

formar

4 t l.a$orwiao del RE

4llDtDQJIDlD

cortan lB secuencia 98ñnl. ganemn-do ,.mo prohorTflQn&t Nctivn

6TRH (coda una de 3 aminoécidoó1

...

(D(D(D(D(D[J Otros fragmentos peplid,cos

n

+

Comple¡o

Secuencia &eflal

de Golg,

oc-: ~) e::--~ e:::

(b) Prohomlon.'lS

se p,oceS1J pam (

º~--J' d ACTH

o

e

~1.11 oe

«=J

+

LEC

l!vos mas fragmentos peptfdlCOS adidaoa'fe8

Ó~

. - ,..

__.----

1 copilar

l La vesb,la secwtOf'a

'11111

----

___º_,... ,\ '... Endolotlo

Fragnl8nto pepUdico

hermona p~ tocmar uno o más pépódoa- ~c-

Ft"ll"""'IO pepUdlOO

-::-------~•;oc~r~oc~,oo~~

] 11end<>rlloa , l~rop,na

con entimas y pr.ohormonas 8rl su inl&rio< emerger, d~ GQlgL Las ..,,im. cortan I• ,xo-

0 1

.-et°"' ,

4 tLas vesfcul&s sec,..iora,

Ve:slcutn ©=-Hormona ai;tiva

Proplomeianocort,na

lormnr

desde el RE. a traYé$ dd complejo de Gol~I

-Sb

~.,.....-r---.~ ~

tas p,ohOrmOnaS oomo ta p,oplornetano"""""'- la p!Qhormona de la ACTH, p~oo COl'\tener ffllJChas secuencaas pepcldicas con a<:ilvidad bk>l6glea

4 JLa Prol10IY!lCl1" pr,sa,

-

libera su CQntGnido pe,, ""º"'"'"Isen ol espacio fl\lMCOkJW.

\::

r!_ _ _ Haclo 1¡¡ .., I diana 4

'

•· t • •

La holffiONI lngn,soa b olrcubooón para se,

tm_,:la tio.cla "" diana.

te) Las prohorrnon1u1son procnadas para formar hórmonati activas mld lrag:me,no• peptJdlcos

La cadena peptldca de la prohocmona do b i:nsulin:i 1epliog3SQbnl oi mlsml

oon la ayuda de puoot.. óloulturo l~SJ. La p""10<· mona se rragtnlClla y torm.a ,nsUfina v ~ldO e

+

PéptidoC

XXIII

inician cada capítulo con un problema que involucra una enfermedad o un trastorno, y que se va desa rrollando en segmentos a lo largo de las páginas siguientes. Las preguntas en cada segmento le obliga n a apl icar la información que ha aprendido al leer el texto. Puede cont rolar su comprensión al comparar sus respuestas con las de la Conclusión qu e se encuentra al final del capítulo. Tres nuevos Temas Relacionados aparecen en esta edición: uno sobre encontrar información co nfiable en Internet (capítulo 1), otro sobre el virus del papiloma humano y el cáncer cervical (capítulo 24) y uno más sobre el cólera en Haití (capítulo 21 ). LOS TEMAS RELACIONADOS

Al S,l,tr df N l)tlll!f!fl Clait'c Of ~ + MW'f/lfd.)o U!'I ~ l'"~H!!U:~~~m.tdrt 'P<,,t b \lOI, Ü!Nfl"lt.Nl'{fl
t1tal!;¡¡,'(amc,•1"'tct.,. ,1 ~ -1»,.,.,.,...Ndotrm llltlil'l!I ~ ·n<> IN"- Cll'b11,., llriPOl'1.l ! ..*f li linO' ..;toli, nllm.,! .¡_c,i,e llolloJr --o.._ i mnty,-, ~ .,._; MU.!1.\11 JI m6*'-i dt111.lt'!ffil. ~ IO'l'l,-iiSt,,,,f!IV.,_n;) ~IOIMI ~-ot MI ópode


"'"'°

,,..,~o(IUO

o

c.xui,,...,~

[emailprotected]~ al

J . 1:1\ ti .r,tlallo-df /lt#-ü«1.0t1 IIMUI l..fmll)' fll-Jl;dl) (S(( ti . ...

-( ~ ~¡!;Oc' ((lf!Ull<, ~ ~ _ f d , t

lor~ . w " ll;clr,a~~l111~•1

(Qr,I> -cliaib«.ir) jql ~ - $ ~

•,¡.,......_ ¿qw:

~ief'lllbia yb dlll>e~,

•ffl~••lldo

4, ¿COfflO-p;te!W fÍ"'l'"J ¡wf9M'~' ~ dt.>~.ill!n CllÓ ~ pitJlflaWi:b-,'


s. ~ a a . awttmd4iltrfWlr.ttkl1dt Ji,; bd~ .n ,V,M..,.¡
.. ¿Ql4dijo Mil"? I Sll m .tclfl(' ~ \il: . M l ~ ~ •C't..lblt iiilwkw p.,,o1.\¡J d¡,abt«!, G90 2 ,

JI"""' !ffl\11\J ~.. "NO tiloY ~ 111'0. N Ñ . ~ " M Jolo 1~ dit h.c:• fo""'°' p . . u .tl •fl.blutu 41 tolltt-.+ tt!f11ilr ·11~ to rur,h\. p+io"' lltl'l'lp) p.;-¡ tO'I,... ,.,,- ·11,,1 ~ ~ ~ ,,~<«iSIIIJr)' ~ r \1

"°''"..

,...,!mret• t11'!<"'1t.o ,,,--.:,;., r -Sue,ongo

qiw ,;i, c») 1rn,

_. c,.16

p¡H!dcl MllQWlt" 'Mlffly (ORO la- flVr"llllf:itdon y p,'!fl\Ó· "'Y dclt-.¡q~--

U (*'lt4illl Mi l'fl1,1IIICl,os dl!l)Hl,- IL-- l COl'SIP~l"ltl'll.e $ofl "!J'fl"J-"'l~.J) afl,tu;

.!.00(11 ltrPC.~

fflVC~i:ll('flM ll,IO lo, l'lld-rir- fMllt.1iiotl \'111"' '1W_l)l,'1ld• -~ , r , : : ~ ~

T-Odo-,4at~IO) p.il)ll(•~f>O'"r.isQfplr.K~n.wo~ "".:N"lorodas itld!tai q11e l.11 ~ lel que j),.ti.k."-Cfl llobt(t-5, 11vG 2 f)l.lclÍ:''I la.d!l,,W II WIN. lU:'. p.ll,ltflit$ d1,bettw1 ~ \fl 1k'~• AA l)IOÍl,ir;ln,t,ts"• i. ~ tr,.*"(..o d e ~.«1hM1k.tlf,,;)t.)Ol)r11t ~IC"

4eilirla.n hiiCAtf, 7 - 1.~••~IQeao~IQl po.,t,w..l~ flOl~/\MIOfUI V M ff'lcw~/l'lf'l()lf .tdAl4tt"'1tllCl'"'"'11YQ rll.d)l•J~f

:..••.. .;:.::.

Mr••

U ~Jli>d.. NC~ 11~ w• 1Q1

lr.._..,.,...-,w, •h.e,,-..I..-0..'1\19' ~ p,11~--- ll-

do. Pf"Ot.l(iDD'dl(t1Jna no~~ o.~ hmthénincfai ~ Jl,,1!0o,~

~«•

•1i.'IU

,,-.-St4'11'tl:Q.~ ll


t"-losp.~rfltnrJ~w~nc:w-tr~f9fc¡t.,nf'Yt"rdo'WMnr'll'f'iot,... ..t.ttl lr&Q.'fl,etl.tM~~-"lt ~ r e !k'bl!r&li"l *"'fbm-..i, • ru,, Pl'Of~ dé'''41\M,f SOlll11t<w"..1..,lt'l wll..•t1W o ~ ~ll1•"9~D ~4!, lt"1c,1-~,,r::ltt-

··~··

f,mílía• da gene, lnm¡port•do<es

Un ,e.suhado dt!I ptO)«t(I C.hOr'M Hum111n0 ha ~ido .i ~«1tr1lfn".odt que m...:ltai prc,t~P\1:1 tttin re!~ ~ " Cl'ltft $1. taf1\0 [emailprotected] de liM ml~a espede como f!rnA!: d¡,1ff\ l.tS e,;pecles. Como ttsu!1»do, loidenuRcot.hln Clescub-ietto q~ la 1Nyo-

tl• de kli, trMiPQn;td~

~ ffltfflbtiM p11111

dtJtos ot9An.lco,

l)t~etltc.tn b unb de dos "~'ltrflW'nilJM'" dt ~ IOS trll~r1bdórti ABC (del ~ ArP•b.lJldittg awttttJ ó 1.t w¡.,erbn,;11.t de tr. Los uampo,t.-blfl dtt L1 í.amlt.a AJr \.díli:riln «-:'f'9~ dd ATfl paf.a tr.,.n~ ( ~ UIAorg•nic.n: ptllq\19ñ~ 41 " " ~ de~ f!Wffl bf.lnas. e,; lft @N!1iWlt!' Wf'<'Bí q\le el caM~ de dof\lroC~fP., ue-

LOS RECUADROS

~ t i 1n1.-,1U1 drff .-.) 1"' \tif, 1111' OCN.O lJ~de: f'IOd!<.,,. obw!W d b11llo r.k Llu110.'Cltasl.l~blolo111l11b . ~:,e,j 1v41,., t


'il ,~iau .,.., ,,wliO w m•ro t..e,'lt-:'I".

P'"'"°"'

Wl'PffO obttn-doGt i. 1t1tdu-u. " """ dlli, moH<.tJI•, q-.. lo. (ltC'!tlflce• llllll...... p..'• df'1.:c.r Is p-lH4ifleil 6t ÍOl' rel="nofollow">el (11,, c:IO<M'i tlll ~ f'f'411,e:H"i<.e\lli• Cilitl6o lo) ~ · St: ((JM1)/lrll eG.!\ ~ Uldo. t ml~ IMli 111'1 (IIH" p.;edf' w,, 11\edl!M poi SiblNNt

. - .nwr.,_ dr do


Cllt "'"'Wf!(flt o ~!otNn t*.lod

""'"'"' °""""

Ull.:llfl_.ilt,.. lttJI ""llffllli'll 'il can:1.xboctcolt$1«ot ttr,)U()tl!t~hl Sido 1& rtc0~ d ó11 jlOI -.d!OII .il'íll!l, tPor qi.oflt'llld\o ( ~ l..,,ul,_.,. ,.....p,_$11 wlud1 O\.'fP'Ué1 dlt tadrl ~n'

l l'IIC'tllf'I ~ l4m~'(C*"llt IIMeWde llourmaiw ~ (Cóffitl bl bOfmtJll-ál ~

S., ffflb.1t00, t•mbldn n dtno q~ nNttfl tl«1.' tdo& dt OQl,IM.,.

,oc en•,,1,...COI\Men,w~ ~ " ~~

.

U1\$1U011 ~ .. t.ditl~ ~ieawtld~ t dldJ<~W\lotdlr Lde-

te-10len w t.w;te-lfl;k-.rtOlnfitl"OJtfflbl no~ WI dlrtl.t!N) ' "' ~ ~1.,~til!lia-de,,01e,u,fd.fnll~f' "I ti:it!o.1!-1#11 Ndl ófobo i.t tt~Xltl.l "'' tdo i u l'lf l"l(ll"<'l.1'- dto •popro-.H\11 pata tlatchit tv.diotclvbit. a tt.nspb!Udot ,.,,," tnrnoiP .-'"t,, ~,n"'h"i'C'6<'ff~ Uflt-. po, "Mft } igl,I\ m ~ lf.(I, Cu.an.kt d , Ofl'll)Í4jO LOI.


""*"

~ adtW-ttoitllf' ,.~.,...,,,.,.....,_ .ttf'dur•Ol""l'-~o-#h1~

•1i1~~1~111,tW1-no,, • \l~Wio. • --,n, t ooi á~ I fni!Slf' tu.nocno-..1.l K'lln.,IIJdór\ dt o:ile1terGf


tffl....;ot~t,lt,(woy COl!Cr:ib\l,.a".-. ~ ~

,lUQue$ O !~ M .

XXIV

destacan las investigaciones en fisio-

logia y medicina. Tres tipos de recuadros le ayuda n a comp render el papel de la fisiología en la ciencia y en la medicina actual: los recuadros de Biotecnología ana lizan aplicaciones y técnicas de laboratorio surgidas en el mundo ráp idamente ca mbiante de la biotecnología; los recuadros de Aplicación clínica se enfocan en los aspectos clínicos y patológicos; y los recuadros de Novedades describen los próximos avances en la investigaciones fisiológica.

organizan los procesos fisiológicos y sus detalles en un formato visual y lógico. Estas figuras usan colores y formas que se mantienen en todo el texto para representar los procesos, y lo guiarán para com prender mejor las funciones fisiológicas coordinadas.

-~o--.-~'/f'i!l'II...__...,.

..-111o•Ul'lp)•••~~-~--

~... , O..Ol.lbo•"'!-......,llla,;t,1,1':.tlflllllt,

l'l!!ill'>!-~~0..~111 ... ""115(1.K'f~"lr.llO.-"OI

---

que se encuentra en la página inicial de cada capítulo, enumera los temas que usted debe saber para comprender el material que se va a presenta r. Los números de páginas de referencia aho rran tiempo de estudio, lo que hace al libro de texto una herramienta fácil de usar. LA INFORMACIÓN BÁSICA,

'ICl'l,&K). MIOUUJIIU

t.l,


·•~on-ilittll•ll(".....,.
!!

·-

......,.:

o

NUiQUHt A

~~""""°'"'"..... C0"1ot~i:J91 IN06

....1,r,,.,11111¡.....,,.-,. -..-.......... """~

~

LOS VÍNCULOS CONCEPTUALES son números de páginas en puei.;t;.1 c-dub:r pur medio dr un si.stffllil dA.' mm1tlucriJfl ,l.- setldltJi• Fig. 7~-1). Mochas. honnoruu pepndícas cjer«n sm efectos a tray· lcm.u que ul-i!l:t..Jn ~I AMPí 1-omo M!J;undo mcns,tjcro. Als

r;ves Je hclm1on.iS pcptidkas. como lo~ de insululJ. (>O'e

color azul incluidos en el texto. Conectan los conceptos que usted está leyendo con temas que se analizaron antes en el libro. Los vínculos conceptuales le ayudan a encontrar datos que usted puede haber olvidado o que pueden ser útiles para comprender la información nueva.

1.SY~OAS

"~· ~·- M.r • _.25,_u,

1,..,r-1-""

~,< ,.

P.. > •

t +--""-·-·---t· -

,.

-

t',¡ •l'&l'"lf"li-1; U.t•of'

I

t P¡, • l , e ~ ~ " - - : H i . l ~ddGuli.!6Ci dt:bl~üt:

1 , ..... P"M. . _.,Qlll(. ~<J. •

....,,l,tl_ów,1,._1.19¡_,.~ W-tlllJH1tiltill'll\!t',,QICli!ll(¡,.-);1

-;;¡- y,_.,-

fomentan el pensamiento analítico, ya que le hacen interpretar y aplicar la información presentada en la figura. Las respuestas a estas preguntas aparecen al final de cada capítulo. LAS PREGUNTAS DE LAS FIGURAS Y GRÁFICOS

G PM®HrA g ~ · Qlle")I ~ ¡ y . ~ A.. !P,tlel'ti «:dn!YDe:t«1110.. unc.p1w...,.....~,c1, ~ -

-

ht• :,O.ftntl\),.t!lla..-1-4t1g,a.¡.IQ)oa .-~H!>wialt-:119'11Q 1í4'1:r-> ¿\l..,,,.._..~Ol á

HCU..OIÓN U.T~ C,V.OA YVfLOCIDAO CN O. MÚOOUl..0 ~ - - - - 1 . ........ll1CO

G

l

PM:GUNlAS t ¿f,l\tM,Pt,,rtO


i•

~---IU~4

Olk'ClciWIOn" ISOlft,jl,IC.l'¡I

t ¿.Er qui, wwo III oomr~ lo1lfbel¡J¡V"

<

!

~r.,_.,111..._ ~,,.,._t.o• ..

1111•ioru1ta

1'.

,Pllfqt,lf ill'\dn¡Oebnd111inimrwi;ior-VO pa-onttral,arno.ma;ir,µaion yrio por vil cral,.CCffl)Ull~?

1l Alo! pod111,e1,i,o 10""""" po,c-cl.lói


""""'°I('"' loif~"""duó>ld,.-J pot1,,,,.,_,.....,._dtK'.

, . ~ . , ~ ~ 1"f qo.t ~loll>O


1t En m-. I• fll/. ,J>1,gj¡,1in, t~Nl•>'I "' onl>lhldcs dt ~ 1:1"4 Esu JI<""' bb¡¡.,i.aro
d - ~ ....,..,~ ...1.......dt~diltct><

están ubicados a interva los a través de los capítulos, y le ayudan a probar su comprensión antes de avanza r al siguiente tema. Puede comparar sus propias respuestas con las que se ofrecen al final de cada capítulo. LOS RECUADROS DE REVISIÓN

-

""'••""'•........... -

XXV

Las figuras sobre TEMAS ESPECÍFICO • destacan la anatomía y la fisiología de órganos importantes que a menudo se omiten en los textos de fisiología, como la piel, el hígado, el bazo y la glándula pineal.

La glá.nctula plneal

-

......

·-

........ .. --~.....,-------··--

l.a . . . . . . . _ . ... . . . . .lo¡f* . . . . . . . lf/l',,I\ r-.u,urall!CN'll'J.,....__,_OIIII__....,__

t'40o'~f-'2"1».,.,._ .. ,,...~..,.......,..... .... ....,, """" ,........ ,.

....

• ..,,.,\l>l_•.,._...,.¡.,..__,.11Mta ......

fc.a,.-...~.,.wWSlll:ilO:• ....,.._,_ .....,.._ - ~

LOS RESÚMENES DE ANATOMÍA brindan infor-

mación visual abreviada de un sistema fisiológico, desde una perspectiva macroscópica a una microscópica. Ya sea que usted esté aprendiendo anatomía por primera vez o quiera refrescar su memoria, estos resúmenes le muestran las características esenciales de cada aparato o sistema en una sola figura.

............ ........."-·~ -·,~·--~ . . ., .~~,-----~.........,._ .. ................_...........,_....... __ .,,._ ..... ~-·--_..,, ........ ...,.. ~~------¡,.--... ~...,....... ..,,.........,. ~.,.. -.....~----------......-~ .............. -.__

,

..

~ _,,..,.,""~~•~ .. .,....a..... p,r,llllot,..._. ..,

..,._.,.. ,• ...-.... ~ u........,.__..,)................

l .."

~ ~.~ W l k .. u,'I

QÓO . . . .Ól~0(.151fta_.,. . . . ., t l l # ~ - - d 8 · ~ - i - , - 0 ..,1

" .........."'........._ ~ ,......,..,....,.,, ... _ilio_.,..,....,.,.

..

o11..-....~.N1_ _ _ _ _ _ _ ....,.._..,,~6" ........

1

__ ................... ......... ... ------------~-

, . , . . . . ~ ~...~..-.Htl,V,~ . . . . . . . . . . . . . ........

--·-I.Jl"**'IA1llllfo•-----ow-111---. -~c..li.ll,QI••*~•·•~· "*••,):o ,w,,, ~tt1 ~"°,.."""*"e,a,t;1...,.,-11, ....... .,...u~inU..,@ _._ .. ......_. ,...

..+-----'

e.,.,.,,.

~

ª"...

~

~0(11•

......A,) · -

• ....

~

._.~,.....,.,,..,..,,..-,.,.,..,,., ,n.e,oa~ "',. ~ . -... ~~l4illlt'hti ............ ~ - - - - ~ .. _.....t-*1 ••...... ~ ..............."(i• ..w,....r,,

b>.,.,.......

i..,ts ...,.......... -

.....

__

,-;;1o11...,..._

~"-M-,t.oo.~t..-..a,

,_

....._,

....,_ '

.i~1 ttll')l-aJit•

·---....-~_,.-.¡_ ,__, .__

Ea:truetun del corwzon

jj . .11-11,g,u,

!~lllllffl"'llCIIL4

..... ......,

....... ..... __ ~º----------·,

--..

,........,

......

_,---

~

..

.,......

-~.....--

__ fe.,,._ .. __..

-

... -

--

,......

li,e~o1-111•Mitct.dd _..u...,....._

.......,__.... ..,.._ ....... •- r....,. .......-..i,.¡jqj ~

\

....

_, __---··--·_ ---·-

_ ,.__ ..,.,, _..._t___ ~.:.--•• - · ~ - ,......o'll,s .........• ~ l - ' 1 -

t., . . . . . . . . .

.... ··""""'"'

XXVI

-

--

La sexta edición de Fisiologú1 Humana: un enfoque integrado se basa

en un abordaje detallado de los temas de fisiología integrada y molecular q ue han sido las bases de este Libro desde rn primera publicació n. El texto ha sido revisado con numerosas actualizaciones de los contenidos, especialmente en las áreas de la terapia endovenosa con liq uidas, la transducción del sabor,)' la fis iología del músculo liso. Algunas secciones del texto se han reorgan izado, especialmente en la p rimera unidad (Capítulos I a 6 ), para perm itir q ue es tos capít ulos introductorios se enfoq uen más en temas de interacciones moleculares, compa rtimen tación, energía biológica, din ámica de las membranas y comunicación e in tegración. El anális is sobre homeostasia se encuentra en el Capítulo l. Las vías de metabolismo anabólico y del catabolismo de grasas y proteínas se pasaron al Capítulo 22, como pa rte de la expl icación sobre el metabolismo de estado alimentado y en ayunas. El Capítulo 4 ahora se aboca al tema de la energía b iológica. En una importante revisión de las ilustraciones, hemos creado las figuras de revisión con material que la ma)'o ria de los estudiantes debe saber de cursos anteriores, y las figuras de temas esenciales que pueden servir como resumen rápido de un tema. En la mayoría de las ilustraciones, el título y las leyendas se han transformado en pa rte de la il ustración, para hacer más fácil la obtención de información de la figura.

Actualizaciones de los contenidos en cada capítulo

• Un nuevo cuestionario de revisión permite a los estudian tes eval ua r sus recuerdos de q uím ica b,~sica • C',omentario ampliado sobre interacciones proteicas • Figu ras de revisión: Lípidos; Carbohidratos; Proteínas; Nucleótidos; Átomos )' moléculas; Enlaces moleculares; Soluciones; In teracciones moleculares; pH • Figuras sobre temas esenciales: Activación e inh ibición de proteínas; Factores q ue afectan la un ión a p roteínas

Capítulo 3 • Comentario resumido sob re orgánulos celulares • Andas de GPI para proteínas de membrana • Síntesis proteica como ejemplo funcional de cómo traba_ia la compartimentación dentro de una célula • Información n ueva/actualizada sobre: • Cilias p ri mar ias • Grasa parda en adultos • Estudio de Papanicolaou • Cond rocilos de cultivo autólogo • Nuevo recuadro sobre Novedades: Las cilias únicas so11 sensores • Figura de revisión: estructura celular • Figuras de Lemas esenciales: Niveles de organi:1.ación: compartimentos del cuerpo: La membrana cel ular; Uniones cel ulares; Tejido epitelial; Tipos de epitelios; tej ido conectivo; Tipos de tej ido conectivo

Capítulo 4 Capítulo 1 • Nuevo Tema Relalionado sobre la búsqueda bibliográfica • Comen tario consolidado sobre la homeostasia • La i.nt roducción ampliada sobre los temas incluye información sobre los conceptos centrales destacados en los informes sobre educación en biología de la Fundación Nacional de las Ciencias, el Instituto Méd ico Howa rd Hughes y la Asociación de Escuelas de Med.ici na de los Estados Unidos, y el panel de la universidad • Nuevas figuras sobre los medios interno y externo; de.~equilibrio de es tado estacionario • Nuevo recuadro de Novedades sob re El mundo cambiante de /a.s ómicns

Capítulo 2 • El capítulo ahora se enfoca en las interacciones moleculares, con más énfasis en las interacciones no cova len tes y la forma molecular • La ma)'Or parte de la q uímica básica se incorpora en las figuras de revisió n

• Se trasladaron las vías anabólicas del metabolismo y el catabolismo de grasas y proteínas al Capít ulo 22, y se consol ida ron las vías de la glucólis is, el ciclo del ácido cítrico,)' el sistema de transporte de electrones en las fuguras de temas esenciales, para que el texto quedara abocado a la producción de energía • Comentario y term inología actu:alizados para el destino de las pro teínas • Figuras de lemas esenciales: Producción de ATP; Glucól isis; Piruvato, aceLil-CoA y ciclo del ácido cítrico; Sistema de transpo rte de electrones; Sín tesis proteica

Capítulo 5 • El capítulo a.hora se dedica a los comparlimentos y al equilib rio/desequilib rio • Nueva sección de in troducción sob re el uso de agua de coco por vía endovenosa • Expansión del comentario sobre osmolaridad y tonicidad usando como ejemplo a los compartimentos del cuerpo en luga r de una sola célula. Ejemplos de cálculos para la terap ia de líquidos IV.

XXVII

XXVIII

Novedades de esta edición

• Nueva figura que muestra la difusión en gel de agar • Figuras de temas esenciales: Compartimentos líquidos del cuerpo; Osmolaridad y ton icidad; Transportadores de mem brana; Endocitosis, exocitosis y reciclado de la membrana

Capítulo 6 • Se trasladó la homeostasia al Capítulo 1 • Figuras consolidadas • Figuras de temas esenciales: Comunicación en el cuerpo; Cascadas de transducción y ampli ficación de señales; Transducción de señales; Vías reflejas simples y complejas

Capítulo 7 • lnformación nueva/actualizada sobre: • Núcleos paraven tricula r y supraóptico • Retroal imentación de bucle ullracorto • Melatonina • figuras de temas esenciales: Síntesis y procesamiento de hormonas peptídicas; Glándula hipófisis; Hormonas hipotalámi cas )' de la hipófisis anterior

Capítulo 8 • Comen tario consolidado sobre desarrollo y reparación • Información nueva/actualizada sobre: • Resistencia, ley de Ohm, constante de longitud • Transportadores de neurotransmiso res • Trasplantes de células madre • Síntesis de nemotransmisores • Nuevo recuadro sobre las propiedades de un cable, capacitancia y constante de tiempo • Cinco n uevas preguntas de Revisión • Nueva pregunta en la figura sob re la ecuación de Nernst. • Figuras sobre temas esenciales: Organi:1,ación del sistema nervioso; Anatomía de la neurona; Células de la glía; Potenciales graduales; Potencial de acción; Comunicación sináptica; Divergencia y convergencia; Respuestas posinápticas rápidas )' lentas; Suma

Capítulo 9 • Información nueva/actualizada sobre: • AnLidepresivos y crecimiento neuronal • Sueño y memoria • Enfermedad de Alzheimer • Ratones Brainbow • Nueva pregunta de Nivel Tres al final del capítulo • Dos nuevas preguntas de figuras • figura de tema esencial: Desarrollo del sistema nervioso

Capítulo 10 • lnformación nueva/actualizada sobre: • Transd ucción del sabor

• Aspectos somatosensitivos del gusto mediados por nervios craneales y receptores TRP • Melanopsina y células de los ganglios retinales que contienen melanops ina ( mRGC) • Procesamiento de las señales en las células bipolares de la retina • Tratamiento de la enfermedad de Méniere • JnvesLigación sobre dolor • Canal de sodio epitelial (ENaC) • Canales receptores de potencial transitorio (TRP) • Receptores T l R (dulce y umami) y T2R para el sabor amargo • Papilas gustativas: tipos l, n , UJ y células basales • Células retinales bipolares, subtjpos ON y OFF • mGluR6: receptor metabotrópico al glutamato en la retina • Figuras de temas esenciales: Gusto; Equilibrio; Optica del ojo

Capítulo 11 • información nueva/actualizada sobre: • Abandono del tabaco • Estadísticas sob re tabaquismo en estudiantes • Figuras revisadas sobre vfas autonómicas • Figuras de temas esenciales: Divisiones eferentes; División motora somática

Capítulo 12 • Información nueva/actualizada sobre: • Células satélite y células madre ,del músculo esquelético • Entrada de Ca'- a través del receptor DHP: entrada de Ca10 acoplada a la excitación • Estructura de la miosina • Sección revisada sobre la fisiología del músculo liso: • Músculos tónicos y fásicos • Modelo revisado de la organización de los filamentos • Sensibilidad al calcio • Liberación de calcio inducida por calcio • Nueva figura para la relajación del músculo esquelético • Figuras de temas esenciales: El sarcómero; Acoplamiento excitación-contracción y relajación; Músculo liso

Capítulo 13 • Figura de temas esenciales: Reflejos nerviosos

Capítulo 14 • Comen tario nuevo/ampliado sobre: • ECG • ConLrol autónomo del volumen minuto • Relaciones entre longitud )' fuerza • Tres nuevas preguntas de las figuras • Nueva pregunta de Revisión • Figuras de temas esenciales: física del flujo de líquidos; El ECG

Novedades de esta edición

Capítulo 1 s • Comentario nuevo/ampliado sobre: • Control de la presión arterial • Control selecúvo de las dianas de los centros de conlrol cardiovasculares • Nueva figura sobre la integración del volumen minuto y la resistencia • Nueva pregunta de Revisión • Cuatro nuevas preguntas de las figuras • Nuevo problema cuantitativo al final del capítulo • Figuras de Lemas esenciales: Presión arterial media; Control cardiovascular

Capítulo 16 • Recuadro de Novedades sobre la terapia con plasma rico en plaquetas

Capítulo 17 • Información nueva/actualizada sobre: • Secreción de líquidos en las vías aéreas • Glándulas submucosas en las vías aéreas • Pleura visceral y parietal • Ecuación de distensibiljdad y elasúcidad • Nuevas figuras sobre la secreción de líquidos y las glándulas submucosas de las vías aéreas • Cuatro nuevas pregtmtas de figttras • Nuevo problema cuantitativo al final del capítulo • Figuras de Lemas esenciales: Le),eS de los gases; Ventilación

Capítulo 18 • Información nueva/actualizada sobre: • Ecuación de Fick como ejemplo del equilibrio de masas • Nuevas figuras sobre el intercambio de gases alveolares y la unión del oxígeno a la hemoglobina, la ecuación de Fick }' el balance de masas • Figura de temas esenciales: Curva de saturación de oxígenohemoglobina

Capítulo 19 • lnformación nueva/actualizada sobre: • Transportador de aniones orgánicos • Transporte activo terciario • Nuevas figuras sobre reabsorción en los capilares peritubulares y secreción de aniones inorg,\nicos • Cinco nuevas preguntas sobre las figuras • Nuevo problema cuantitativo de final del capítulo • Figuras de temas esenciales: Función de la nefrona; TFG; Clearance renal

Capítulo 20 • Información nueva/actualizada sobre: • Péptidos natriurélicos

• • • • • •

XXIX

• Ecuación de Henderson-Hasselbalch • Efecto de la ANG 1T en el túbulo proximal Nuevos Cuadros endocrinos sobre aldosterona, RAS, AVP y ANP Nuevo mapa para aldosterona Nueva figura sobre las compensaciones de las alleraciones ácido-base Nueva pregtu1la de Revisión Tres nuevas preguntas sobre figuras Figuras de Lemas esenciales: Aldosterona; RAS; AVP; Péptidos nalriuréticos

Capítulo 21 • Nuevo Tema Relacionado sobre ,el cólera en Haití • Jnformación nueva/actualizada sobre: • Glándulas salivales y secreción de la saliva • El reflejo de deglución • Orlistat • Transporte del hemo • Absorción de hierro y calcio • Nueva pregtmta sobre figura • Nueva pregunta de Revisión • Nuevas figtLras sobre absorción de hjerro y calcio, y regulación gastrointestinal • Figuras sobre temas esenciales: Secreción; Digesúón y absorción: Carbohidralos; Digestión y absorción: Grasas

Capítulo 22 • In formación nueva/actualjzada sobre: • Influencias psicológicas sobre la alimenLación • Recomendaciones sobre colesterol • Dietas cetógenas • Estadísúcas sobre diabetes • Criterios revisados para el diagnósúco de diabetes • Pre-diabetes • Estado hiperglucémico hiperosmolar • GLUT4 en el músculo en ejercicio • Vasorulatación cutánea acLiva • Receptores beta-3 • Grasa pitrda en los seres humanos • Metabolismo de proleínas y grasas, que se trasladó del Ca pítulo 4 • Nuevos recuadros sobre IMC y sobre antioxidantes y radicales libres • Nuevo gráfico sobre interacciones entre insu)jna y glucagón • Nuevas figuras sobre los factores involucrados en la secreción de insulina • Nueva pregunta sobre figura • Nueva pregLL0ta de Nivel Tres sobre experimentos sobre respuesta Lermorreguladora • Figuras de lemas esenciales: Vías bioquímicas de producción de energía y síntesis de grasas

XXX

Novedades de es a edjdón

Cap,itul'o, .23 • It1form. 'ón nue ,a/a hia1i.zadá obr : • Trnn ·portador s limid o • E teroide · :x:u,ale y ·redmienLo ó.�eo n la pubertad • TRPV , • .ECaC • · �euronas PO 1C en e] bjpot Jamo • Nueva .figura . obre la S cecreci n ácida n Jos o teo ·la lo • Figura de temá e en · al: Hue o

Cap,ituf o .24 • Nue o Tema Relacionado sobre HPV. cán r ·ervi a1 }' a u­ nas. contra HP • ue a fi. ura� oh.re ,e:lr 1 -tur bacleri. na y defi n ·.a. d primera ]í11ea

• Do nue ms pre untas . obl"e figura • Figuras de temas e en iale : tnfec. ·on Infe . ion . ,irale

· acterian , ·

Capítul10· 25 uevo problema, u. nlitali o. obr voli.1.men minuto eJ 1no

Capítulo 26 •· lnJormadóo :1 Lteva/a tu. ]fa d. -obre: • Cir un isión ma ulina. ., HIV •· Fina t rida 1 clncer prostáti o •· AlVll H romo indicador de fa. función ovárica • Nueva fi ura ·obre el. desarmUo Co1icwar • Figura de ternas esenciale ·: fe_rtfüzadón

XXX

8cribir, editar y publicar un libro de texto es un proyecto de grupo, que requiere el talento y la experiencia de muchas personas. Ningún científico tiene los conocimientos detallados en todas las áreas necesarios para escrib i.r un libro tan amplio como éste, y estoy en deuda con todos mis colegas que han compartido con tanta generosidad su experiencia en cada edición. En especial quiero reconocer a Bruce Johnson, de Comel/ U1ziversity, Departamento de Neurobiología y Comportamiento, un gran neurobiólogo y docente, quien una vez más se aseguró de que los capítulos sobre neurobiología fuesen exactos y reílejasen los últimos desarrollos en este campo tan cambiante. Muchas otras personas dedicaron tiempo }' energías para hacer realidad este libro, y quisiera agradecerles a todos, en forma colectiva e individual. Pido disculpas por adelantado ,1 aquellos cuyos nombres he omitido.

Contribuciones de estudiantes

Revisores

Los siguien tes estudiantes sugirieron temas q ue aparecieron en esta edició n:

Estoy especial mente agradecida a los docentes q ue revisaron uno o más capítulos de la última ed ición. Hubo muchas sugerencias en sus amables rev isiones que no pude ind uir en el tex to, pero agradezco el tiempo}' la consideración que pusieron en sus comentarios. Los revisores de esta edición son: Lisa Bonneau, A1etropolitan Comm111zity College-nlue Ri11er Erick Bo urassa, Facultad de Medici na de University of Sirll

E11st11ti11s 13etsy Branstle)', Universidad de Valencia M ichael Buratovich, Spring Arbor U11iversity Tom Davis, Lom.s College Cathy Davison, SUNY Empire State Co/lege Joseph Esdi n, Antelope Va/ley College y University of California en Los Ángeles Suzanna Gribble, Grove City U11iversi1y Steve Henderson, California Swte U11iversity, Ch ico \•Villiam Jurney, Nomumdale Community Co/lege Dean La uritzen, City College of San Francisco David Mallo ry, Marshall University 13yron Noord ewier, Nortlzwestern College Ryan Paruch, Tulsa Commzmity College Marck Smith , Santiago Canyon College Jasan St.randberg, Century College Jill Tall, Youngstown State University vVendy Vermillion, Columbus State Commrmity College Muchos otros docentes}' estudiantes ded icaron tiempo a escrib ir o enviar por correo electrónico preguntas o sugerencias para aclara r temas. Siempre me gusta recibir estos mensajes,}' me cüsculpo por no tener un lugar para reconoce rlos ind ividualmente. De especial ayuda en esta edición fueron Ana Mar ia Barral, Cuyamaca College Catherine Loudon, U11iversity of California, lrvine An ita ';Voods, University of Western 01ztario Erik Swenson, U11iversity of Washington

Revisiones de especialistas Nadie puede ser experto en todas las áreas de la fisiología, y estoy profundamente ag radecida a m is amigos y colegas que rev isaro n capítulos en teros o respondie ron p reguntas específicas. Incluso con su ayuda, puede haber errores, po r los cuales asumo toda la responsabi lidad. Los e.~pecialistas revisores de esta edición fuero n: Susan M. Barman, Michigmz State U11iversity James Bryant, University ofTexas, Austin Jeffrey Pommerville, Mari.copa Commu11ity College Marion J. Siegrnan, Facultad de Med icina Jefferson

Vitali Azo uz: agua de coco por vía IV Chun- Yu "Ji rnm y" Lee: histo ria para el Tema Relacionado del Capitulo 1 Katie Zimmerma n: enfermedad de Méniere Claire Con roy: revisión de la Figura 11 .5 }' Temas Relacio nados sob re cólera y HJ>V Otro grupo de estudiantes actuó como panel de rev isió n a medida que desarrollamos el nuevo programa d e ilustraciones: Ryan Aghabozorg Fadi AI -Asadi Kayla Broadhead Hilary Edelman

Meherin Huq ue Catherine CYKralKa Zuleikha Tyebjee Tiana \.Von

Fotografías Quisiera agradecer a los siguientes colegas, quienes generosamente me bri ndaron microfotografías de sus investigaciones: Kristen Harris, U1ziversity of Texas Flo ra M. Love, University of Texas Jane Lubisher, University of Texas Young-Jin Son, University of Texas

El equipo de desarrollo y producción Escr ib ir un manuscr ito es solamente el primer paso en un largo y complicado p roceso q ue termina con un lib ro impreso y sus mater iales atuilia res. El equipo que trabaja conm igo en el desarrollo del libro merece mucho crédi to po r el producto terminado. En esta edición, m is coautores de las ilustraciones, Bill Ober y Clai re Garrison, junto con el talentoso d ibujan te )im Giban, crearon las nuevas figuras de temas esenciales que apa recen en cada capítulo. Una vez más, Yvo Riezebos diseñ6 tma atractiva cubierta que ret1e_ja cómo la ciencia es en realidad un arte. Co rno siem pre, ha sido un placer trabajar con

XXXI

XXXII

índice

Anne A. Reíd, mi ediLora desde hace años, )' An Lonio Padial, mi cor rector. Anne Sca nlan-Rohrer, mi editora de proyecto, es una maesLra para hacer cumpl ir las fechas de entrega s in generar demasiado

estré.~. El equipo de Pearson Educatio n traba_jó incansablemenle para llevar a esta edición del manuscrito al libro impreso. Tuve dos editores de adquisiciones q ue traba_iaron conmigo en la visión de esta edición: Deirdre Espinoza, que se ret iró para ocuparse de su familia, y mi n uevo editor Kelsey Volker, que se sumó al equipo. Ilarbara Yien, Directora de Desarrollo para las Cientias Aplicadas, se ocupó con habil idad en el periodo de transición, e hizo su máximo esfuerzo para man lenerme encarrilada. Ashley Williams fue la Editora Asistente que coordinó los supJemenLos impresos y ayudó siempre que fue necesario. La tarea de coo rdinar la producción reca)'Ó sobre la Editora AsisLe nte de Gerencia de Pearson Nancy Tabor. El Gerente Principal de Proyectos Jared Sterzer de PreMediaG/oba/ manejó la composición y la gerencia de proyecto,)' el Gerente de Proyecto W inn ie Luong en la sala de arte, lmagi11eeri11g, condujo el equipo que preparó a las ilus traciones de 13ill y Claire para la prod ucción. Kristi n Pilja)' fue la investigadora que encon Lró las maravillosas foLos nuevas que aparecen en esta ed.ición. Annie v\lang fue la asisLen te de producción de medios que mantuvo a los auLo res de los suplernenLos Lrabajando y a Liempo. ChrisLy Lesko es el director de mercadeo que trabaja con los excelen tes eq uipos de ventas de Pearson Education y Pearso11 !11tematio1111l, y Derek Perrigo es el gerente de mercadeo de la lista de anatomía y fisiología.

Agradecimiento especial Como siempre, quisiera agradecer a mis al um nos )' colegas que buscaron los errores y las áreas que necesitaban mejorar. He aprendido que el concepto de darle un pun Lo extra al pr imer estud iante que i nforma un error de tipo funciona. M is docentes ayudanLes de grado han tenido un muy impor tante papel en mi enseñanza desde que llegué a la University ofTexas, y sus opiniones me han ayudado a moldear mi forma de enseflar. Muchos de ellos son en la actual idad docen tes, y quisiera agradecer en especial a: Lynn Cialdella, MS, MilA PaLli T horn, PhD Karina Loyo-García, PhD Jan M. Machan, PhD Ari 13errnan, PhD Kurt Venator, PhD PeLer Engl ish, PhD

Kira Wenstrom, PhD Lawrence 13rewer, PhD Caro! C. Li nder, PhD Sarah Davies, PhD Finalmente, un agradecimiento especial a mis colegas de American Physio/ogy Society y Human A11a10111y & Physiology Society, cuyas experiencias en el aula han enriquecido mi prop ia comprens ión de cómo enseñar fisiología. Tamb ién quisiera reconocer a un grupo espec ial de amigos por su con ti nuo apoyo: Penelope Hansen (Memorial U11iversity, San Juan), Mary Anne Rokitka (SUNY 13uffalo), Rob Carroll (Faetdtad de MedicLna de East Carolina University), Cindy Gill (Hampshire U11iversity) y Joel Mich ael ( Facultad de Medicina Rush), así como a Ruth 13uskirk, Jeanne Lagowski, Jan M. Machart y Ma rilla Svinicki ( University of Texas). Como s iempre, agradezco a mi familia )' amigos por su paciencia, comprensión y apoyo durante el caos que parece inevitable en las rev isiones de libros. El agradecim Lento más gra nde es para mi t'Sposo Andy, cuyo amor, apoyo y predisposición para privarse de comida casera en ocasiones me ayudó a cumpli r con los Liem pos establecidos.

Un trabajo que continúa Uno de los aspecLos m¡~s gratificantes de escribi r un libro de texto es la opo rtunidad que se nos da para encontrarnos y comunicarnos con otros docentes y estudiantes. En los años que han pasado desde que se publicó la prLmera edición, he recibido mensajes de personas de todo el mundo, y he tenido el placer de saber cómo el libro ha sido incorporado en la enseñanza y el aprendizaje. Corno los libros de ciencias se revisan cada tres o cuat ro años, son siempre un trabajo cont inuo. Lo invito a ponerse en con Lacto conmi go o con mi editor para enviar cualquier sugerencia, cor rección o comen tario sobre esta edición. Es más füci l ponerse en contacto conmigo a través de m i co rreo electrón ico, [emailprotected] Puede escribi r a mi edi to r a la siguiente dirección: Applied Sciences Pearson Education 130 1 Sanso me Street San Franciso, CA 941 11 Dee U. Si lver lhorn

Biología Integrada

University of Texas Austin, Texas

Introducción a la fisiología La fisiología es una ciencia integradora Función y mecanismo Temas de fisiología

8 9 9 1O

Tema 1: laestructuray la función están íntimamente relacionadas Tema 2: los organismos vivos necesitan energía Tema 3: el flujode información coordina las funciones del cuerpo Tema 4: lahomeostasis mantiene laestabilidad interna

Homeostasis

11 11 13 14

¡Cuál es ef medio interno del cuerpo? La homeostasis depende del equilibrio de masas La excreción elimina sustancias del organismo 1-lomeostasis no5ignifica equilibrío

ienvenidos al fascinante esLudio del cuerpo humano! Durante la mayor pa rte de la h istoria, a los seres h umanos les ha interesado cómo funciona su cuerpo. Los textos de los antiguos egipcios, indios )' ch inos describen los inlentos de sus médicos para tratar d iferentes enfermedades y devolver la salud. Aunque algunos remedios anLiguos, como el estiércol de camello y el po lvo de cuernos de carnero, pueden parecer extraños, aún utilizamos otros, tales como las sanguijuelas y las susta ncias químicas derivadas de plan tas medicinaJe.s. la forma en que usamos estos tratam ientos camb ió a medida q ue aprendimos más acerca del cuer po humano. No ha habido nunc.a una época más emocionan te para el estudio de la fisiología h uma na. La fisiología es el estudio del funcionamiento no rmal de un organismo vivo y las panes que lo componen, i ncluidos todos sus procesos q uím icos y fís icos. La palabra fisw/ogf.a significa, litera.lmente, "conocimiento de la naLuraleza''. AristóLeles (384-322 a. C.) util izó el término en este sentido amplio para descri bi r el funcionam ien to de LOdos los organis mos vivos, y no solamente el del cuerpo h umano. No obstan Le, Hipócrates (ca. 460-377 a. C. ), considerado el pad re de la medicina, usaba el término fisiología con el significado de "el poder curativo de la naLuraleza''. )' a part ir de aquí la disciplina se asoció más estrechamen Le con la medicina. Hacia el siglo X\ I, en Europa, la fisiología se había establecido fo rmalmente como el estudio de las funciones vitales del cuerpo humano. En la actualidad, el térm ino se usa nuevamenle para referirse al esLudio de los an imales )' las plantas. Hoy Lenemos el beneficio de siglos de Lrabajo de fisió logos que constru) eron las bases del conocim ien Lo sobre cómo funciona el cuerpo humano. Desde la década de 1970, los rápidos avances en los campos de la biología cel ular y molecular han complemen Lado este trabajo. Pocas décadas atrás, pensábamos que encontraríamos la clave

B

1

¿Qué creer? Al salir de su primera clase de fisiología, Jimmy recibió un mensaje de texto de su madre: "Por favor, llámame. Necesito preg untarte algo". Como su madre rara vez e nviaba mensajes de texto, Jimmy imaginó que debía ser algo importante y la llamó: '¡Hola, mamá! ¿Qué pasa?'. "Oh, Jimmy, no sé qué hacer. Vi al médico esta mañana, y me dijo que necesito ad ministrarme insu lina . ¡Pero no quie ro! Mi tipo de d iabetes no requiere insulina. Creo que me prescribió insu lina solo porque intenta que lo visite con más frecuencia ¿C rees que tengo razón ?". Jimmy hizo una pausa. "No estoy seguro, mamá. Probablemente solo trate de hacer lo mejor para ti. ¿Le hablaste a él sobre e l tema?'. "Bueno, lo intenté, pero él no tenía tiempo pa ra conversar. Tú estás estudiando estas cosas. ¿Podrías consultar y ver si realme nte necesito insu lina?". "Supongo que sí. Déja me ver qué puedo averiguar·. Jimmy cortó la comu nicación y pensó: "Y, ahora, ¿qué?".

10

2

13

18

24

27

del secreto de la vida secuenciando el genoma humano, que es el Lérmi no que define de forma conjun ta toda la información genét ica contenida en el ADN de una especie; sin embargo, es la visión deconstrucLivista de la biología ha demostrado tener sus lim itaóones, ya que los organismos vivos son mucho más q ue la simple SLtma de sus partes.

La fisiología es una ciencia integradora Muchos sistemas complejos, inclu idos los del cuerpo humano, poseen propiedades emergentes, que son propiedades CU)'ª existencia no puede p redecirse basándose solamente en el conocim iento de sus componen Les individuales. Una propiedad eme rgenLe no es una propiedad de un solo componente del sistema, y es mayor que la simple suma de sus partes individ uales; por ejemplo, si alguien desarma un automóvil y dispone sus tuercas, tornillos y partes en el suelo, ¿podría predecirse q ue, una vez ensambladas adecuadamen Le, estas partes de metal y plástico se convertin\n en un vehículo capaz de convertir la energía del combusLible en movimiento? ¿Quién podría predecir que la combinació n correcta de elemen Los en molécu las y sistemas de moléculas dará como resultado un o rganismo vivo? Entre las propiedades emergentes más complejas en los seres h umanos se encuenL ran las emociones, la in teligenci a y otros aspecLos de las funciones cerebrales, ni nguna de las cuales puede predecirse a partir del co nocimienLO de las propiedades individuales de las células nerviosas. En 1990, cuando comenzó el proyecto para decodifica r el genoma humano, el Human Geno me Project ( ,v,viv.genom.e.gov), los investigadores pensaban que al iden tiücar y secuenciar todos los genes en el ADN h uma no comprenderían cómo funciona el cuer po humano. Sin embargo, a med ida que avanzó la investigación, los científicos tuv ieron q ue revisar su idea o riginal de que un segmento dado de ADN con Lenía un gen q ue codi ficaba a una proteína. Res ultó evidente q ue un gen puede codi ficar muchas proteínas. El Human Genome Project se completó en 2003, pero an tes de ese momento los científicos habían ido más allá de la genóm ica: a la proteómica, el estudio de las proteínas en los o rganismos vivos. AcLua lmente, los investigado res ha n dado cuenta de que saber q ue una pro Leí na se sinteliza en una cél ula en especi al no siempre nos dice qué importancia tiene en ella, en el tejido o en el funcio namjen lo del organismo. Las nuevas y emocio nan Les áreas de la in vestigación biológica se denominan genómica funcional, biología de los sistemas )' b iología integradora, pero todas estas son, fundamentalmente, campos de la fisiología. La fis iología se enfoca en especial en la integración de las funciones a través de varios niveles de organización. (1111.egrnr significa swnar varios elemen Los pa ra crear un Lodo un ificado.) La • Figura 1- l muestra los diferentes niveles de organización, desde el n ivel molecular hasLa las poblaciones de distinLas especies que conviven en ecosistemas y en la biosfera; muestra los niveles de organizació n y las d iferentes subdisciplinas de la quimica y de labiología relacionadas con el esLudio de cada nivel de o rgan ización. Existe una superposición impo rtante en Lre los distin tos campos de esLudio, y estas divisiones anificiales va rían de acuerdo con qujén las defina; no obstante, cabe señalar que la fisiología comprende muchos niveles de organización, desde la b io logía molecular y celular hasta la fisiolo gía ecológica de las poblaciones.

La fisiología es una ciencia integradora

3

Al nivel del organ ismo, la fisiología se encuen Lra in timamente ligada a la anatomía. La esLructura de un tej ido u órgano debe proporcionar una base física eficiente para su función; por esta razón resulta casi imposible estud iar la fisio logía de un sistema del cuerpo s in comprender la anatomía subyacen te. Deb ido a la interrelación entre anatomía y fisiología, en este libro se incl uyen resúmenes anatómicos. Dichas caracLerísLicas especiales de revisión ilustran la anatomía de los sistemas l'isiológicos en d istintos niveles de organización. En el nivel más simple de organización ilustrado en la Figura 1- l, los átomos de los elementos se unen para formar moléculas. Las células son conjuntos de moléculas de los organismos vivos. La célula es la unidad estructural más pequeña capaz de llevar adelante todos los procesos vita les. la membrana celular (o plasmática) es una ba rrera de lípidos )' proLeínas que separa las células de su enlomo. Los organ ismos simp les están formados por una soh1 célula, pero los complejos tienen muchas de ellas, con especializaciones esLrnCtLtrales y funcionales dife rentes. Los grupos de célu las que llevan a cabo funciones relacionadas se conocen como tejidos ( lexere, tejer ). Los tejidos forman un idades funcionales y estructurales llamadas órganos (organon, herramienLa), y los grupos de órganos integran sus funciones para crear sis temas (el Capítulo 3 Lrata sobre la anatomía de las células, los Lej idos )' los órganos). Los diez aparatos del cue rpo humano se ilustran en el • Cuadro ..1.:l Varios de estos aparalos tienen nombres alternaLivos, indicados en Lre paréntesis, basados en los órganos que form an sus aparaLos y no en sus funciones. El aparato tegumentario (i11tegwnentum, cubierta), const ituido por la piel, fo rma un lím ite protector q ue separa al medio interno del cuerpo del medio externo (el mundo exterior). El aparato locomotor proporciona soporte y movimiento corporal. Cuatro aparatos intercambian susLancias enLre el medio interno y el externo. El aparato respira torio (pulmona.r) intercambia gases, el apa.rato digestivo (gastroin teslinal) toma nulrientes y agua y elim ina desechos, el aparato urinario (renal) elimina el exceso de agua y sustancias de desecho y el aparato reproductor produce óvulos o espermaLOzo ides. Los cuaLro aparaLos restantes se extienden por LOdo el cuerpo. El aparato circulatorio (cardiovascular) distribuye las s ustancias bombeando la sangre por los vasos. Los sistemas nervioso y endocrino coordinan h1s funciones orgán icas. NoLe que la figura los muesLra como algo continuo ,mís que como dos sistemas separados, ¿po r q ué?

El cambiante mundo de la ómica Si leemos la literatura cient ífica, parecería q ue las investigaciones contemporáneas, con el uso de las herramientas de la biología molecular, hubieran explo tado en una era de "o rnas· y "ómicas·. ¿Qué es un ·orna'? El sufijo deriva, aparentemente, de la palabra en latín q ue significa "masa· o ·tumor·, pero actualmente se usa para referirse a un grupo de elementos que su man un todo, como el genoma. Uno de los primeros usos del sufijo -oma en biología es la palabra bioma, q ue sig nifica una comun idad entera de organismos q ue viven en una región ecológica importante, como el bioma marino o el bioma desértico. El genoma es la suma de todos los genes de un organismo, y el proteinoma, la suma de todas sus proteínas. Los adjetivos derivados terminados en -ómica describen la investigación relacionada con el estudio de un "orna", y agregar ese sufijo a una palabra se ha convertido en la manera más precisa de referirse a un campo de estudio. Así, el tradicional estudio de la bioquímica ahora incluye la metabo/ómica (estudio de las vías metabólicas) y la interactómica (estudio de las interacciones entre las proteínas). Si busca en Internet, encontrará muchas menciones de transcriptoma (ARN), /ipidoma (lípidos) y farmacagenómica (la influencia de la genética en la respuesta del o rganismo a los fármacos). ¡Existe incluso una publicación llamada OM/CS (el término pa ra "ómica· e n inglés)! El Physiome Project (www.physiome.org) es un esfuerzo internacional organ izado para coordinar la información molecular, celular y fisiológica sobre los organismos vivos en una base de datos en Internet. Los científicos de todo el mundo pueden acceder a esta información y uti lizarla en sus propias investigaciones para crea r mejores fármacos o terapias genéticas para curar y prevenir enfermedades. Algunos científicos usa n estos datos para crear modelos matemáticos que exp lican cómo funciona e l cuerpo. El Physio me Project es una empresa ambiciosa, q ue promete integrar la información su rgida en distintas áreas de investigació n para que podamos acrecentar nuestro conocimiento sobre los complejos procesos que llamamos vida.

• FIGURA 1-1 Niveles de organización y sus campos de estudio relacionados FISIOLOGÍA

ECOLOGÍA

BIOLOGÍA BIOLOGÍA CELULAR QUÍMICA

1

MOLECULAR

Áton~s l - 1 Mrnéculas

1-1

C~ulas

1-1 1-1 I· Tejidos

Organos

YApsar1stªet1osnas · lorganismos r

Poblaciones una especie de -

Ecosistemas de diferentes especies

+I

Biósfera

1

4

Capítulo 1 Introducción a la fisiología

Sistemas yaparatos del cuerpo humano ylos órganos que los integran Nombre del sistema o aparato

Incluye

Funciones representativas

La integración entre los sistemas y aparatos del organismo

Circulatorio

Corazón, vasos sa nguíneos, sa ngre

Transp orte d e sustancias entre las células d el cuerp o

Digestivo

Estómago, intestino, hígado, páncreas

Transformación d e alimen tos en partículas que p ued en ser t ransp ortadas d ent ro del cu erpo; eliminación d e algunos deshecho s

Glándula tiroidea, glándula adrenal

Coordinación del funcionamiento del organismo a t ravés d e la síntesis y la liberación d e moléculas reguladoras

In munitario

Timo, g anglios linfáticos

Defen sa cont ra invasores externos

Teg umentario

Piel

Protección del medio externo

Locomotor

Músculos esq ueléticos, huesos

Soporte y movi miento

Nervioso

Cerebro, médula espinal

Coordinación de las f unciones corp orales mediante seña les eléctricas y liberación d e moléculas reguladoras

Reproductor

Ovarios y útero, t estícu los

Continuación de la especie

Respiratorio

Pulmon es, vías aéreas

Intercam bio d e o xígeno y dióxid o d e carbono entre los medios interno y externo

Urinario

Riñones, vejiga

Mante nimiento d el ag ua y lo s solutos d el medio inte rno; eliminación de d esechos

Endocrino

Po rque a medida que aprendimos más sobre la naturaleza integradora de las funcio nes fis io lógicas, los límites entre ambos sisLemas se han hecho más borrosos. El único sistema q ue no se muestra en el Cuadro l- 1 es el di íuso sistema inmunitari o, el cual incluye, de manera no restrictiva, las estrucLuras a naLóm icas co nocidas como sistema linfático. Las células espeó alizad as del sisLema inmun iLario se encuen Lran distr ibuidas en Lodo el o rgan ismo. Protegen el medio inLerno de sustancias

~

Si_§.tcma tcg.umefl~

I

Slstc.ina nervioso

1\parato circulator,o

t Aparato di9ost1vo

Esta figura esquemática i ndica las relacion es entre lo s ap aratos y sistemas del cuerpo. El interior d e algunos órganos huecos (mostrados en b lanco) se abre hacia el medio externo.

extrafias inte rcepta ndo aquellas susLancias que ingresan a través de los in LesLin os y los p ul mones o por u na herid a en la piel. Adem,\s, los Lejidos inmunitarios se asocian estrecha menLe con el apara to ci rculatorio. Tradicio nalmente, los cmsos y libros sobre fisio logía están organizados por sistemas y aparatos. Los estudj¡tnLes estudian la fis io logía card iovascular y la regulación d e la p resión ar terial en un capítulo y, luego, estudian los rifio nes y el co nLrol del vol umen de líqu idos cor-

Función y mecanismo

porales en otro. En el ser humano vivo, no obstan Le, los aparatos cardiovascular y renal se com unican entre sí, de manera que un cambio en uno de ellos puede ocasionar una reacción en el otro; por ejemplo, el vol umen de líquido corporal ejerce una influencia en la presión sanguínea, en tanto que los cambios registrados en la presión sanguínea alteran la función renal, dado que los riñones regulan el vo lumen de líquidos. El presente libro incluye varios capítulos dedicados a temas relacionados con la función inLegrada. Desarrollar destrezas que ayuden a comprender cómo funcionan de forma conjunta los diferentes sistemas y aparatos es tan importante como memorizar hechos. Una de las formas en las que los fisiólogos integran la información es mediante la utilización de representaciones visuales de procesos fisiológicos denominadas mapas. La secc ión referenLe a la elaboración de mapas concepLuales, incluida en el presenLe capíLulo, ayuda a comprender como realizar los mapas. El primer tipo de mapa, ilustrado en la a Fi gura L-2a, es una representación esquemática de la esLrucLura o la función. El segundo Lipo de mapa, ilustrado en la Figura l-2b, es un diagrama del proceso fisiológico a medida que transcurre el tiempo. EsLos mapas se denominan diagramas de f/uio o mapas de procesos. Las preguntas incluidas al final de cada capílulo deLallan listas de Lérminos seleccionados que se pueden uLilizar a fin de practicar el mapeo.

• FIGURA 1-2 Tipos de mapas

Función y mecanismo Definimos la fisiología como el funcionamiento normal del cuerpo. No obstanLe, los fisiólogos son cautos al distinguir entre LLmción y mecanismo. La función de un sistema o acontecimiento fisiológico es el "porqué" de ese sistema o acontecimiento: ¿por qué una cierta respuesLa ayuda a un animal a sobrevivir en una situación determinada? En otras palabras, ¿cuál es la importa11cia adapta/ iva de dicho acontecimiento para ese animal? Por ejemplo, los seres lnunanos somos animales grandes, móvi les y terrestres, y nuestros cuerpos mantienen un contenido de agua relativamente constante a pesar de vivir en un entorno externo seco y mU)' variable. La deshidratación es una amenaza permanente para nuestro bienestar. ¿Qué procesos han evolucionado en nuestra anatomía )' fisiología para permitirnos sobrevivir en esle enLOrno hostil? Uno de ellos es la producción de orina allamente concentrada por el riñón, lo cual permite al cuerpo conservar agua. Este hecho nos indi ca por qué producimos orina concentrada, pero no nos dice cómo el riiión realiza esta tarea. El enfoque teleológico aplicado a la ciencia consiste en considerar un acontecimiento fisiológico de acuerdo con su importancia adaptativa. Por ejemplo, la respuesta teleológica de por qué los glóbu-

EMPAREDADOS

Persona que trabaja al aire libre en un día caluroso y seco

1

Componentes exteriores

i Panes

Tortillas

Relle nos

i

!

¡

Envoltorios

Vegetales

Quesos

1

Pérdida de agua corporal por evaporación

¡ Carnes

Condimentos y salsas

{a) Mapa que muestra relaciones entre estructuras y funciones

@

Concentración de líquidos corporales Detección de los cambios en la concentración interna por parte de los receptores internos

PREGUNTA 1. ¿Puede agregar más detalles e interrelaciones al mapa (a)?

2. He aquí una lista de términos para construir un mapa del cuerpo humano. Use los pasos indicados en la página s iguiente para crear un mapa con ellos. Agregue más términos. si lo desea. Al final del capitulo encontrará un ejemplo de respuesta.

..

Estimulación de las vías de la sed

La pernona bebe agua

• aparato cardiovascular • aparato digestivo • aparato locomotor • aparato reproductor • aparato respiratorio • aparato urinario • boca • cerebro • corazón

• el cuerpo • estómago • ganglios linfáticos • glándula tiroidea • intestino • ovarios • pulmones • riñones

S

• sistema endocrino • sistema inmunitario • sistema nervioso • sistema tegumentario • testículos • útero • vasos sanguíneos • vejiga

~ t

l

líquidos corporales disminuye su concentración

(b) Mapa de proceso o diagrama

de flujo

6

Capítulo 1 Introducción a la fisiolog ía

Mapas conceptuales

El mapa conceptual es una forma no lineal de organizar material basada en la teoría de que los individuos cuentan con sus propias formas de integrar nuevos conocimientos con los que ya poseen. Es una herramienta de estudio útil porque, para la creación de un mapa, es necesario pensar sobre la importancia y las relaciones entre varios fragmentos de información. Los estudios han demostrado que, cuando las personas interactúan con la información, organizándola a su manera antes de memorizarla, mejoran su comprensión y retención. La elaboración de mapas no es solamente una técnica de estudio. Los expertos en un tema construyen mapas cuando intentan integrar información nueva a su base de conocimientos, y pueden crear dos o tres versiones de un mapa antes de estar satisfechos con el modo en que este representa sus ideas. Los científicos realizan mapas con los pasos de sus experimentos, y los profesionales de la salud los hacen para guiarse en el diagnóstico y el tratamiento de los pacientes. Un mapa puede tomar varias formas, pero, en general, está formado por términos (palabras o frases cortas) vinculados con flechas que indican las asociaciones entre ellos. Las flechas pueden marcarse con frases que describan el tipo de asociación entre los términos (estructura/función, causa/ efecto) o con frases explicativas ("está compuesto por"). También se pueden elegir diferentes flechas de diversos colores para representar d istintas categorías de ideas. En fisiología, los mapas se basan generalmente en las relaciones entre estructuras anatómicas y procesos fisiológicos (mapas de estructura/ función) o en mecanismos de control homeostático normales y sus respuestas a los cambios anormales o fisiopatológicos (mapas de proceso o diagramas de flujo). Un mapa puede incluir también gráficos o dibujos. La Fig ura 1-2a es un mapa de estructura (podrá encontrar otros ejemplos de mapas de estructura/ función en el Capítulo 3). La Fig ura 1-2b es un ejemplo de diagrama de flujo (al final del Capítulo 15 encontrará otros ejemplos de diagramas de flujo). En este libro se muestran muchos mapas, y pueden servir como punto de partida para que usted cree sus propios mapas; sin embargo, el beneficio real surge de prepararlos uno mismo. Al crear mapas se piensa en las relaciones entre los términos, se o rganizan los conceptos en una estructura jerárquica y se ven las similitudes y diferencias entre los elementos. Interactuar con el material de esta manera ayuda a recordarlo a largo plazo en lugar de, sim plemente, memorizar partes de información y, luego, olvidarla.

A algunas personas no les gusta el desorden de los mapas dibujados a mano. Exi sten muchas formas de realizar mapas electrónicamente, que incluyen el programa PowerPoint y otros programas gratuitos y comerciales. PowerPoint

1. A partir de la opción FORMATO - DISEÑO DE LA DIAPOSITIVA, seleccione la diapositiva en blanco. 2. Utilice las AUTOFORMAS para crear cajas/óvalos y flechas. Para formatear la autoforma, selecciónela con el botón derecho del ratón después de dibujarla. Puede modificar el color de relleno y el de las líneas. 3. Utilice la opción INSERTAR - CAJA DE TEXTO para denominar sus flechas e incluir términos dentro de sus formas. Programas informáticos Programas gratuitos para la realización de mapas conceptuales se pueden instalar desde IHMC CmapTools, en http://cmap.ihmc.us. Otra opción es realizar una búsqueda en Internet del término mapas conceptuales gratuitos. lnspiration (www.inspiration.com) es un programa

comercial para la elaboración de mapas muy popular. Comenzar a realiza r el mapa

1. Primero, seleccione los términos o conceptos para incluir en el mapa. (En cada capítulo de este texto, las preguntas finales incluyen al menos una lista de términos para construir un mapa.) A veces es útil escribir los elementos entrozos de papel o en notas adhesivas para red istribuirlos con mayor facilidad. 2. En general, la parte más difícil es decidir por dónde comenzar. Empiece agrupando de manera organizada los términos relacionados. Puede ser que desee ubicar algunos de ellos en más de un grupo. Tome nota de esos términos, ya que probablemente te ndrán varias flechas apuntándolos o saliendo de ellos. 3. Trate de crear cierta jerarquía con los términos. Puede ordenarlos en un papel, en una mesa o en el piso. En un mapa de estructura o función, comience situando arriba el concepto más general, más importante o primordial, aquel del cual surgen los demás. En un mapa de proceso, comience con el primer evento. Luego, desglose la idea principal en partes progresivamente más específicas, utilizando los demás conceptos, o siga el evento en el tiempo. Use flechas para apuntar en la dirección de los vínculos e incluya líneas horizontales para unir los conceptos relacionados. El desa rrollo del mapa hacia abajo significará un aumento de complejidad o el paso del tiempo. Puede pasar que algunas de

Función y mecanismo

sus flechas se crucen entre sí; a veces esto se puede evitar recolocando los términos del mapa. Las flechas pueden nombrarse con palabras que las expliquen, lo que puede resultar útil. Por ejemp lo, forman Proteínas de canal

canales abiertos

El color puede ser muy útil en los mapas. Puede usar colores d iferentes para los d istintos tipos de vínculos o para d iferentes categorías de térm inos. Puede agregar dibujos y gráficos que se asocien a términos específicos del mapa. 4. Una vez que haya creado su mapa, siéntese y piense en él. ¿Están todos los términos en el lugar adecuado? Tal vez quiera move r alguno a otro lugar una vez que haya visto el cuadro completo. Revise e l mapa pa ra completarlo con nuevos conceptos o para corregir las asociaciones erróneas.

los rojos transportan oxígeno es: "Porque las células necesitan oxígeno, y los glóbulos rojos lo llevan hasta ellas''. Esta respuesta expl ica la raz611 po r la cual los eritrocitos transportan oxígeno -su función-, pero no dice nada sobre cómo lo hacen. Por el contrario, la mayoría de los fisiólogos estudia los procesos fisio lógicos o mecanismos: el "cómo" de un sistema. El enfoque mecanicis ta de la fisiología exam ina los procesos. la respuesta mecan icista a la pregunta: "¿Cómo transportan oxígeno los glóbulos rojos?" es: "El oxígeno se une a las moléculas de hemoglobina que están presentes en los glóbulos rojos". Esta respuesta, muy concreta, explica exactamente cómo ocurre el transporte de oxígeno pero no dice nada sob re la importancia del transpo rte de oxígeno para el ani ma l vivo. Los es tudiantes confunden a menudo estos dos enfoques de pensam iento sobre la íi.siología. Las investigaciones han demostrado que incluso los estudiante. de medicina tienden a responder las preguntas con expl icaciones teleológicas cuando la respuesta más apropiada sería una explicación mecan icista. 1 A menudo, esto ocurre porque los profesores preguntan por qué ocurre un even to fisiológico cuando, en realidad, qu ieren saber cómo sucede. Conocer los dos enfoques ayud,m1 a ev itar esta con iusión. Aunque la función y el proceso pa recen ser las dos caras de una misma moneda, es posib le estudiar procesos, espec ialmente en el nivel cel ular y el subcelular, sin comprender su función en la vida del organismo. A medida que el conocimiento de la biología se hace más

Examín e lo comenzando con el concepto principal y moviéndose luego hacia detalles más específicos. Pregúntese cosas como: ¿cuál es la causa?, ¿y el efecto?, ¿cuáles son las partes involucradas o las características prin cipales? 5. La ciencia es un campo colabora tivo. Una forma útil de estud iar con un mapa es intercambiarlo con el de un compañero de estudios y tratar de comprender ambos mapas. Por cierto, ¡no se verán iguales! Está bien que sean d iferentes. Recuerde que su mapa refleja lo que usted p iensa sobre e l tema, que puede ser distinto de lo que piensan los demás. ¿Uno de ustedes incluyó a lgo que el otro olvidó? ¿Alguno estableció una relación incorrecta entre dos elementos? 6. Practique construyendo mapas. Las preguntas de estudio de cada capítulo le darán ideas de lo que debería mapear. Su profesor le puede ayudar a empezar.

complejo, a menudo los científicos se ven tan abocados al estudio de procesos complejos que no pueden da r un paso atrás y ver la importancia de esos procesos en las cél ulas, los sistemas)' aparatos o el ani mal vivo. En contraste, es posible utilizar el pensamiento teleológico de manera incorrecta, diciendo: "Oh, en esta si tuación el organismo necesita hacer esto". Est.o puede ser una b ue na solución, pero si no existe el proceso para hacer esto, el organismo no tendrá suerte. El concepto de funciones integradas y procesos es el pr incipio que regenta la investigación aplicada, un enfoque a men udo descrito como "del laboratorio a la cama del paciente''. La investigación aplicada utiliza los conocimientos y resultados obtenidos en la invesLigación biomédica b,\sica de los procesos para el desarrollo de tratam ientos y estrategias destinados a la prevención de en fermedades de los seres humanos. Por ejemplo, investigadores que trabajaban con ratas descubrieron que una sustancia quím ica segregada por el páncreas, denominada amilina, reducía la ingesta de alimen to de las ratas. Estos descub rimientos los gu iaron di rectamente a una investigación aplicada, en la que se inyectó a humanos vo lun tarios una forma sintética de amilinn y se registró su ingesta posterior, s in modificar intencionalmente su esLilo de vida.' El fármaco suprimió la ingesta de comida en humanos, si bien su uso no ha sido aún aprobado por la Food and Drug Administration. A nivel de los sistemas y aparatos, conocemos casi completamente la mecán ica de la función corporal gracias a siglos de investí· gación. Las pregun tas sin respuesta apuntan a la integración y el con-

J

1

D. R. Richardso1\. A survey of .student<;' noti-ons of body function as tdoologic or mechanisiic. [emailprotected] Phy;ío/ Ed11c258:8 10,Jun 199(). (l11tp:l/t1dv<111.phy,íology.org).

7

S. R.Smith ttal. Pramlintide tre.1tment reduces 24--h caloric intake and meal sizes and improve.s control of eating in obese subjects: a 6-wk transfational resean:h srudy. Am J Physio/ E11doafoo/ Met,,b293: E.620 f.62 7, 2007.

8

Capítulo 1 Introducción a la fis iología

Cua ndo regresó a su habitación, Jimmy se sentó fre nte a su ordenador y entró e n Inte rnet. Escribió diabetes en la venta na de búsqueda: obtuvo 66,7 m illones d e resultados. "Eso no va a funcionar. ¿Y si busco insulina?", 22,5 millon es d e resultados. "¿Cómo voy a obtener respuesta a lgu na?". Eligió desplegar e l primer hallazgo, una página w eb d enominada type2-diabetesinfo.com.' Eso podría resultar. Su madre tenía diabetes tipo 2. Pe ro era de u na compañía farmacéutica qu e intenta ba vend e rle un fármaco. "¿Y esta otra? Whylnsulin.com :4 ¿podrá ofrecer a lgunas respuestas?". Pero esa tambié n inten taba ve n derle algo. "Quizás mi p rofesor de Fisiología p ueda ayudarme. Le preg untaré ma ñana·.

P1: ¿Qué términos d e búsqueda podría haber usado Jimmy para obtener menos resultados ?

2

10

13

18

24

27

trol de dichos mecan ismos, espec ialmente en los niveles celular y molecular. No obstante, la explicación de lo que ocu rre en los tubos de ensayo o en las células aisladas puede responder solo parcialmente las pregu ntas sobre la función; por este motivo, los estudios en animales y seres humanos son pasos esenciales en el proceso de aplicar la investigación básica al tratam iento y la cura de enfermedades.

Temas de fisiología "La íisiologia no es una ciencia ni una profesión, sino un punto de vista''.' Los fisiólogos se jactan de relacionar los p rocesos que estud ian con el funcionamiento del organismo como un todo. Para los estu diantes, ser capaces de pensar cómo múltiples órganos, sistemas y aparatos integran su funcionamiento es uno de los aspectos más difíciles del estudio de la fisiologia. Quienes quieran especializarse en ella deberán hacer más que simplemente memorizar hechos )' aprender nueva terminología. Los investigadores han demostrado q ue la capacidad de reso lver problemas requiere un marco conceptual o una " imagen completa» del campo. Este libro le ayudará a constru ir un marco concep tual para la íisiología, descr ibiendo explícitamente los conceptos biológicos básicos o ternas comunes a todos los organismos vivos. Estos conceptos representan patrones que apa recen repetidamente,)' usted comenzan\ a reconocerlos cuando los encuentre en contextos específicos. El reconocimiento de patrones es una habilidad importante que ayuda a simpliíicar el aprendizaje de la fisiología.

"Jufomiaci6u sobre diabetes tipo 2!' (N. del T.) '"Por qué insulina." ( N. del T.) ; lt W. Gerard Mirror co Physiology: SelfS11r"ey of P/rysiological Science. Washington D.C.: American Physiology Society, t 958. 3

En los últimos años, tres organ izaciones diferen tes emitieron informes para fomentar la enseflanza de la b iología utilizando estos conceptos fundamentales. Si bien las descripciones varían en los tres informes, surgen cinco temas principales:

2 3

4 5

estructura y función a través de todos los niveles de organización transferencia, almacenam iento)' uso de la energía flujo, almacenam ien to y Liso de la información den tro de los o rgan ismos individuales y dentro de Ltna especie de organismos horneostasis y los sistemas de control que la mantienen evolución

Adicionalmente, los tres estudios enfatizan la importancia de comprender el p roceso de creación de la ciencia y la naturaleza cuantitativa de la b iología. El • Cuadro 1-2 detalla los conceptos fundamentales en biología de los tres informes. En este libro nos enfocarnos en los cuatro temas más relacio nados con la fisiología: las relaciones en tre estructu ra y función, el uso de la energía b iológica, el ílujo de información dentro de un organismo y la horneosrasis )' los sistemas de control que la mantienen. Los primeros seis cap ítulos presentan los conceptos fundamenhtles de los temas mencionados. Es posible que algunos de ellos le resulten fami liares a parti r de clases de biología y de química anteriores. Estos temas y los concep tos relacionados con ellos, con variaciones, aparecen\n una y otra vez en los próximos capítulos del lib ro. Búsq uelos en el resumen y en las preguntas al final de cada uno de elJos.

Tema 1: la estructura y la función están íntimamente relacionadas La integración de la estructura y la función se extiende a través de todos los niveles de organ ización, desde el n ivel molecular hasta el cuerpo in tacto. Este tema se subdivide en dos ideas principales: interacción molecular y compartimentación.

/11teraccio11e.s molecultues La capacidad de las moléculas individuales de unirse o reaccionar con o tras moléculas es esencia] para las funcicrnes biológicas. La función de una molécula depende de su estructura y fo rma, y aun un cambio pequeño en estos aspectos puede tene r efectos importantes sobre la función . El ejemplo ch\s ico de este fenómeno es el cambio en un aminoácido de la proteína de la hemoglobi na (la hemoglob ina es el pigmento de la sangre que transpo rta el oxígeno ). Ese pequeflo cambio en la proteína convierte la hemoglobi na normal en la forma asociada con la anemia drepanocítica. Mue.has de las interacciones molecu la res de impo rtancia fisio lógica tratadas en este lib ro se rel acionan con la clase de moléculas biológicas denominadas protefl1as. Los grupos funcionales de proleínas incl uyen las e11zimas que aceleran las reacciones químicas, las 1110/éculas de señalizació11 y las protef11t1s receploras que unen las moléculas de señalización y las proteínas especializadas que funcionan corno bombas, íiltros, motores o transportadores bio lógicos. (En el Capítulo 2 se analizan de manera más detallada las interacciones moleculares que incl uyen las proteínas. ) Las interacciones entre las proteínas, el agua y otras moléculas inílu)'en sob re la eslructura cel ular y las prop iedades mecán icas de las células y los tejidos. Las propiedades mecánicas que se encuentran en

Temas de fisiología

Fundamentos científicos para futuros médicos (HHMI y AAMC}1

Visión y cambio (NSF y AAAS)2

Descrip ción currícular del curso de Biología para el año 2010 (Comité de Educación Superior)3

Estructura/ función de las moléculas a los organismos

Estructura y función (anatomía y fisiología)

Relación entre estructura y función

Principios físicos aplicados a los sistemas vivos Principios químicos aplicados a los sistemas vivos

Vías y transformaciones de energía y materia

Transferencia de energía

Biomoléculas y sus funciones

Flujo de información, intercambio y almacenamiento

Continuidad y cam bio

Los organismos sien ten y controlan su medio interno y responden al medio externo

Sistemas

Regulación ("un estado de equilibrio dinámico'1

La evolución como principio organizador

Evolución

Evolución

9

' Scienrific Foundacion for Furure Physicians. Howard Hughes Medica! lnstitute (HHMI) and the Association of American Medica! Colleges (AAMQ, 2009. www.aamc.org/scienrificfoundacions. ' Vision and Change: A Cal/ roAccion. National Science Foundation (NSF) and American Association for the Advancement of Science (AAAS), 2011. hrrp//visionandchange.orglfinalreporr. The report mentioned the integration of science and society as well. ' Co/lege Board AP Biology Course Descriprion, The College Board, 2010. hrrp;// apcenrral.college boord.com/apc/public/reposicory/op-biology-couse.


el estudio de la fis iología incluyen la adaptabilidad (capacidad de estiramiento}, la elasticidad (rigidez o la capacidad de retornar al estado anterior al estiramiento), la resistencia, la flexibil idad y la ll uidez (viscosidad). Compartim.en.t·aci6n La compartimentación es la división del espacio en compartimentos separados. Los compartimentos permiten a la célula, el tej ido o el órgano especializarse y aislar fLmciones. Cada nivel de organización se asocia con di ferentes tipos de compartimentos. A nivel macroscópico, los tej idos y órganos del cuerpo forman compart imentos funcionales separados, tales como las cavidades del cuerpo o el interior de los órganos huecos. A nive l microscópico, las membranas celulitres separan las células del líquido extrace lular y crean también pequeiios compart imentos dentro de las cé lulas, denom inados orgánulos. ( La comparlimentación es el lema del Capítulo 3.)

Tema 2: los organismosvivosnecesitan energía El crecimiento, la reproducción , el movimiento, la homeostasis: estos y todos los dem,\s procesos que tienen lugar en un organismo requieren el continuo apone de energía. ¿De dónde proviene esta energía y cómo se almacena? Responderemos todas esas preguntas y descr ib iremos algunas de las formas en las que se utiliza la energía en el orga-

n ismo para constr uir y separar moléculas ( véase el Capítulo 4 ). En los capítulos subsiguientes aprenderá cómo se utiliza la energía para transportar mo léculas a través de las membranas cel ulares y crear movimiento.

Tema 3: el flujode información coordina las funciones del cuerpo El Oujo de información en los sistemas vivos varía desde la transferencia de la información almacenada en el ADN de una generación a otra (genética) hasta el !lujo de información dentro del cuerpo de un solo organismo. A nivel del organismo, el flujo de información incluye la Lraducció n del código genético en proteínas que so n responsables de la estructura )' la funció n celular, así como de las numerosas formas de comun icación intercelular que coordinan el funcionamiento de un organismo complejo. En el organismo humano, el !lujo de información entre las células se lleva a e.abo bajo la forma de seiiales químicas o de señales eléctricas. La información puede pasar de una célula a sus vecinas (comunicación local) o de tma parle del organismo a otra (comunicación a larga distancia). Cuando las señales químicas llegan a las cél ulas diana, deben transferir la info rmación desde el exte rior de la célula hacia su interior.

1O

Capítulo 1 Introducción a la fisiología

Después de s u segunda clase de fisiología, Jimmy se presentó a su profesor y le explicó su problema. l a primera su gerencia del profesor fue si mple: tratar de re finar la búsqu eda. "Una de las mejores formas de b usca r es combinar térmi nos con e l conector Y. Si recuerda la teoría de los conju ntos d e su clase de matemáticas, el conector Y le da rá la intersecció n de los conjuntos. En ot ras palabras, solo obten drá los resultados que ocu rren en ambos conjuntos.' Parecía bastante simple. Jimmy volvió a consultar e n Internet e intentó diabetes e insulina. Esa b úsqueda aú n tenía 12,4 millones de resultados, p ero a lgunos d e e llos, e n la primera página, después d e los avisos p ublicitarios, parecían ba stante buenos: mayoclinic.com y diabetes.org. Entonces sí estaba más cerca.

P2: ¿Qué clases de páginas web debería desplegar Jim my e n su list a de resultados y cómo podría reconocerlas?

2

8. 13

18

24

27

Algunas moléculas son capaces de atravesar la ba rrera de la membrana celula r, en tan to que otras moléculas no pueden hacerlo. l as moléculas de señalización que no pueden ingresar en la célula deben enviar su mensaje a t ravés de la membrana celular. (Cómo las moléculas cruzan las membranas biológicas es el tema del Capitulo 2, El Capitulo 6 trata sobre la com un icación quím ica en el o rgan ismo).

Tema 4: la homeostasis mantiene la estabilidad interna l os o rgan ismos que sobreviven en ambientes hos tiles soportan la var iabilidad externa manten iendo su medio in terno relativamente estable, una habilidad conocida como homeostasis (horneo-, sim ilar, + -stasis. condición ). La homeostas is y la regulación del medio interno so n pr incipios clave de la fisiología y los temas relacionados con ella en cada capítulo de este libro. la secc ión siguiente observa en detalle los elementos principales de este importante tema.

Homeostasis El concepto de un medio interno relalivamenLe estable fue desarrollado por el médico francés Claude Bernard a mediados del siglo XIX. Durante sus estudios en med icina experimental, Bernar d notó la estabilidad de varias funciones fisiológicas, tales como la temperatura corporal, la frecuencia cardíaca y la pres ió n arterial. Como responsa ble de la cátedra de Fisiología de la Un iversidad de París, escribió

"C'est la _(u:ilé d11 mi/ie11 inlérierir qui est la co11dition d'1111e vie libre et indépendn11te" (" La condición para una vida lib re e independ iente es la constancia del medio interno").• Esta es una idea que apl icó a

muchas de las observaciones experimentales de su época y se convirtió en tema de debate en tre fisiólogos y médicos. En 1929, un fisió logo estadounidense llamado Walter B. Can non escrib ió una revisión para la Sociedad Americana de Fisiología.' Utili zando las observaciones realizadas por nwnerosos fisiólogos y médicos d urante el siglo X!X y comienzos del siglo XX, Cannon propuso una lista de variables que se encuentran bajo el control horneostático. Sabemos que su lista era precisa)' completa. Cannon d ividió sus variables en lo que él describió como facto res ambien tales que a fectan las células (osmolaridad, agua, sodio, calcio y otros iones o rgánicos, oxígeno, así como "secrecione.s internas q ue tienen efectos generales y continuos" ). Las "secreciones internas" de Cannon son las hormonas y o tras sustancias químicas que nuestras células utilizan para com unicarse entre si. En su ensayo, Can non creó la pa labra homeostasis para describir la regulación del medio interno del o rganismo. Explicó que eligió el prefijo homeo- (que significa "parecido" o "similar") en lugar de homo- (que sign ifica "igual") porque el medio in terno se mantiene den tro de un rango de valores en lugar de tomar un valo r e,xacto y fijo. También indicó que el sufijo -stasis, en este caso, signi fica "condición': no un estado que permanece estático e invariable. Así, la homeostasis de Cannon es un estado en el que se mantiene " una co ndición sim ilar", también descrita por Claude 13ernard rnmo " un medio interno relat ivamente constante". Algunos fisiólogos sostienen que una interpretación literal de stasis (un estado permanen te) en la palabra homeostasis remite a la idea de algo estático, sin cambios. Destacan que deberíamos usar en su lugar la palabra lwmeodi11ámica., para reflejar los pequeños cambios que ocurren permanentemente en nuestro medio interno (dynamikos, fuerza o poder). Ya sea que el proceso se llame homeostasis u homeodinámica, el concepto importante pa ra recordar es que el organ ismo con trola su estado inte rno)' actúa corrigiendo las alteraciones que atenten contra su función normal. Si el organismo no logra mantener la homeostasis de las v,triables críticas indicadas por Walter Ca n non, la función normal se interrumpe, y puede aparecer como resultado un estado de enfermedad o patológico (pathos, sufrim iento). Las enfermedades pueden dividirse en dos grupos generales de acuerdo con su orige n: aquellas en las cuales el problema surge del fallo interno de algún proceso risio lógico y aquellas que tienen o rigen en una fuente externa. las causas internas de las enfermedades inclu¡•en el crecimiento anormal de las células, que puede provocar cáncer o tumores benignos; la producción de anticue rpos contra los propios tej idos (enfermedades autoinmun itar ias), y la muerte prema tura de las células o el mal funcionamiento de los procesos celulares. Los trastornos heredita rios son considerados también como producidos por causas internas. Las causas extern as de las enfermedades son los quím icos tóxicos, los traumatismos fís icos y los invasores externos, como v irus y bacter ias. Tanto en las enfermedades causadas por factores in ternos como en las causadas por factores externos, cuando se in terrumpe la ho -

• C. Bcrnard. lntr0


( 110\w.g11re11berg.orpebooksl16234). ' W. B. Cillllon. Organization for physiological homeostasis. 443, 1929.

P/1ysiol Rev 9: 399-

Homeostasi s

e•

meostasis, el organ ismo intenta compensarlo Pig. 1-3). Si la compensació n Liene éxito, la homeostasis se restablece. Si la compensación falla puede aparecer la enfe rmedad. El estudio de las funciones orgán icas en un estado de enfermedad se conoce como fisiopatología. Usted encontrará muchos ejemplos de íisiopatología a medida que estudiemos los distintos sistemas y aparatos del organ ismo. Una enfermedad muy frecuente en los Estados Unidos es la diabetes mellitus, una alteración metabólica caracter izada por concentraciones de glucosa en la sangre ano rmalmente elevadas. Aunque hablamos de diabetes como si fuese una enfermedad ún ica, es en rea lidad una fam ilia de trastornos con causas y man ifestac iones diversas. Aprenderá más sobre la d iabete.s en los recuadros específicos q ue aparecen a lo largo de los capítulos de este libro. La influenci a de esta alte ració n en muchos de los s istemas del o rgan ismo la convierte en llll exce lente ejemplo de la naturaleza integradora de la fisiología.

¿Cuál es el medio interno del cuerpo? Claude Bernard escribió sob re la "constancia del medio interno'; pero ¿por qué es tan esencial la constancia? La mayoría de las cél ulas de nuestro cuerpo no toleran demasiado los cambios en su entorno. En este aspecto son bastante similares a los orga nismos primilivos que vivían en los mares tropicales, un medio estable donde la sal in idad, el contenido de oxígeno y el pH varían muy poco y donde la luz y la

Organismo en homeostasis

Cambio externo

Cambio interno

l

_ !_ El organismo intenta compensar1a

Enfermedad • FIGURA 1-3 Homeostasís

temperatura presentan ciclos de variación p redecibles. La composición interna de estas antiguas criaturas era casi idént ica a la del agua marina. Si las cond iciones del entorno cambiaban, las del interio r del organismo primitivo también lo hacían. Aún hoy, los invertebrados marinos no pueden tolerar camb ios en la sal in idad o en el pH, como bien lo saben quienes han tenido un acuario de agua salada. Tanto antes como ahora, muchos o rgan ismos marinos depen dían de la constanc ia de su medio externo para mantener su medio interno en eq ttilibrio. No obstante, a med ida que los organ ismos evo lucionaron y migraron de los mares a los estuarios y, luego, al agua dulce y a la tierra, enconLraron medios externos altamen te variables. Las lluv ias d iluyen el agua salada de los estuarios, y los o rganismos que viven en ellos deben enfrentar la entrada del agua en sus líq uidos corporales. Los o rganismos terrestres, incluso los h umanos, se enfrentan al des<1fio de la deshidratación (pérdida constante del agua interna en el aire seco que los rodea). Mantener el medio in terno estable significa equi librar la pérdida de agua con el consumo adecuado de ella. Pero ¿qué es, exactamente, el medio interno del organismo? Para los an imales multicelulares, es el medio interno acuoso que rodea las células, un "mar interior" del cuerpo denominado líquido extracelular (extra-, por fuera de) Fig. 1-4). El líquido extracelular (LEC) sirve como transición entre el medio externo del organismo y el líquido intracelula r (L!C) del interio r de las cél ulas ( i11tra-, dentro de) . Como el líquido extracelula r es una zona regulado ra en tre las cél ulas del cuerpo y el mundo exterior, existen procesos fisiológicos complejos que han evo lucionado para mantener relativamente es table su composición. Cuando la composición del líq uido extracelular se aleja de su rango de valores normales se activan mecanismos compensatorios q ue lo llevan a su estado normal; por ejemplo, cuando usted bebe un gran vo lumen de agua, la dilución del líquido extracelula r d ispara un meca n ismo que hace que sus riñones eliminen el exceso de agua y protejan las células de la inflamación. La mayoría de los animales mullicelulares no toleran grandes cambios y dependen de la estabi lidad del líqui do extracelular para mantener su funcionamiento normal.

<•

la homeostasis depende del equilibrio de masas

El cambio interno produce pérdida de la homeostasis

Fallo en la compensación

11

Éxito de la compensación

Bienestar

En los años sesenta, un grupo de teóricos de la conspiración consiguió un mechón de cabello de Napoleón 13onaparte y lo envió a un laboratorio para su análisis q uím ico, en un intento por demostrar que había muerto por envenenamiento con arsén ico. En la aCLualidad, un grupo de estudiantes que comparte una pizza bromea sob re el aroma a ajo en su aliento. A primera vista, estos dos escenarios pa recen tener poco en común, pero, en realidad, el cabello de Napoleón y el "aliento a ajo" dem uestran cómo funciona el cuerpo humano para mantener el equi librio que denominamos homeostasis. El cuerpo humano es un sistema abierto que intercamb ia calor y sustancias con el medio externo. Para mantener la homeostasis, el cuerpo debe mantener el equilibrio de masas. La ley d el equilibrio de masas establece que, para que la canlidad de una sustancia del organ ismo se mantenga constante, toda ganancia debe ser compensada por una pérd ida igual (• Fig. 1-Sa). La cantidad de una sustancia del organismo también se denomina carga del organismo, como en el caso de la "carga de sodio''.

12

Capít ulo 1 Introducción a la fisiología

Po r ejemplo, la pérdida de agua hacia el medio externo (salida) en forma de sudor y de or ina debe estar equil ibrada con la ingesta de agua del medio externo más el agua producida metabólicamente (entrada). Las concentraciones de olras sustancias, t.tles como oxíge-

mant ienen por medio del equilib rio de masas. La siguiente ecuació n si nteti za la ley de equil ibrio de masas: Can tidad total de sustancia x en el cuerpo

no y dióxido de carbono, sal es)' iones de h idrógeno ( pH ), también se

Las células contienen ~ líquido Intracelular (LIC) "'La membrana celular _ __ separa las células del LEC

Células

-

--LEc +-- -

= i.ngesta + producción ext.,eción - metabolismo

1 Medio externo

_

Liquido extracelular _. (LEC) _

_

_.

Líquido intracelular

(UC)

Las células están - - rodeadas por el líquido extracelular (LEC)

(b)

(a)

@

PREGUNTA Marque la membrana celular en el esquema con un * ·

• FIGURA 1-4 Los medios interno y externo del organismo. (a) La mayoría de las células están co mp letamente rodeadas por el medio i nterno del organismo, co mpuesto por líquid o extracelular (LEC). (b) Un esq uema del organismo representa los compartim entos líq uidos del cuerpo, el líquido extracelular, que intercambia sust ancias con el mundo exterior, y el líquido d el interior de las células o líquido intracel ular (LIC).

para mantener un nivel constante, la salida debe ser igual a la entrada.

Producción metabólica

Metabolización en una nueva sustancia

Ley del equilibrio de masas

Salida

(a) Equilibrio de masa en un sistema abierto

Equilibrio de masas

ingesta o

= carga corporal + producción existente

(b) Equilibrio de masa en el cuerpo

• FIGURA 1-5 Equilibrio de masa en un sistema abierto. (a) Para mantener el equilibrio, la entrada en el sistema debe ser equivalente a la sa lida. (b) Las sustancias ing resan en el organismo principalmente a través de la ingesta o la respiración, o bien pueden ser producidos por el metabolismo. Las sustancias sa len del cuerpo por med io de la excreción o del m etabolismo.

metabólica

excreción o eliminación metabólica

Homeostasis

La mayoría de las sustancias ingresan en el orga nismo desde el med io extern o, pero algunas - como el dióxido de carbono- son producidas internamente a través del meLabolismo ( Fig. 1-Sb). En general, el agua y los nutrien tes ingresan en el organismo en fo rma de al imentos y bebidas absorbidos a través del intestino. El oxígeno y o tros gases )' moléculas volátiles ingresan a través de los pulmones. Algunas sustancias q uím icas sol ubles en lípidos logran ingresar en el medio interno penetrando la barrera de la piel. Para man tener el equ ilibrio de masas, el organismo tiene dos opciones. La opción más simple es excreta r la materia. La excreción se define como la elim inación de sustancias del cuerpo, generalmen te a través de la orina, las heces, los p ul mones o la p iel. Por ejemplo, el dióxido de carbono producido durante el metabo lismo es eliminado a través de los pul mones. Muchas sustancias extrañas q ue ingresa n en el o rganismo, tales como los larmacos o los aditivos artificiales de los al imentos, son eliminados por el hígado y los riño nes. (Toda sustancia extraña en el organismo se denomina xenobi6tico, del griego xe,ws, extratio ). Una segunda opción para mamener el equilibrio de masa es convertir la sustancia en otra, diferente, por medio del metabol ismo. Los nutriente,~ que ingresan en el organismo se convienen en el pu nto de partida para las vías que transfo rman el nutriente original en una molécula d iferen te. No obstante, la transformación del nutr iente o riginal en algo diferente crea una nueva alte ración del equilibrio de masas, agregando más de la nueva sustancia o metabolúo al o rganismo. (Se denomina meuibolito a Lodo producto creado en una vía metabólica ). Los cien tíficos usan el flujo de masas para hac.er un seguim iento de las sustancias a través del organismo. Para la sustancia x, la ecuación para el flujo de masas es:

Flujo de masas = concen tración de x X flujo de volumen (cantidad x/min) = (cantidad x/vol) x (vol/m in)

El !lujo de masas puede utilizarse para determ inar la velocidad de la ingesta, de la excreción o de la producción de x. Por ejemplo, si a una persona se le admi nistra de forma endovenosa ( IV) una so lució n de glucosa q ue tiene una concentración de 50 gramos de glucosa por litro de solución, a razón de 2 mililitros por minuto, el fl ujo de masas de glucosa en el organismo será el siguiente:

50 g de glucosa - - - - - - x 2 mL de solución/min. =0,1 g de glucosa/min. 1 000 mL de solución

La velocidad de entrada de la gl ucosa en el organismo será de O, l g de glucosa/ min. El !lujo de masas se apl ica tan to al ingreso, la producción y la elimi nación de sustancias como al movimiento de susLancü1s de un compartimen to del organismo a otro. Cuando las sustancias ingresa n en el orga nismo, p rimero se co nvierten en parte del líquido extracelular. Hacia dónde se di rige después una sustancia depende de si puede o no cruza r la barrera de la membrana celular e ingresar en las células.

13

Jimmy llamó a su madre con las novedades que había encontrado en las páginas web d e la Clínica Mayo y de la American Diabetes Association. De acuerdo con estas d os organizaciones, una persona con diabetes de tipo 2 podría comenzar a req uerir insulina a medid a q ue progresara la e nfermedad. Pero su madre a ún no estaba convencida d e tener que recibir inyecciones de insulina: ·Mi amiga Ahn leyó que alg unos d octores dicen q ue, si comes u na dieta rica en fibras, no es necesario ningú n otro trata· miento para la d iabetes· . ·Mamá, eso no me parece acertado', respondió Jimmy. · Pero debe se rlo - dijo su mad re- . Así lo dice

The Doctor's Medica/ Library:• P3: Consulte The Doctor's Medico/ Library en www.medicallibrary.net, y busq ue el artículo titulad o "Fiber" ("Fibra") ingresando la palabra en el casillero de búsq ueda o por medio del listado alfabético denominado Lib ra ry Articles ("Artículos de la biblioteca'). ¿Qué dice el d octor Ke nnedy, autor del artículo, acerca de la d ieta elevada en fibra y la diabetes? P4: ¿Debería creer la mamá de Jimmy lo q ue d ice esta página web? ¿Cómo p uede Jimmy averiguar más acerca de q uié n creó la página y cuáles son sus credencia les?

2

8

10 . 18

24

27

La excreción elimina sustancias del organismo Es relativamente fác.il controla r la cantidad de una sustancia que ingresa en el o rgan ismo desde el mundo exterio r, pero resulta m,\s difícil seguir las moléculas dentro del organismo a fin de cont rolar su elim inación o su metabolización. En lugar de medir di rectamente la sustancia, podemos seguir la velocidad a la que desaparece de la sangre. Este concepto se denomina depttración. La depuración se expresa generalmen te como un vo lumen de sangre liberada de una sustancia determinada por unidad de tiempo. Po r esta razón, la depuración es solo una medida ind irecta de cómo se elim ina u na sustancia. El riñón y el hígado son los dos ó rganos principales que eli mi nan soluLos del organ ismo. Los hepatocitos (hepatims, relativo al hígado, + cito, célula) o células hepáticas meLabolizan muchos tipos de moléculas diferentes, especialmente los xenohióticos, tales como los fármacos. Los metabolitos resultantes pueden ser secretados hacia el intest ino, pan su excreción a través de las hec.es, o liberados en la sangre, para su el iminación por los riñones. Las compañías fa rmacéuticas q ue realizan ensayos con sustancias quím icas para su potencial uso como fármacos terapéut icos deben conocer la depuración de una sustancia qtLÍm ica antes de poder desarrolla r el cronograma de dosis adecuado. La depuración tamb ién Liene lugar en otros tejidos, además del hígado y los riño nes. La saliva, el sudor, la leche materna y el cabello contienen sustancias que han sido liberadas del organismo. La secreció n sal ival de la hormona cortisol proporciona una fuen te simple y

• "In biblioteca médica del doctor." (N. del T.)

14

Capítulo 1 Introducción a la fis iología

no invasiva de dicha hormona para controlar el estrés aón ico. Las drogas y el akohol secretados en la leche materna son importan tes, ya q ue el lactan le ingerirá d ichas suslancias. El análisis del cabello de Napoleón 13onaparle reali zado en los a ños sesenta exam inó si con tenía a rsén ico porque los folículos del cabello ayudan a liberar algu nos compuestos del organismo. Los resultados indicaron significativas concen trac iones de d icho veneno en su cabello, pero persiste la duda acerca de s i Napo león fue asesinado o envenenado por acciden te o si mur ió de cánce r de estó mago. Comer ajo produce "ali en to a ajo" porq ue los pul mones liberan sustancias voláti les solubles en líp idos cuando estas sustancias pasan a las vías aéreas y son exhaladas. Los p ulmones tamb ién liberan el etanol de la sang re, y el alcohol exha lado es la base del "test de alcoholemia" usado po r las agenc ias a ca rgo del cumpli miento de la ley.

Revisión

1. Si una persona i119iere 12 miligramos (mg) de saly excreta 11 mg de esta enla orina, ¡qué ocurre con el miligramo res1ante? 2. lz glurn-::a se metaboliza como co,(dióxido de carbono) yagua. Expliqueel efectodel metabolismo de la glucosa enelorganismo.

Homeostasis no significa equilibrio Cuando los fisió logos hablan de homeostasis se refieren a la estabilidad del medio interno del organismo; en otras palabras, la estabilidad del compartimento del liquido celular (C LC). Una de las razones para enfocarse en la ho meosLasis del líquido exlracelular es que es relativamente fácil controlarla mediante una mueslra de sangre. Cuando se centrifuga, la sangre se sepa.raen dos partes: el plasma, que es el componen te líquido, y las células más pesadas de la sa ngre. El plasma es parte del compartimento del líquido extracelular, y su composición puede anal izarse fácil mente. Es mucho más difícil controlar lo que ocmre en el compa rtimento del líquido inLracelular (CLI ), aunque las cél ulas mantengan la homeostasis celular. En un estado de homeostasis, la composición de ambos compartimen tos del o rgan ismo es relativamen te estable. Esta condición es un estad o estable di nám ico. El adjetivo dim.lmico indica q ue las sustan cias se mueven constan temen te enlre los dos compartimentos. En un estado estable no ex iste un movim ien to ne/o de sustancias entre los dos compartimentos. Sin embargo, un estado estable no equivale a equilibrio ( aequus, igual, + libra, equilib rio). El equilibrio implica q ue la composición de los compartimen tos del organismo es idéntica. Si examinamos la composición del LEC y el LIC, encontraremos q ue las concen Lraciones de muchas sustancias son diferentes en los dos compartimentos (• Fig. 1-6); por ejemplo, el sod io (Na+) y el clo ro (Cl-) tienen una concen tración mucho mayor en el LEC que en el LIC, en tanto que el potasio ( K+) es más concentrado en el LIC. Debido a estas diferencias en su co ncentración, los dos comparti mentos de líquidos no están equi lib rados. Po r el con trario, el LEC y el LIC existen en un estado de d esequilib rio ( dis- es un prefijo negativo que indica lo opuesto al significado del sustantivo base). Para los o rgan ismos vivos, el objetivo de

LEC

140 -

-

LIC

120 :J' ::,

,.

~ 100 -

.s •o

80,-

~

,_ 60

--

e

-~ e

o

40,_

ü

,_

20

~

,.

-~

~

'

-

,---, Na•

cr

K+

• FIGURA 1-6 Los compartimentos del organismo se encuentran en un estado dinámico pero no en equilibrio. Las conce ntraciones de sod io, potasio y cloro no son idénticas e n e l compartime nto de líqu ido extrace lular (LEC) y el compartime nto de líqu ido intracelular

(LIQ.

la homeostasis es mantene r el estado t'Stable d inámico en sus compartimen tos, no hacerlos idénticos.

Sistemas de control y homeostasis Para mantener la homeostasis, el cuerpo humano controla ciertas funciones clave, tales como la presión sanguínea y la glucem ia, las cuales deben permanecer dentro de un rango operat ivo particula r para que el o rganismo se conse rve salL1dable. Estas impo rtantes variables reguladas se man tienen dentro de su rango acep table (normal) mediante mecanismos de control fisiológicos que se manifiestan si estas variables se alejan demas iado de su valor de referencia o valor óplirno. Existen dos patrones básicos de mecan ismos de con trol: el cont rol local y el con trol reflejo a larga distancia. En su forma más simple, todos los sistemas de control tienen tres componentes: ( L) una señal de en trada; (2) un controlador o centro integrado r (integrar, resta urar), que in tegra la información que ingresa e in icia una resp uesta adecuada, y (3) una señal de salida Fig. J- i ), que rrea una respuesta. Los sistemas de con trol reflejos a larga distancia son más complejos q ue este modelo simple, ya que pueden incl uir señales de en trada de diferente origen y p roduci r señales de sal ida que actúan sobre múltiples objeLivos.

<•

Señal de entrada

-

-

Señal de sahda

• FIGURA 1-7 Un sistema de control simple

Si stem as de cont rol y homeostasis

1S

e inicia una

r respuesta Cerebro --;F.-"'..,.~

Aqui se percibe un cambio sistémico en la presión sangu ínea. CAMBIO LOCAL En el control local, las células cercanas al cambio inician una respuesta.

En el control reflejo, las células distantes controlan la respuesta.

la RESPUESTA REFLEJA es iniciada por las células distantes.

LEYENDA Estimulo Centro integrado,

O

Respuesta

• FIGURA 1·8 Comparación del control/oca/ y el control reflejo

El control local está restringido aun tejido La forma de con Lrol más simple es el control local, que eslá resLri ngi·

do a tej idos o cél ulas determinados (a Fig 1-8). En el control local, un cambio relativamente aislado ocurre en un tejido. Una célula o un grupo de cél ulas cercanas perciben el camb io en su ento rno inmediato )' responden, por lo general, liberando una sustanlia química. La respuesta está restringida a la región do nde ocurrió el cambio, de ahí el térm ino control loetil. Se puede observar un ejemplo de control local cuando dism inuye la concen tració n de oxígeno en una célula. Las células que revisLen los pequeños vasos sanguíneos que irrigan el área perciben la menor concenLración de oxígeno )' responden segregando una señal quím ica. l a molécula de señalizació n se d ifunde a los músculos cercanos a la pared del vaso sanguíneo, llevándoles un mensaje de relajación. La relajació n de los músculos aumenta (dilata ) el vaso sanguíneo, lo que incremenla el !lujo sanguíneo hacia el tejido)' lleva m,ís oxígeno al área.

El control reflejo utiliza señales a larga distancia Los cambios q ue se ext ienden a todo el organismo, o de naturaleza sis· lémica, requieren sistemas de con lrol más complejos para mantener la homeostasis; por ejemplo, manlener la presión sanguínea para impul sar el flujo de sangre a Lravés de todo el o rganismo es una cuestión sistémica y no local. Dado q ue la presión sanguínea tiene lugar en todo el organismo. su mantenim ien to requíere comun icación y coordinación de larga distancia. Utilizaremos el térm ino control reflejo para

referirnos a la vía de larga distancia que usan el sistema nervioso y el sistema endócr ino. Un rellejo fisiológico puede dividirse en dos partes: un bucle de resp uesta y un bucle de retroalimen tación<• Fig. l -9a) . Al igual que el sistema de control simple )'ª descrito, un bucle de respuesta tiene tres componen tes principales: una señal de e11tmda, un centro de integración para integrar la señal y una señnl de salida. Estos tres componentes pueden e.xpand irse en la siguiente secuencia de siete pasos para formar un patrón que se encuentra en todas las vías reilejas con leves variaciones: Eslím ulo-) sensor-) señal de entrada-) centro de in Legració n -) señal de sal ida-) objetivo-) respuesta El inicio del bucle de respuesta com ienza con un estímulo (el cambio que ocurre cuando la variable regulada se desplaza fuera del rango deseable). Un sensor especializado controla la variable. Si el sensor es activado por el esLím ulo, envía una señal de en trada al centro de integración. El centro de integración evalúa la información que proviene del sensor e inicia una sefial de salida. La sefial de salida se dirige a un objetivo pa.ra produci r una respuesta . Si Liene éxito, la respuesta hace retornar la variable regulada al rango deseado. En los mam íferos, los cen Lros de integración forman generalmente pa rte del sistema nervioso o del sistema endócrino. Las señales de salida pueden ser señales quím icas, señales eléctr icas o Lllla combinació n de ambas. Cualquier célula del cuerpo puede ser un objeLivo activado por señales de salida.

16

Capítulo 1 Introducción a la fis iología

Pasos del reflej o

A V

Temperatura del agua: 25 º C

Circuito de realimentación

~------------------- '

'

La temperatura del agua está por debajo del valor fijado.

ESTÍMULO

El termómetro detecta la disminución de la temperatura.

SENSOR

La señal pasa del sensor a la caja de control a través del cable.

,,

o

Sube la temperatura del agua

-

'

i

t sEÑAL

1 DEENTRADA e ·O

La caja de control se programa para que responda a una temperatura menor de 29 ºC.

La señal pasa por un cable hasta el calentador.

e .,"' .~

"'e

oí a:

i

SEÑAL DESAU DA

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

t El calentador se enciende.

Cable conector al calentador

• -------- '

( OBJETIVO )

t

Calentador La temperatura del agua sube.

·-------- I

• FIGURA 1-9 Pasos en el circuito de respuesta de una ruta de control reflejo. En el acuario del

ej emplo, la caja d e control se ajusta para mantener la temperat ura del ag ua a 30 ± 1 ºC.

Los bucles de respuesta comienzan con un estímulo Para il ustrar los bucles de res puesta, ap liquemos el concepto a un simple ejemplo no biológico. Pensemos en un acua rio cuyo calentador ha sido programado para mantener la temperatura del agua (la variable regulada) a 30 ºC ( Fig. l-9b). La temperatw-a ambiente es de 25 º C. La tem peratu.ra deseada del agua ( 30 ºC ) es el valor de refere11ci11 para la variable regulada. Supongamos que, inicialmen te, el agua del acuario se encuentra a temperatura ambiente, 25 ºC. Al encen der la caja de comando se activa el bucle de respuesta. El termómetro (sensor) registra una tempenll LLra de 25 ºC. Envía esta información a través de un cable (señal de entrada) hasta la caja de comando (centro integrador). La caja de comando está programada para evaluar la seftal entran te de temperatura, compararla con el valor de referencia para el sis tema (30 ºC) y "decidi r" si se necesi ta una respuesta para llevar la temperatura del agua hasta el valor de referencia. La caja de comando envía una señal a través de o tro cable (señal de sal ida) hasta el ca len tador (elector), el cual se enciende y com ienza a calen Lar el agua ( respuesta). Esta secuencia -desde el estimulo hasta la respuesta- es el bucle de respuesLa.

El ejemplo del acuario ind u)•e una variable ( temperatura) con trolada po r un único sistema de control (el calentador). También podemos describir un sistema bajo doble comando. Por ejemplo, pensemos en Ltna casa q ue tiene tanto calefacci6 n como a ire acondicionado. El d ueño desea ría que la casa permaneciera a 70 º F (aprox imadamen te, 21 ºC). En las frías mañanas de otoño, cuando la temperatura baja en la casa, el calefacto r se enciende para calenta rla. Luego, a medida que la temperatura del día aumenta, el calefacto r ya no es necesario )' se apaga. Cuando el so l calienta la casa más allá del valo r de referen cia, el acondicio nador de ai re se enciende para refrescarla hasta llegar nuevamente a 70 º F. El calefacto r y el acondicionador de ai re tienen un co111rol antagónico sobre la temperatura de la casa, ya que funcionan opon iéndose mutua mente. En el cuerpo humano ocurren situacio nes simila res cuando dos ramas del sistema nervioso o dos ho rmonas diferentes tienen efectos opuestos sobre un mismo objeti vo. Revisión

3. ¡Cuál es la desventaja de contarcon un solo sistemaóecontrol{un calentador) para mante· ner la temperatura del agua dela(IJario dentro de un rangodeseado?

Sistem as de control y homeostasis

Los bucles de retroalimentación modulan los bucles de respuesta El bucle de respuesta es solo la p rimera parte de un reflejo. Por ejemplo, en el acuario ya descrito, el senso r envía información térmica a la caja de comando, que reconoce que el agua está demasiado fría. La caja de comando responde encendiendo el e.alentado r a fin de templar el agua. Una vez que comienza la respuesta, ¿qué es lo que im pide q ue el calentador aumente la temperatura hasta, por ejemp lo, 50 ºC? La sol ución es un bucle de retroalimentación, en el que la respuesta se "relroalime nta" para influir sobre el segmento de salida de la vía. En el ejemplo del acua rio, al encender el calentador se incrementa la temperatura del agua. El sensor controla continuamen te la temperatura)' envía información a la ca_ja de control. Cuando el agua se calienta hasta el máximo valor aceptable., la caja de comando apaga el calentador, poniendo, así, fin a la respuesta reOeja.

17

rango aceptable, el bucle de retroalimentación hace que la caja de comando apague el calentador. El agua, luego, se en fria gradualmente hasta que comienza un nuevo ciclo. El resultado final es una variable que oscila (o;cillare, moverse en vaivén) alrededor del valor de referencia. En los sistemas fisiológicos, algunos sensores son m,ís sensibles que otros. Por ejemplo, los sensores que disparan los reflejos para conservar agua se activan cuando la concentración de la sangre se incrementa solo un 3% sobre lo normal, pero los sensores para la di,m inución de oxígeno en la sangre no responden hasta que el oxígeno ha disminuido en un 40% . Una vía en la q ue la respuesta se opone a la señal o la elimina se denomina retroalimentación negativa (• Fig. l - 1 la) . Los bucles de retroalimentación negativa estabilizan la variable regulada, ayudando así al sistema para mantener la homeostasis. En el ejemplo del acuario, el calen tador calienta el agua (la respues ta) y elimina el estímulo (baja temperatura del agua). Con la pérdida del estímulo para la vía, el bucle de respuesta se apaga. Los budes de retroa/ime11taci611 negati-

restaurar el estado normal pero 110 pued,m impedir la altemci611 inicial.

Los bucles de retroalimentación negativa son homeostáticos

va pueiie11

Para la ma)'oría de los reílejos, los b ucles de retroalimentación son homeostáticos -es decir, diseñados para mantener el sistema en un valor de referencia, o cerca de este, a fin de que la variable regulada sea relativamente estable-. La medida en que un centro de integración logra man tener la estabilidad depende de la sensibilidad del sistema. En el caso de nuestro acuario, la caja de comando está programada para tener una sensibilidad de ± l ºC. Si la temperatura del agua ba_ja de 30 ºCa 29,5 ºC, aún se encontrará dentro del rango aceptable y no tendrá lugar respuesta alguna. Si la temperatura del agua disminu)'e a 29 º C (30 - l ), la caja de comando encenderá el calentador (• Fig. 1- l O). A medida que el agua se cal ienta, la caja de comando recibe constantemente información del sensor acerca de la Lemperatura del agua. Cuando el agua alcanza 31 ºC (30 ± 1 ), que es el lím ite superior para el

Estímulo inicial

---11

Respuesta

El bucle de respuesta se desactiva

(

-4-

Estímulo

:

1

1

1

)

----------·

32

(a) Retroalimentación negativa: la respuesta

-1--- - + - - - - - - - - ' > - - - - - + - - - - + - - i

La realimentación - ~ negativa desactiva el bucle de respuesta 31 -

contrarresta el estímulo, desactivando el bucle de respuesta.

Valor de referencia de la función

--1- - - - ~ - - - t Estímulo inicial Rango normal de la función

Respuesta

29 - - Se activa el bucle de respuesta

G)Ciclode retroalimentación

28 ~

-

t

Tiempo - --

Estímulo

l

J

. un factor ,1 se requiere ,1 ~ J externo para desactivar G) : : el ciclo de retroalimen: : !ación. ,

--------------------~

J

• FIGURA 1-10 Oscilación alrededor del valor de referencia. La

mayoría de las funciones que mantie nen la homeostasis tienen un valor de re ferencia o valor normal. El bucle de respuesta que controla la función se aaiva cuando la función sale del rango no rmal predeterminado.

(b) Retroalimentación positiva: la respuesta refuerza el estímulo, alejando la variable aún más del valor de referencia. • FIGURA 1-11 Retroalimentación negativa y positiva

18

Capítulo 1 Introducción a la fis iología

Los bucles de retroalimentación positiva no son homeostáticos Algunas vías reílejas 110 son homeostáticas. En un bucle de r etroalimentación posiUva, la respuesta ref11erza el eslímulo en lugar de disminuirlo o eliminarlo. En la retroalimentación positiva, la respuesta eleva la variable regulada aún más allá de su valor normal. Esto inicia un círculo vicioso de respuesta cada vez mayor y hace que el sistema esté temporalmente fuera de control (Fig. l - 1 lb) . Como la retroalimentación posiLiva escala la respuesta, este tipo de alimentación requiere cierta intervención o evento fuera del bucle para detener la respuesta. Un ejemplo de bucle de retroalimentación positiva es el control hormonal de las con1racciones uterinas durante el parto r• Fig. l- 12). Cuando el bebé es tá listo para nacer, desciende dentro del útero y comienza a ejercer presión sobre el cérvix, en el cuello del útero. Las sefütles sensitivas emitidas por el cérvi.x hacia el cerebro originan la liberación de la hormona oxitoci11a, que hace que el útero se contraiga y empuje la cabeza del bebé con mayor fuerza sobre el cérvix, aumentando su d ilatación. El incremento en la dilatación origina una

El bebé descíende en el útero para iniciar el parto

t

---------------------11

/:

Estimula

Bucle de retroalimentación positiva! Causa

1

t

'--------------------- 4

1

Revisión

?P...-,,,.,~p.JO

4. El acuario óe la Figura 1-9, ¡funciooa utilizando retroalimentación positiva o negativa?

El control de prealimentación permite al organismo prever los cambios Los bucles de retroalimentación negativa pueden estabi lizar una fun ción y mantenerla dentro de un rango normal pero no pueden impedir el cambio que originó el reflejo. Algunos reflejos han evolucionado de manera que permiten al organismo predecir que un cambio está a punto de ocurri r e iniciar un bucle de respuesta antes de dicho cambio. Estas respuestas anticipadas se denominan control de prealimentadón. Un ejemplo de control de prealimentación fácil de comprender es el rellejo de s,tlivación. Solamente ve r u o ler comida, o aun pensar en ella, es suÍtcien te para que nuestra boca se haga agua esperando comerla. Este reflejo se extiende aún más, )'ª que el mismo estímulo puede iniciar la secreción de ácido hidroclorhídrico cuando el estó mago prevé la llegada de la com ida. Aparentemente, uno de los reíle-

Dilatación delcérvix estimula

Liberación de oxitocina origina 1

mayor liberación de oxilocina, lo que provoca más contraccione.s, que empujan al bebé con más fue rza contra el cérvix. Este ciclo conLinúa hasta que, finalmente, nace el bebé, liberando la presión sobre el cérvix y deteniendo el bucle de retroalimentación posi tiva.

El nacimiento del '¡ bebé interrumpe el ciclo

j

------

Tras leer e l artículo sobre fibra, Jimmy decidió pedir ayuda a su profesor nuevamente: "¿Cómo puedo darme cuenta de a quién creerle en la Internet? ¿Existe alguna forma mejor de obtener información sobre salud ?". "Bueno, las pág inas que encontró, de la Clínica Mayo y la American Diabetes Association, son buenas en cuanto a informa· ción dirigida al público general; pero si quiere leer la misma infor· mación que los científicos y los médicos debe buscar e n MEDLINE, la base de datos publicada por la National Library of Medicine de los Estados Unidos de América. PubMed es la versión de libre acceso al público (www.pubmed.gov). Esta base de datos incluye artículos revisados por homólogos, lo cual significa q ue la inves· tigación descrita ha atravesado un proceso de filtro e n el cual el trabajo es sometido a la crítica de un panel a nónimo de dos o tres cie ntíficos que están cualificados para revisar la calidad cientifica. l a revisión por homólogos sirve como control de calidad, ya que, cuando un trabajo no cumple con los estánda res de los revisores, es rechazado por e l editor de la revista·. PS: Jimmy ingresó en PubMed los siguientes términos de bús·

q ueda: diabetes tipo 2 e insulinoterapia. Repita esta búsq ue· da. Compare la cantidad de resultados obtenidos con los de las búsq uedas en Google.

2

• FIGURA 1-12 Bucle de retroalimentación positiva

8

10

13 . 24

27

Sistem as de control y homeostasis

jos de prealimentación más complejos t'S la respuesla del organismo al ejercicio (Capílulo 25 ).

~

ro

o

Los ritmos biológicos son el resultado de cambios en el valor de referencia

...

u ~

"'

19

37

~

8. o o ~

Como se explicó anteriormenle, cada variable regulada tiene un rango normal, denlro del cual puede variar sin originar una corrección. En los sistemas fisiológicos, los valores de reierencia para numerosas variables reguladas son diferentes de una persona a otra, o pueden cambiar para el mismo individuo durante un período de tiempo. Los facLores que inlluyen en el valor de referencia de un indi viduo pa.ra una determ inada variable incluyen los rilmos biológicos normales, los facLores herediLarios y las condiciones ambienLales a las que la persona se ha acostumbrado. Las variables reguladas pueden cambiar de manera predecible y crear patrones recurrentes o ciclos de cambio conocidos como ritmos biológicos o biorritmos. El horario de muchos ritmos biológicos coincide con cambios predecibles en el medio ambiente, tales como los ciclos de luz-oscuridad o las esLaciones. Los ritmos biológicos reilejan cambios en el valor de referencia de la variable regulada. Por ejemplo, Lodos los an imales mueslran alguna forma de rilmo biológico diario, denominado ritmo circadiano (circa, acerca de, + dies, día). Los seres humanos Lenemos ritmos circadianos para muchas funciones del organismo, indu)'endo la presión sanguínea, la Lemperatura corporal y los procesos metabólicos. La Lemperatura corporal alcanza su máximo en las úlLimas horas de la tarde y desciende dn\sLicamente en las primeras horas de la mañana (a Fig. l-J3a). ¿Alguna vez, estud iando tarde por la noche, comenzó a sentir frío? Esto no se origina por una disminución en la temperatura ambiental, sino porque su reflejo termorregulado r baja la temperatura de su Lermostato interno. Entre las interesantes correlaciones ent re los ritmos circadianos )' el comportamiento está la temperatura corporal. Los investigadores han descubierto que las personas que se autodenominan " madrugadoras" poseen unos ritmos de temperatura que provocan un incremento de la temperatura corporal antes de despertarse por la mañana, de ta l forma que salen de sus camas preparadas para enfren larse el mundo. Por o tra parte, los "noctámbulos" pueden verse obligados, por sus horarios escolares y laborales, a salir de sus camas con una temperatura corporal aún en su valor m,ls bajo, antes de que sus cuerpos estén preparados para la actividad. Los "noctámbulos" aún están llenos de energía y trabajando productivamente en las últimas horas del día, cuando la temperatura corporal de los "madrugadores" desciende y rápidamente se van quedando dorm idos. La concentración de muchas hormonas humanas en la sangre varía de manera predecible en un ciclo de 24 horas. El cortisol, la hormona del crecimiento y las hormonas sexuales son los ejemplos más destacados. La concentración de cortiso l en una muestra tomada a las 9:00 a.m. puede ser de, aproximadamen le, el doble de una tomada en las primeras horas de la tarde ( Fig. 1· l 3b). Po r Jo tanto, si se sospecha que un paciente presenta una anormalidad en su secreción hormonal, es importante saber en qué horario se midieron los niveles hormonales. Una concentración que es normal a las 9:00 a.m. resultará elevada a las 2:00 p.m. Una estrategia para eviLar errores origi nados por fluctuaciones circadianas es reco-

:::,

~ Q)

a.

E ~ 36

Medianoche

Mediodía

Medianoche

Mediodía

Medianoche

(a) La temperatura corporal es mínima en las primeras horas de la mañana, y la máxima se registra entre el final de la tarde y las primeras horas de la noche.

Medianoche

9:00AM.

~

Mediodía

Medianoche

Mediodía

Medianoche

(b) El cortisol plasmático es mínimo durante el sueño y alcanza

brevemente su máximo después de despertar.

Ritmos circadianos en los humanos. Los datos indicados e n (a) se origi nan e n: W. E. Scales et al., J Appl Physiol 65(4): 1840- 1846, 1988. Los datos indicados en (b) se originan en: L. Weibel et al., Am J Physiol Endocrino/ Merab 270: E608-E6 l 3, 1996.

• FIGURA 1-13

lectar información durante un día completo y calcular un valor promed io durante 24 horas; por ejemplo, la secreción de corlisol se esLima de manera indi recta m idiendo todos los meLabol itos de cortisol urinario excretados durante 24 horas. ¿Cm\l es la imporlancia adaplativa de las funciones que varían con un r itmo circadiano? Nuestra mejor respuesta es que los ritmos biológicos crean una respuesta anticipada a una variab le ambiemal predecible. ExisLen ritmos de reproducción estacionales en muchos organismos. Estos ri tmos están programados de manera tal que la descendencia cuente con alimentos y otras condiciones favorables a fin de maximizar su supervivencia. Los ritmos circadianos señalados por el ciclo de luz-oscuridad pueden corresponderse con ciclos de desGmso-actividad. Estos ritmos permiten a nuestro organ ismo prever su comportamien to y coordinar, en consecuencia, los procesos orgán icos. Es posible que usLed haya oído decir a quienes están acostumbrados a cenar a las 6:00 p.m. que no pueden digerir los alimen tos si esperan hasta las 10:00 p.m. para comer, porque su aparato d igestivo "deja de funcionar': preparándose asi para ir a dormir.

20

Capítulo 1 Introducción a la fis iología

Parte de la variabil idad de los valore,s de refe rencia está más relacio nada con los cambios en las condiciones ambientales que con los ritmos b iológicos. La adaptación de los procesos íisio lógicos a u n conjm1to de condicio nes ambienta les se conoce corno climatización cuando ocu rre naturalmente; si el proceso ocurre de manera a rti ficial en un laboratorio, se denomina aclimatación. Cada invierno, la gente que vive en las lat itudes supe rio res del hemisferio norte se d irige al Sur en invierno, en febrero, esperando escapar de las in hóspitas temperaturas bajo cero y de las nevadas del d ima del no rte. Miemras los norteños usan mangas cortas a una temperatura de 4 ºC ( 40 º F), los sureños, abrigados con camperas y guantes, piensan que los no rtelios están locos: ¡hace frío! El d istin to comportamiento se debe a la d ife rente temperatura de cl imatización, una diferencia en el valo r de referencia para la regulación de la temperatura corporal, que es resultado del con dicionam iento prev io. Los b iorriLrnos y la acl imatación son procesos comp lejos que los científicos aún no comprenden en su to tal idad. Algunos ritmos se o rigi nan en grupos especiales de cél ulas ce rebrales y son reforzados por la información sobre el ciclo de luz-oscuridad que ingresa a través de los ojos. Algunas células ajenas al sistema nervioso generan sus propios ritmos. lnvestigaciones real izadas en an imales simples, tales como las moscas, han comenzado a explicar la base molecular de los r itmos bio lógicos. ( El Cap itulo 9 trata sobre la base celular y molecular para los ritmos ci rcadianos).

La ciencia de la fisiología ¿Cómo sabernos lo que sabemos acerca de la fisiología del o rganismo humano? Las primeras descripciones de la fisiología tuvieron origen en simples observacio nes. Pero la fisiología es una ciencia experimental, en la que los invesligadores formulan hipótesis (hypotithenai, suponer) o supos iciones lógicas sobre cómo suceden los h echos; luego, prueba n las h ipótesis mediante el d iseño de experimentos, a fin de reuni r p ruebas que las apO)'en o las refuten, y, final mente, publican los resultados en textos científicos. Los proveedores de serv icios de la salud consultan la literatura científica, en busca de pruebas proporcio nadas po r d ichos experimentos, corno guía para tomar sus decisiones cl ínicas. La eval uación crítica de pruebas científicas realizada de este modo es una p ráctica q ue se conoce como medici na basada en la ev idencia. La observación )' la experimentación son los elemen tos clave de la investigación científica.

Los buenos experimentos científicos deben diseñarse con cuidado Un tipo común de experimento biológico consiste en el iminar o alterar alguna va riable q ue el investigado r crea que es pa rle esencial del fenómeno observado. La variable alterada es la variable indepen diente. Por ejemplo, una b ióloga nota que los pájaros de un comedero parecen comer más en inv ierno que en verano. EUa formula la h ipótesis de q ue la temperatura baja hace que los páj<1ros incrementen su consumo de alimento. Para probar esta h ipótesis, diseña un experimen to en el cual somete a los p¡1jaros a d iferentes temperaturas y controla cminto comen. En su experimento, la temperatura, el elemen to q ue se ma nip ula, es la variable indepen dien te. La ingesta de comida,

que se supone q ue depende de la temperatura, se transforma en la variable dependien te. Revisión

S. IJn grupo de estudiantes lleva a cabo un experimento en laboratorio en el cual bebendjferentes volúmenes de aguay miden laorina producida dentro de la hora siguiente a la inges· ta ¡Cuáles son las variables independiente y dependiente de e,i e experimento?

Una característica esencial de cualquier experimento es la existencia de un grupo con trol. Un grupo de control es, generalmente, un d uplicado del grupo experimental en Lodos los aspectos, excepto en que la variable independien te no camb ia con respecto a su valor in icial; por ejemplo, en el experimento de los pájaros, el grupo de con trol serta un grupo de animales que se man tuviesen a una temperatura cálida, pero tratados en Lodos los demás aspectos igual que aquellos sometidos a temperatu ra fría. El propósito del grupo con trol es asegurarse de que los cambios observados se deban a la variable q ue se manipula y no a.l camb io de alguna otra var iable. Po r ejemplo, suponga que, en este experimento, la ingesta de com ida aumenta después de que el investigador camb ia el Lipo de alimento prov isto. A menos q ue exista un grupo con trol, el investigador no podrá determinar si el aumento de ingesta se debe a la temperatura o al hecho de que la nueva comida es más sabrosa. Durante el experimen to, el investigador recolecta con gran cuidado la información o los datos (dat11m, lo que se da) sobre el efecto que la variable manipulada (independiente) tiene sob re la variable observada (dependiente). Una vez que el invest igador cree que )'ª tiene suficiente información para obtener una conclus ión, comienza a anal izar los datos. El estudio puede real izarse de varias fo rmas y, en general, incluye un anális is estadíslico para determinar si las diferencias apa rentes son sign ificativas. Un formato habitual para p resen ta r los datos es un gráfico (véase la Fig. l-1 4 en Gráficos). Si un experimento apoya la hipótesis de que el frío hace que los pájaros ingieran más alimen to, en to nces se debe repetir, para asegurarse q ue los resultados no se deben a un evento aislado y ún ico. Este paso se denom ina replicació n. Cuando los datos sostienen la hipótesis en varios exper imentos, esta puede lransformarse en una teor[a cien tífica. La mayo r pan e de la informaci6n que se presenta en los libros de texto como este está basada en modelos que los científicos han desar rollado a partir de la mejor evidencia experimental disponible. A veces se p ublican n uevas evidencias experimentales que no concuerdan con un modelo vigente; en ese caso, el modelo debe revisarse para q ue sea coherente con las nuevas observaciones. Así, aunque usted pueda ap render un "hecho" fisio lógico estudiando este libro, den tro de d iez. años ese "hecho" puede ser inexacto debido a lo que los científicos hayan descubierto en ese tiempo. Por ejemp lo, en 1970, los estudian Les aprendían que la membrana cel ular era como un "emparedado de manteq1Lilla''. una estructura compuesta po r una capa de lipidos encerrada en tre dos capas de proteínas. Si n embargo, en l972, los científicos presen taron un modelo de membrana muy di ferente, en el cual glóbulos de proteínas flotan den tro de una capa doble de lípidos. Como resultado, los autores de libros de texto tuv ieron q ue revisar su descripción de las membranas cel ulares, y los estudian tes q ue habían aprendido el modelo del empa-

La ciencia de la fis iología

redado de mantequilla tuvieron que revisar su modelo mental de la membrana. ¿De dónde vienen nuestros modelos cientificos sob re la fisiología humana? Hemos aprendido mucho de lo que sabemos a partir de experimentos en an imales, desde calamares has ta ratas. Desde muchos puntos de vista, los procesos fisiológicos en estos animales son idénticos a los que ocurren en los seres humanos o son suficientemente simi lares como para poder extrapolar los datos ob tenidos. fa importante usar modelos no h Ltmanos, porque los experimentos en personas pueden ser difíciles de llevar a cabo. Sin embargo, no Lodos los estudios hechos en animales pueden aplicarse a los seres humanos. Por ejemplo, un antidepresivo q ue se había usado de manera segura durante años en Europa fue sometido a una nueva prueba más estricta, requerida por la Food and Drug Administralion de los Estados Un idos, antes de poder ser comerciali zado en ese país. Cuando perros de raza beagle Lomaron el fá rmaco durante algunos meses, comenzaron a morir por problemas cardíacos. Entre los científicos se empezaron a disparar las señales de alarma, hasta que nuevas investigaciones mostraron q ue esta raza de perros posee w1a constitución genética diferente, que provoca la degradación del fármaco en una sustancia tóxica. El medicamenLO era perfectamente segLLrO en otras razas de perros )'enseres humanos y, en consecuencia, se aprobó su comercialización.

Los resultados de los experimentos en seres humanos pueden ser difíciles de interpretar Existen muchas razones por las cuales es difícil llevar a cabo expe rimentos en seres humanos, entre ellas la variabilidad, los factores psicológicos y las consideraciones éticas.

Varia.bilidad Las poblaciones humanas tienen una enorme variabilidad genética y medioambiental. Aunque los hbros de úsiología presentan generalmente valores promedio para la mayoría de las variab les fisiológicas, como la presión arterial, estos valores promedio son, sim plemente, un número que queda en algún lugar cerca del med io de un amplio rango de valores. Así, para encontrar diferencias significativas entre los grupos y controles en los experimentos en seres lnunanos, un investigador debería inclui r un ~ran número de sujetos idénticos. Sin embargo, conseguir dos grupos de pe rsonas que sean idé11 licas en todos los aspectos es imposible. El investigador debe, en cambio, intentar reclutar sujetos que sean similares en Lanws aspectos como sea posible. En algunos países, las búsquedas se publican en los periód icos: "Se buscan homb res sanos de 18 a 25 años, no fumado res, con un peso corporal cercano al ideal, para participar en un estudio...". Los investigadores deben considera r la va ri abilidad inherenLe, incluso en un grupo seleccionado de pe rsonas, cuando realizan estos exper imentos, ya que puede afectar su capacidad de interpretar con precisión el significado de los datos obtenidos del grupo. Una forma de reducir la variabilidad den tro de una población en estudio, ya sea humana o animal, es reali zar wi estudio con grupos cr tLZados. En un estudio de este tipo, cada individuo actúa como sujeto experimental y como contro l. Así, la respuesta de cada individuo al tratamiento puede compararse con su propio valor de contro l. Este

21

método es eficaz en particular cuando existe mucha var iabi lidad den tro de la población. Por ejemplo, en un ensayo de una medicación para la presión arterial, los sujetos pueden d ividirse en dos grupos. El grupo A recibirá una sustancia inactiva llamada placebo (del )aún "agradar") durante la primera mitad del experimento y, luego, pasará a recibir el fármaco exper im ental en la segunda mitad; el grupo B comenzará con el fármaco experimental y, luego, será cambiado por el placebo. Este esquema permitirá al investigador evaluar el efecto del agente en cada indiv iduo; d icho de otro modo, cada sujeto actuará como su propio control. Estadísticamente, los datos así ob ten idos pueden analiza rse usando métodos que contemplen los cambios en c.ada individuo más que los cambios en el grupo en general.

Factores psicológicos ütra variable significativa en los estudios en seres humanos es el aspecto psicológico de admin istrar un tratam ien to. Si se da a una persona una píldora y se le dice que le ali viará algún problema, existe una gran posibil idad de que tenga exactamente ese efecto, aun si contiene solamente azúcar o una sustanlia inene. Este fenómeno, que está bien documentado, se llama efecto placebo. De la misma manera, si se adv ierte a las personas que el agente que están tomando puede tener efectos adversos específicos, ellas informarán w1a mayor incidencia de los efectos adversos que un grupo similar que no haya recibido la advertencia. Este fenómeno se denomina efecto nocebo, de la palabra latina nocere, "hacer daño". Los efectos placebo y nocebo muestran la capacidad de nuestras mentes de alterar las funciones fisiológicas de nuestros organismos. Al d iseñar un experimento con sujetos humanos se debe tratar de controlar los efectos placebo y nocebo. La manera más si mple de hacerlo es con un estudio con enmascaramiento o ciego, en el cual los sujetos no saben si están recibiendo el tratamiento o el placebo. Sin embargo, aun esta precaución puede fallar si el investigador que evalúa al sujeto sabe qué tipo de tratamiento está recibiendo. Las expectativas del investigador sobre lo que el tratamiento logrará --0 no- pueden afectar sus observaciones o sus interpretaciones. Alfa ev il,lf este inconven iente se realizan a menudo estudios con doble enmascaramiento o doble ciego, en los cuales un tercer indiv iduo, no involucrado en el experimento, es el único que sabe qué grupo recibe el tratam iento experimen tal y qué grupo recibe el control. El diseño experimental más sofisticado para hacer mínimos los efectos psicológicos es el estudio con grupos cruzados y doble enmascaramiento. En este tipo de estudio, el grupo de con trol de la primera mitad del experimento se transforma en el grupo experimental en la segtmda milad, )' viceversa, pero ninguno de los participantes sabe quién Loma el tratamiento activo. Co11sidera.cio11es ét.icas Las cuestiones éticas surgen cuando se usan

se res humanos como sujetos de experimentación, en especial cuando son personas que padecen una enfermedad. ¿Es ético privar al grupo de control de un tratamiento nuevo)' promiso rio? Un ejemplo destacado ocurrió hace unos años, cuando los investigadores probaban la eGcacia de un Ln\lamiento pa ra disolver los coágu los sanguíneos en las víctimas de infartos. La tasa de sobrev ida entre los pacientes trata dos fue tanto más elevada que el estudio se interrumpió para permitir que los miembros del grupo control recibiesen también el agente experimental.

22

Capítulo 1 In t roducción a la fisiología

Gráficos Los gráficos son representaciones pictóricas d e la relación ent re dos o más variables dibujadas en un área rectangular (• Fig. 1-14a). Usamos gráficos para presentar una gran cantid ad d e d atos numéricos en un espacio p equeño, para destacar comparaciones entre variables o para mostrar una tendencia a lo largo del t iempo. Un lector puede ext raer información mucho má s rápido de un gráfico que d e una tabla de números o de una d escripción escrita. Un gráfico b ien co nstruido d ebe contener -de forma muy abreviada- todo lo que el lector necesita saber sobre los d atos, incluyen do el propósito del exp erimento, cómo se lo condujo y cuáles fueron sus res ultados.

8

7 '@'

-"'

6

'5 El 5 tí Q)

4

O)

E

3 2

1

Todos los gráficos científicos t ienen características comu nes. La variable independiente (manipulada por quien conduce el exp erimento) se representa en el ej e horizonta l x. La variable d ependiente (la que el exp erimentador mide) se representa en el ej e vert ical y. Si el diseño experimental es válido y la hipótesis correcta, los cambios en la variable independiente {eje x) originarán cambios en la variable d epen diente (ej e y). En o t ras palab ras, y es una f unción de x. Esta relación puede expresa rse matemáticamente como y = f(x). Otra manera de expresar la relación entre los ejes es consid erarla como "el efecto d e x sobre

A

Los canarios fueron alimentados con una de tres dietas y su ingesta fue controlada durante tres semanas.

_ , PREGUNTA ¿Oué alimento prefirieron los canarios?

(b) Gráfico de barras. Cada barra muestra una variable distinta. Las barras están alineadas una al lado de la otra a lo largo de un eje de manera que se las puede comparar fácilmente entre si. Los gráficos científicos de barras tienen tradicionalmente barras verticales

y''. Cada eje de un gráfico se divide en unidades expresad as por marcas. Una leyend a nos dice qué variable rep resenta el eje (t iempo, temp erat ura, cantidad d e alimento consumido) y en qué unidad es se la representa (días, grados centígrados, gramos p or día). La intersección d e los dos ejes se d enomina origen. El origen, en general, aunque no siempre, t iene un valor d e

c

B Dieta

cero para ambos ejes. Un gráfico d ebe tener un título que d escriba lo que representa. Si se muestran varios grupos en un mismo gráfico, las líneas o barras que los representan pueden tener nombres o una leyenda que indique lo que cada símbolo o color representa.

eje y

.,"'

~

u,

'0

Q)

e:

(ti

-o

·e:

}

1 unidad

"'

i5 ::, 1ií

2..

(1)

eQ) '5 e(1)

X

X X

.S: _g¡ D

(ti

·e

(ti

Q)

X

Q)

"O

(l)

E

·:J

z

ejex

Variable dependiente (unidades)

• FIGURA 1-14

LEYENDA • Grupo A X Grupos

o

1

2

3

4

5

6

7

8

9

10

Calificación obtenido en la evaluación

(Describ~ l_a información representada por el graf1co)

(a) Las características estándar de un gráfico son las unidades y los nombres de los ejes, las referencias y una leyenda.

2

1

1 unidad

>

LEYENDA {

3

o

~

Q.


"O

X

4

JI

La distribución de las calificaciones de los estudiantes en un examen de 1O puntos se representa en un histograma.

º

PREGUNTA ¿Cuántos estudiantes hicieron el examen?

(c) Histograma. Un h istograma muestra la distribución de una variable para un conj unto de valores.

La ciencia de la fisiología

La mayoría de los gráficos qu e enco ntrará en fisiolog ía mu estra n los datos como barras (gráficos de barras o histog ramas), como líneas (gráficos de líneas) o como puntos (gráficos de dispersión). En las Figuras 1-14b, c, d, e se muestran cuatro tipos de gráficos típicos. Los gráficos de barras (Fig. 1-14b) se usan cuando las variables independ ientes so n entidades diferentes. Un histograma (Fig. 1-14c) es un gráfico de barras especial, que muestra la distri6 uc1ón de un a variable para cierto rango de valores; el eje x está dividido e n unidades (llamadas "bins" en algunos programas informáticos de gráficos} y el eje y indica cómo muchas partes de los datos se asocian con cada bin.

60 50 §

!!! 40 oQ. ou 30 o UJ ~

Q)

CL

20

.. ...

10

Los gráficos de líneas (Fig. 1-14d) se usa n comúnmente cuando la variable independiente del eje x es un fenóme no continuo, como el tiempo, la tem peratura o el peso. Cada punto del gráfico puede re presentar el promedio de un grupo de o bservaciones. Como la variable independie nte es una función continua, los pun tos del gráfico pueden conectarse con una línea (conexión entre los puntos o una línea curva que "mejor se adapte: que se calcu la matemáticamente). La conexión entre los puntos permite al lector real iza r interpolaciones o estimar valores que se encuentren entre los valores medidos. Los gráficos de dispersión (Fig. 1-14e} mu estran la re lación entre dos variables, como el tiem po de estudio antes de un examen y la calificación obtenido en él. Generalmente, cada punto del gráfico representa un sujeto de la muestra estudiada. Los puntos individuales de un gráfico de dispersión nunca se conectan con una línea, pero una línea o curva, la que "mejor se adapte~ puede indicar una tendencia de los datos.

o

(a) ¿Cuál fue !avariable independiente en este experimento? ¿Cuál fue ladependiente? (b) Dibuje un gráfico y nombre cada eje con la va;iable correcta. Dibuje lineas de ten-

dencia o barras que muestrenlos datosobtenidos.

•••

1

2

• 1r '

•••

LEYENDA Machos - • - • Hembras • • • · •• · • ••

4

3

5

6

7

Ratones machos y hembras alimentados con una dieta estándar y pesados diariamente.

o

PREGUNTA ¿Cuándo aumentaron de peso más rápido los ratones machos?

(d) Gráfico de líneas. El eje x representa, en general, el tiempo; los puntos representan observaciones promedio. Los puntos pueden unirse con líneas; en ese caso, la pendiente de la línea entre dos puntos mostrará la tasa de cambio de la variable.

100 90 ~ e (l)

80

E

70

"' X

(l)

.; e

(l)

e

•O

60 50

·¡;;

40

~

30

ro

~ ü

20 10 2

4 6 8 Tiempo de estudio (horas)

10

12

Las notas de los estudiantes se relacionaron directamente con el tiempo de estudio.

Revisión 6. los estudiantes de un laboratorio de fisiología recolectaron datos sobre su frecuencia cardiaca. En carla caso, el parámetro se midió primero con el sujeto en reposo y, luego, después de haber realizado ejercicio. El experimento tuvo como resultado dos hallaz· gos: (1) que la frecuencia cardíaca era mayor en el ejercicio que en reposo y (2) quelas mujerestenían mayores frecuencias cardiacasen reposo que los hombm.

....

• ••

.,. .... . .... . ... .•

Día

A continuación se indican algunas preg untas para formularse cuando se trata de o btener información a partir de un gráfico: 1. ¿Qué variable re prese nta cada eje? 2. ¿Cuál es la relación entre las variables representadas en los ejes? Esta relación, en general, puede expresarse reem plazando los nombres de los ejes por la siguiente frase:"el efecto de x sobre y"; por ejem plo, el gráfico (b) muestra el efecto del tipo de dieta de los cana rios sobre su ingesta diaria. 3. ¿Hay alguna tendencia apa rente en el gráfico? Pa ra los gráficos de líneas o de dispersión, ¿la línea es horizontal (sin cam bios en la variable de pendiente cuando cambia la independiente) o tiene un a pendiente? ¿La línea es recta o curva? En los gráficos de ba rras, ¿tienen estas la m isma alt ura o difere ntes alturas? Si son di ferentes, ¿existe una tendencia en la dirección del cambio de altura?

23

o

PREGUNTAS

Para los gráficos (d) y (e), responda lo siguiente: • ¿Qué intentaba determinar el investigador? • ¿Cuáles eran las variables dependiente e independiente? • ¿Qué resultados o tendencias indicaron los datos? (e) Gráfico de di spers ión. Cada punto representa un miembro de la muestra estudiada. Los puntos individuales nunca se unen, pero puede estimarse una línea de ajuste para mostrar la tendencia de los datos o, mejor aún, se puede calcular matemáticamente una ecuación.

24

Capítulo 1 Introducción a la fis iología

Por el conLrario, las pruebas realizadas con algunas sustancias antilumorales moslraron que los lratamienlos experimentales eran menos eficaces para detener la met.\stasis que los tratamientos estándar usados po r los controles. ¿Era ético lratar a los pacientes del grupo e.xperimt>ntal privándolos de las prácticas médicas actuale.s más eficaces? Ho)', la mayoría de los estudios son eval uados sobre la marcha de manera conti nua pa ra reduci r la posibilidad de que los sujetos resulten perjudicados por participar. En 2002, un ensa)'º sobre la terapia de reemplazo hormonal en mujeres menopáusicas conclu)'Ó tempranamente cuando los investigadores no laron que las mujeres que tomaban una píldora con dos hormonas desarrollaban enfermedades cardiovasculares y cáncer con ma}'or frecuencia que las que recibían un placebo. Por otra parte, las mujeres que recibían hormonas tenían m.e11ores tasas de dncer de colon y fracturas óseas. Los investigadores decidieron que los riesgos asociados con el tralamien to excedí.tn los potenciales beneficios e

"Hola, profesor. Regresé". La mayoría de los artículos q ue Jimmy encontró en PubMed se enfocaban demasiado en experimentos individuales, y él no comprendía los térmi nos técnicos que los autores usaban. '¿Existe alguna forma de encontrar artículos q ue no sean ta n complicados?'. ' Sí, existen muchas formas. Muchas revistas publican artículos de revisión que contienen una sinop· sis o resu men de investigaciones recientes sobre un tema en particular. En el comienzo del aprendizaje sobre un tema es mejor comenza r con artículos de revisión. PubMed tiene un enlace con la página de resultados. Un lugar diferente donde se puede busca r información básica es MedlineP/us, otro recurso de la National Library of Medicine (www.medlineplus.gov)." Jimmy decidió intentar con MedlineP/us, ya q ue los resultados de PubMed parecían demasiado técnicos para su preg unta simple. En la página de MedlinePlus escribió diabetes tipo 2 e insulinotera· pia en la ventana de búsqueda. Tras leer algunos de los artículos que encontró alli como enlaces, llamó a su madre: "¡Hola, mamá! ¡Encontré la respuesta a tu pregunta!.' P6:

Repita la búsqueda de Jimmy en MedlineP/us y bu sque en laces hacia artículos sobre diabetes tipo 2 publicados por los National lnstitutes of Health (NIHJ, por la National Library of Medici ne (NLMJ o por los Centers for Disease Control and Prevention (CDC). Basándose en el contenido de esos artículos, ¿qué dijo Jimmy a su madre acerca de su necesidad de recibir insulina para su diabetes tipo 2?

P7 : ¿Qué puede decirse del artículo que indicaba que una dieta

con elevado contenido de fibra podía ayudar? En las páginas que resultaron de la búsqueda e n MedlinePlus, busq ue artículos sobre tratamientos alternativos para la diabetes publicados por el National Center for Complementary and Altem ative Medicine. ¿Mencionan estos artículos la fibra dietaría?

2

8

10

13

18 . 27

interrumpieron el estudio. Para aprender más sobre este ensayo clínico y sobre las ventajas )' desventajas de la terapia de reemplazo hormonal, visite la página web de la U.S. National library of Medicine: ww, v. nlm.11ih. gov/medli11epl11.s/hon no, 1erepl11ceme11ttherapy. h1, nl.

Losestudiosen sereshumanospueden adoptar muchasformas Casi a diario, los periódicos muestran a rtículos acerca de ensayos clín icos sobre la eficacia de medicamentos u otros tratamientos médicos. Muchos aspectos diferentes del diseño experimenlal pueden afectar la val idez y la aplicabil idad de los resultados de estos ensa¡•os. Por ejemplo, algunos estudios se llevan a cabo solamente por un período de tiempo limitado en un número acolado de personas, como los estudios que realjza la Food and Drug Adm inisLralion de los Estados Unidos en el proceso de aprobación de un fá rmaco. En diferentes ocasiones, en los últimos años, medicamentos aprobados como resultado de estos estudios fueron posteriormente retirados del mercado cuando SlL uso extend ido develó efectos adversos e, incluso, produjo muerLes. los estudios longitudinales se diseñan para llevarse a cabo en un período de tiempo largo. Uno de los estudios lo ngitudinales más famosos es el "Framingham Heart Study" ( www.Jrami11gliam.com/ heart), que comenzó en 1948 y aún sigue realizándose. Éste es un estudio prospectivo (pro,-pectus, por venir, mirar hacia adelante) que recl uló personas sanas )' las ha seguido durante aftos para identificar los factores que contribuyen al desarrollo de las enfermedades cardiovasculares. Este trabajo ya ha hecho imporLantes contribuciones a la alención sanitaria, y continúa con los hijos, hoy adultos, de los participantes originales. Otros diseftos de estudios que pueden encontrarse en la literal u· ra son los estudios transversales y los retrospect ivos. Los estudios transversales analizan la prevalencia de una enfermedad o un trastorno en una población. Los datos de estos estudios identifican tendencias que luego deben ser investigadas con más detall e; por ejemplo, si un grupo etario o un nivel socioeconómico determinados se asocian con un riesgo más elevado de desarrollar la enfermedad que se evalúa. Los estudios retrospectivos (retro, hacia alrás, + spett.are, mirar) compa ran grupos de personas que lienen una enfermedad en particular con un grupo control similar pero sano. Estos estudios tienen como objetivo delerm inar si el desarro llo de la enfermedad puede asociarse con una variable en particular. Con frecuencia, los resultados de uno o varios estudios publicados no coinciden con los de o tras publicaciones. En algunos rasos, el motivo de ello resulta ser alguna limitación en el diseño del estudio, como el uso de un número pequeño de sujetos, que puede no ser representativo de poblaciones más grandes. En otros casos, el problema puede deberse a diferencias pequeñas pero potencialmente significativas en el disefio experimental de los distinlos estudios. Una forma en que los científicos intentan resolver estos resultados contradictorios es recurriendo a un metanálisis de los datos ( meta-, a un nivel más e.levado). El metanálisis combina todos los dalos de un grupo de estudios similares y utiliza sofisticadas técnicas estadísticas para extraer tendencias significativas o hallazgos de los datos combinados. Por ejemplo, se realizaron muchos estudios para evaluar si la glucosamina y el sulfato de condoitrina, dos suplementos

La ciencia de la fisiología

dietarios, podrian mejorar los casos de enfermed ades degenerativas de las articulaciones. Sin embargo, los esLL1dios individ uales tenían tamaños muestrales pequeños (menos de 50 sujetos) y se habían realizado con d iferentes regímeues de dosificació n. Un metanálisis usando métodos estadísticos específicos constituye una forma de comparar los resultados de estos estud ios.V La di ficultad para uti lizar seres humanos como sujetos de los experimentos es una de las razones por las cuales los científicos usan an imales para desarrollar muchos de sus modelos. Desde la década de l970, la experimentación en animales se ha incrementado en fisiología, con técn icas desarrolladas por biólogos celulares y genetistas moleculares. A medida que comprendimos los fundamentos de cómo las señales q uímicas en el organ ismo son recibidas e interpretadas por las células, hemos desen trañado los misterios de muchos p rocesos. Al hacerlo, nos hemos acercado a la posibilidad de tratar varias enfermedades corrigiendo su causa más que, simplemente, tratando sus sí u tomas.

• Véase, por ejemplo, S. Wandcl et 11/. Effects of glucosamine, d1ondroitin or placebo in patiems with osteoarthriti.~ of hip or knee: network meta-analysis. Br Med J 341: c4675-c4676, 2010.

Cada vez más, la med.ici na se vuelca hacia las terapias basadas en inte rvencio nes a n ivel molecular. Un ejemplo clás ico es el tratam ien to de la fibrosis quistica, una enfermedad hered itaria en la cual la mucosidad de los pu lmones y el tubo d igestivo es inusualmente abundante. Durante muchos ai'\os, los pacientes con es te trasto rno tuvieron pocas alternativas terapéuticas,)' la ma)'oria moría a corta edad. Sin emba rgo, la investigació n b ásica sobre los mecanismos med iante los cuales las sales y el agua atraviesan las membra nas celulares aportaron pistas sobre la causa subyacente de la fibros is quistica: una proteína defectuosa en la membrana de ciertas células. Una vez q ue los genelistas moleculares hallaron el gen q ue codificaba esa proteína, la posib ilidad de reem pla:lar el gen alterado por el gen de la proteína normal se hizo realidad. Sin embargo, sin la investigació n básica sob re cómo las células y los tejidos llevan adelante sus funciones normales, este tratam ien to nunca se habría desa rrollado. A medida que lea este libro y aprenda lo q ue hoy sabemos sobre cómo funciona el organismo humano, tenga en cuenta que muchas de las ideas aquí presentadas reílejan modelos q ue representan nuestro conocimiento actual y que están sujetos a camb ios. Aún existen muchos in terrogantes en fisiología que aguardan q ue los investigadores encuentren resp uestas.

¿Qué creer? Una habilidad que todos los estudiantes de fisiología deberían adquirir es la de encontrar información en la literatura científica. En el mu ndo act ual, esta literatura puede hallarse tanto de manera impresa, en forma de libros y publicaciones periódicas, como en la Internet. No obstante, a menos q ue la fecha de publicación de un libro sea reciente, puede que no sea la fuente de información más actualizada. Muchos estudiantes comienzan su búsq ueda de información sobre un tema a través de Inte rnet. ¡Te nga cuidado! Cualquiera puede

crear una página y publicar información en Internet. Para las publicaciones pe riódicas no existe un proceso de selección comparable con la revisión por part e de homólogos, y el lect or de una página debe decidir acerca de la validez de la información allí presentada. Es fact ible encontrar bu ena información e n las páginas web publica· das por universidades reconocidas y organizaciones sin fines de lucro, pero es recomendable mirar con escepticismo un art ícu lo sobre vitaminas publicado en la página web de una casa de prod uctos naturistas, a menos que e l artícu lo mencione la publicación de investigaciones realizadas por homólogos.

Pregunta

Respuesta y comentario

1. ¿Qué términos de búsqueda podría

l a mejor mane ra de reducir la lista de resultados es incluir más palabras en la búsqueda en Internet. Por ejemplo, Jimmy podría haber buscado insulinoterapia diabetes. Esa búsqueda habría prod ucido aproximadamente S(J(J 000 resultados. También habría resultado útil ser más espeáfico sobre el tipo de diabetes de su madre. Una búsqueda de insulinoterapia para diabetes tipa 2 solo produce 450 000 resultados. ¡Pero esas son aún demasiadas páginas!

haber usado Jimmy para obtener menos resultados?

2. ¿Qué clases de páginas web debería buscar Jimmy en su lista de resultados y cómo podría reconocerlas?

25

Las mejores páginas web de información sobre la salud tienen origen en organizaciones que forman parte de las comunidades científica y del cuidado de la sal ud, tales como el National lnstitute of Health (NIHJ, en grupos sin fines de lucro dedicados a apoyar la investigación de una enfermedad en particular (como The American Diabetes Associatíon, d iabetes.e rg) o en clínicas y universidades donde los científicos y médicos investigan activamente las causas y los tratamientos de las e nfermedades. Trate las pág inas web comerciales, que terminan en · .com·, con especial cuidado.

26

Capítulo 1 Introducción a la fisiolog ía

Pregunta

Respuesta y comentario

3. En el artículo de The Ooctor's Medica/ Library titulado ·fiber", ¿qué dice el doctor Kenn edy, su autor, acerca de la dieta elevada en fibra y la diabetes?

El doctor Kennedy declara que algunos pacientes con diabetes tipo 2 pu eden ser ·tratados con éxito· con una dieta elevada en contenido de fibra. (La clasificación de la diabetes tipo 2 como ·diabetes del adulto· es obsoleta .)

4. ¿Cómo puede Jimmy averiguar más acerca de quién creó la página web y cuáles son sus credenciales?

Para mayor información sobre quién creó la página web y por qué, busque enlaces al final de la página que lo dirijan a ·tNICto · o ·ACERCA DE NOSOTROS· . En la página de inicio de The Doctor's Medica/ Library, usted averiguará que el sitio promueve el · cuidado natural de la salud·. El enlace sobre el doctor Ron Kenney no brinda información alguna acerca de su capacitación médica u otras credenciales.

S. Compare la cantidad de resultados de la búsqueda en PubMed con la cantidad de resultados obtenidos en las búsquedas en Google.

la cantidad de resultados dependerá del momento en el que realice fa búsqueda, ya q ue constantemente se agregan nuevos artículos; pero es probable que la cantidad sea inferior a 50 000, mucho menos que los millones de resultados que surgen de una búsqueda a través de Google.

6. ¿Qué dijo Jimmy a su madre acerca de su necesidad de recibir insulina para su diabetes tipo 2?

Todos los artfculos publicados por las organizaclones nacionales mencionadas indican que las personas que padecen diabetes tipo 2 pueden necesitar insulina. Los pacientes deberían escuchar siempre a sus profesionales de la sa lud y, en caso de duda, consultarlos sobre qué deberían hacer.

7. ¿Mencionan los artículos publicados por el National Center for Com plementary and Alternative Medicine {NCCAM) la fibra dietaría como tratamiento alternativo para la diabetes?

El articulo del NCCAM incl uye varios tratamientos alternativos que los pacientes han intentado, pero la fibra dieta ria no es uno de ellos. También indica que, hasta ahora, no existe evidencia científica que apoye el uso de suplementos dietarios para el tratamiento de la diabetes. Los pacientes nunca deberían suspender sus tratamientos convencionales cuando realizan tratamientos complementarios, y siempre deberían informar a sus profesionales de la salud sobre cualquier vitamina o suplemento dietario que estén tomando.

Formatosdelascitasbibliográficas Cuando encuentre un artículo, ya sea impreso o en una pág ina web, debe escribir la cita bibliográfica completa. Los formatos de las citas a incluir en los artículos poco d ifieren de una fuente a otra, pero, generalmente, incluyen los siguientes elementos (con la puntuación indicada): Autor{es). Títu lo del artículo. Nombre de la revista vol umen (edición): pági nas incluidas, año de publicación.

Por ejemplo: Echevarria M e llundain AA Aquapori ns. J Physiol Biochem 54(2): 107-118, 1998. En muchas citas, el nombre de la revista se acorta usando abreviaturas convencionales. Por ejemplo, American Journal of Physialagy se abrevia como Am J Physiol. {Títulos de una sola palabra, como Science, nunca se abrevian.) Para cada año calendario, a las ediciones de una revista se les asigna un número de volumen. La primera edición de un determinado vo lumen se denomina edición 1, la segu nda es la edición 2, y así sucesivamente. Las citas originadas en páginas web requieren un formato diferente. A continuación se sugiere uno: Autor/Editor (si lo conoce). Fecha de revisión o derecho de autor (si está disponible). Título de la página web (Medio de publicación). Ed itor de la pági na web. Dirección de la página web (fecha de acceso).

Por ejemplo: Patton G. (ed itor). 2005. Biological Journals and Abbreviations. (Online). National Cancer lnstitute. http://home.ncifcrf.gov/research/bja (fecha de acceso: 1Ode abril de 2005). A diferencia de los recursos impresos, fas páginas web no son permanentes, y con frecuencia desaparecen o se trasladan . Si usted accede a fa versión en Internet de una revista impresa, deberá cita r el medio impreso en lugar de la página web.

Resumen del capítulo

27

Cómo mencionar el trabajo de otros Copiar o parafrasear material de otra fuente sin reconocerla es una falta de honestidad académica. En el material científico escrito, raramente se utiliza n citas textuales entre comi llas; en lugar de eso, se resumen los contenidos del documento o riginal y se reconoce la fuente, como se indica a continuación: Se sabe que alg unas formas raras de epilepsia se o riginan por mutaciones en los canales iónicos (Mulley et al., 2003). Cuando un artículo tie ne tres o más autores, se usa la abreviatura et al. (de l latín at alii, que significa "y otros"), a fin de ahorrar espacio en el cuerpo de l texto. Los nombres de todos los autores se incl uyen en la cita completa, que, por lo general, se encuentra e n la sección Referencias al final del artícu lo. Las listas de referencias se o rganizan a menudo alfabéticamente, por el apellido del primer autor del art ícu lo.

2

8

10

13

18

Resumen del capítulo l. La fisio logía es el estudio del funcionamiento normal de los organismos vivos y las partes que los componen (p. 2).

La fisiología es una ciencia integradora 2. Muchas funciones complejas son propiedades emergentes que no pueden predecirse a partir de las propiedades de las partes que Jas componen (p. 2) 3. Los fisiólogos estudian los diversos niveles de o rganización de los organismos vivos, desde las moléculas hasta las especies. (p. 2; fig. 1-1 ) 4. La célula es la unidad estrnctural más pequeña capaz de llevar a cabo todos los procesos vitales. (p. 3 ) 5. Los conjuntos de células que desarrollan funciones relacionadas forman tejidos y órganos. (p. 3) 6. El cuerpo humano tiene diez sistemas y aparatos fisiológicos: tegumentario, locomotor, respiratorio, digestivo, urinario, imuwútario, circulatorio, nervioso, endocrino y reproductor (p. 3; Cuadro 1-1 )

Funci ón y mecanismo 7. La función de un sistema o de un evento fisiológico es el "porqué" del sistema; el mecanismo por el cual dicho proceso ocurre es el "como" del sistema. El enfoque teleológico de la fisiología explica por qué ocurren los eventos; el enfoque mecanicista explica cómo ocurren. ( p. 3) 8. La investigación aplicada IJeva los resultados de la investigación fisiológica basica a los problemas médicos. (p. 7)

Temas de fis iología 9. Los cuatro temas principales de la fisiología son las relaciones entre estructura y función, tales como las interacciones molecuJares y la compartimentación; el uso de la energía biológica; el flujo de información dentro del organismo, y la homeostasis. (p. 8)

Homeostasis 10. Homeostasis es el mantenimiento de un medio interno relativamente constante. Entre los parámetros que están regulados para mantener la homeostasis se encuentran la temperatura, el pH, las concentraciones de iones, el oxígeno y el agua. (p. 1O) 11. La incapacidad de mantener la homeostasis puede conducir a la enfermedad. (p. JO; Fig. 1-3) 12. El medio interno del organismo es el líquido ~'traceluJar. (p. 11; Fig. 1-4 ) 13. El cuerpo humano como un todo está adaptado para responder a un entorno variable, pero la mayoría de las células del cuerpo pueden tolerar muchos menos cambios. (p. 11 ) 14. La ley de equilibrio de masas establece que, para que la cantidad de ttna sustancia del organismo permanezca constante, toda entrada debe ser compensada por una pérdida idéntica. (p. l l; rig. 1-s) 15. La entrada de una smtancia en el organismo se origina en el metabolismo o en el medio externo. La salida ocurre a través del metabolismo o de la excrec.ión. (p. 13; Fig. 1-5) 16. El índice de ingesta, la producción o la salida de una sustancia x se expresan como flujo de masas, donde flujo de masas = concentración X flujo de volumen . (p. 13) 17. Depuración es la velocidad a la que la sustancia es eliminada de la sangre a través de la excreción, de la metabolización o de ambos. El hígado, los riñones, los pulmones y la piel liberan smtancias de la sangre. (p. 13) 18. Las células y el líquido extracelular mantienen la homeostasis, pero la composición de ambos no es idéntica. Su condición estable es un estado estable dinámico. (p. 14) 19. La mayoría de los solntos se concentra en un compartimento o en otro, creando un estado de desequilibrio. (p. 14; Fig. 1-6)

28

Capítulo 1 Introducción a la fis iología

Sistemas de control y homeostasis 20. Las variables reguladas tienen un punto de referencia y un rango normal. ( p. 14; Fig. 1-10) 21. El control homeostático más simple tiene lugar a nivel del tejido o la célula y se denomina control local. (p. 15; Fig. 1-8) 22 . Los sistemas de control tienen tres componentes: una señal de entrada, un centro integrador y tma señal de salida. (p. 15; Fig. 1-7) 23. Las vías reflejas pueden dividirse en bucles de respuesta y b ucles de retroalimentación . Un bue.le de respuesta se inicia cuando un estím ulo es detectado por un sensor . La señal de entrada comunica el sensor con el centro integrador , que decide la respuesta adecuada. La seiial de salida viaja del centro integrador al objetivo que ejecuta la respuesta adecuada. (p. 16; Fig. 1-9) 24. En la retroaliment ación negativa , la respuesta se opone al estímulo original o lo elimina; a su vez, este detiene el bucle de respuesta. (p. 17; Fig. 1-l l a) 25. En los bucles de ret roalimentación positiva, la respuesta refuerza el estimulo en lugar de atenuarlo o eliminarlo. Esto desestabiliza el sistema hasta que alguna intervención o evento externo al bucle detiene la respuesta. ( p. 18; Figs. 1-1 1b, Jd2) 26. El control de prealimentación permite al cuerpo predeci1· que se avecina un cambio y anticiparse a este iniciando el bucle de respuesta. ( p. 18) 27. Las variables que cambian de fo rma predecible se denominan ritmos biológicos. Aquellos que coinciden con los ciclos de luz-oscuridad se denominan ritmos ci.rcaclianos (p. 19: Fig. 1-1 3) La ciencia de la fisiolog ía 28. La observación y la experimentación son los elementos clave de la investigación científica. Una hipótesis es una suposición lógica sob re cómo ocurre un evento. (p. 20)

Preguntas Nivel 1: revisión de hechos y términos 1. Defina fisiología. Describa la relación entre la fisiología y la anatomía. 2. Nombre los diferentes niveles de organización en la biosfera. 3. Nombre los diez sistemas )' aparatos del organismo y mencione su funcíón o funciones principales. 4. ¿Qué significa que "la fisiología es una cíencia integradora"? 5. Defina homeostasis. Nombre algunas variables reguladas que se mantengan homeostáticamente. 6. Nombre cuatro temas principales de la fisiología. 7. Ordene las siguientes partes de un reflejo de la manera correcta para un bucle de respuesta fisiológico: señal de entrada, centro de integración, seiíal de respuesta, respuesta, sensor, estímulo, blanco. 8. Nombre las fluctuaciones diarias de funciones corporales como la presión sanguínea, la temperatura y los procesos metabólicos.

29. En la experimentacion científica, el factor manipulado por el investigador es la variable i.udepencliente y el factor observado es la var iable dependiente. Todo experimento bien diseñado tiene un control para asegurarse de que los cambios observados se deban a la manipulación e.xperimental y no a otro factor externo. (p. 20 ) 30. Los datos, la información recolectada durante el experimento, se analizan y se presentan, a menudo en forma de gráfico. (p. 20; Fig. 1-14)

3 l. Una teoría cien tífica es una hipótesis que ha sido confirmada por los

32.

33.

34.

35.

datos en varias ocasiones. Cuando la nueva evidencia experimental no coincide con una teoría o modelo, entonces estos deben ser revisados. ( p. 20) La experimentación en animales es una parte importante del aprendizaje de la fisiología humana debido a la enorme variabilidad entre los seres humanos y porque es d ifícil controlar los experimentos en estos últimos. Además, cuando se utilizan los seres humanos como sujetos de experimentación surgen problemas éticos. (p. 21 ) Como integrantes del grupo de control, en muchos experimentos algunos sujetos suelen tomaT una sustancia inactiva llamada p lacebo. Una dificultad de los experimentos con humanos surge de los efectos placebo y nocebo, en los cuales ocurren cambios aun cuando el tratamiento es inactivo. (p. 21) En un estuclio c.on enmascarami ento o ciego, el sujeto ao sabe si recibe el tratamiento experimental o un placebo. En un estuclio con doble enmascarami ento o doble ciego, una tercera persona, que no participa del experimento, es la única que sabe cuál grupo es el experimental y cuál el control. En un est uclio con grupos cruzados, el grupo control de la primera mitad del experimento se transforma en el experimental en la segunda, y viceversa. (p. 21 ) El metanálisis de los datos combina los obtenidos en varios estudios para observar tendencias. (p. 25)

Véanse las respuestas en el apéndic.eA

Trate de incluir las funciones de codos los componentes del mapa y recuerde que algunas estructuras pueden compartir funciones. (Sugerencia: comience con el cuerpo humano como término más importante. Puede también dibujar la silueta de un cuerpo)' desarrollar el mapa sobre esa base. ) 10. Mencione las diferencias entre los términos de cada grupo. (a) tejidos y órganos (b) eje x y eje y en un gráfico (c) variables dependientes e independientes (d ) enfoques teleológico y mecanicista ( e) medio interno y medio externo para el rnerpo humano (f ) estudios clínicos ciego, doble ciego y con grupos cruzados 11. Mencione todos los órganos o estrucntras corporales que pueda que se conecten directamente con el medio externo.

Nivel 2: revisión de conceptos

12. ¿Qué sistemas orgánicos son responsables de la coordinación de las funciones corporales? ¿Y de proteger el organismo de los agentes invasores? ¿Qué sistemas intercambian sustancias con el medio exterior y qué intercambia cada uno?

9. Creación de uu mapa conceptual: dibuje un mapa grande que muestre la organ ización del cuerpo humano. Muestre todos los niveles de o rganización (véase fig. 1-1) y los diez sistemas y aparatos orgánicos.

13. Explique las diferencias entre los mecanismos de retroalimentación positiva, retroalimentación negativa y prealimentaci(m. ¿En qué circunstancias resultaría ventajoso cada uno de ellos?

Pregun tas Nivel 3: reso lución de problemas 14. Un grupo de expertos en biología fueron a un centro comercial y preguntaron a los transeúntes: "¿Por qué fluye la sangre?''. Estas son algunas de las respuestas que recibieron. ¿Cuáles de ellas son teleológicas y cuáles mecanicistas? ( No todas las respuestas son correctas, pero aun así se las puede clasificar.} (a) l'or la gravedad (b) Para llevar oxígeno y nutrientes a las células (c) Porque si no fluyese, marinamos (d} Por la acción propulsora del corazón 15. Aunque la deshidratación es uno de los problemas fisiológicos más importantes que deben superar los animales terrestres, existen otros. Mencione tantos como pueda y piense varias estrategias que los distintos seres terrestres tengan para superarlos. (Sugerencia: piense en los seres humanos, los insectos y los anfibios; piense también en todos hábitats terresues posibles.)

16. Un grupo de estudiantes deseaba ver el efecto de una dieta deficiente en vitamina D sobre el crecimiento de peces pequeños de agua dulce. Los alimentaron con una dieta de esas características y midieron el largo corporal cada tres días, durante tres semanas. Los datos obteni dos fueron los siguientes:

o

Día

dicion aeróbica)' la medida de la circunferencia muscular en sus brazos. la relación entre esas dos variables se muestra en el siguiente gráfico:

Superior


o

:o -o

Excelente

~

(1)


o
Cl.
Longitud del cuerpo promedio (mm) 6

3

7

6 9

••

• •• • • • • • • • • • • • • •• • • • • •

Bueno

Pobre

ü

Muy pobre

10

Nivel 4: problemas analíticos

29

20

30

40

Circunferencia del brazo (CM)

(a) ¡Qué tipo de gráfico es este? (b) ¿Cuál era la pregunta que se planteaban los investigadores? (c) 1:n una frase, resuma la relación entre las dos variables graficadas.

12 15 18 21

9 12 14 16 18 21

(a) ¿Cuáles fueron las variables independiente y dependiente en este experimento? (b) ¿Cuál fue el control? (c) Construra un gráfico con nombres y leyendas utilizando los datos del cuadro. (d) ¡Durante qué período de tiempo el crecimiento fue menor? ¿Cuándo fue más rápido? ( Utilice el gráfico para responder esta pregunta. ) 17. Usted llevó a cabo un experimento en el cual midió los volúmenes de nueve rodajas de patata y, luego, las swnergió en soluciones de diferente salinidad durante 30 minutos; a continuación midió nuevamente el volumen de las nueve rodajas. Los cambios observados fueron: % de c,-imbio en volwnen tras 30 minutos

Solució n

Muestra l

Muestra 2

Muestra 3

Agua destilada

10%

8%

) l o/o

l % sal (NaCl)

0%

-0,5%

l o/o

9% sal (NaCI}

-8%

-12%

-11 %

(al ¡Cuál fue la variable indepencüente en es1e experimento? ¿Cuál la dependiente? (b) ¡Puede decir, a partir de la información dada, si hubo w1 control en este experimento? Si lo hubo, ¡cuál fue? (e) Hepresente mecüante un gráfico los resultados del expe1imento utilizando el tipo de gráfico más adecuado. 18. Al finalizar el semestre, una cla~e de nivel intermedio de veinticinco

levantadores de pesas varones fue evaluada para determinar su con-

19. Responda las preguntas al final del sigujente resumen de un artículo. Se llevó a cabo un estudio' en personas voluntarias para determinar si los procedimientos realizados durante la cirugía artroscópica ( arthro- , articulación,+ scopium, mirar) eran eficaces para aliviar el dolor de rodilla asociado con Ja osteoartritis o enfermedad articular degenerativa. Los voluntarios tenían hasta 75 años y fueron reclutados en el Veteran Affairs /vledical Center. El 93% era de sexo masculino y el 60% , de raza blanca. Un tercio de los sujetos fue sometido a operaciones de tipo placebo, es decir que se les dio aneste~ia y se les hizo una incisión en la rodilla, pero el resto del tratamiento no se llevo a cabo. Los dos tercios restantes del grupo fueron sometidos a uno de los dos procedimientos. Se siguió a los sujetos durante dos años, al cabo de los cuales respondjeron a una serie de preguntas acerca del dolor )' el funcionamiento de su rodilla, y se los sometió a pruebas objetivas caminando y subiendo escaleras. Al final de estudio, los resultados mostrarnn que no había diferencias significativas en el funcionamiento de la rodilla ni en la percepción del dolor entre los sujetos que habían recibido los tratamientos estándar y quienes habían sido tratados con placebo. ( a) ¿Considera ético realizar cirugías de tipo placebo en seres humanos que sufren una enfermedad, aun si se les informa que pueden recibir este tratamiento en lugar de una intervención convencional? (b ) Mencione dos explicaciones posibles para la disminución del dolor informada por los pacientes sometidos a la inten·ención de tipo placebo. (c) Analice y critique el dise1'10 experimental de este estudio. ¿Los resultados son aplicables a cualquier persona con dolor de rodilla?

'° J. B. Moseley et al. A controlJed trial of arthroscopic surgcry for osteoarthritis of che krtee. N Etig J Me,/ 347(2): 81-88, 2002.

30

Capítulo 1 Introducción a la fisiología

Respuestas (d) ¿El diseño del estudio fue ciego, doble ciego o doble ciego con grupos cruzados? (e) ¿Por qué piensa que los investigadores creyeron necesario incluir un grupo placebo en este estudio?

Página 20 5. La variable independiente es la cantidad de agua que beben los estu-

diantes. La variable dependiente es la orina. Página 23

6.

(

Respuestas a las preguntas de revisión

Página 14

1. El gramo de sal restante permanece en el organismo. 2. El metabolismo de la glucosa agrega CO, a la sangTe y agua al organismo, alterando el equilibrio de masas entre estas dos sustancias. Para mantener el equílibrio, ambos metabolitos deben ser excretados u objeto de una mayor metabolización.

e Respuestas a las preguntas de las figuras Página 25

Figura 1-2: (a) Se podrían incluir diferentes clases de panes, carnes, etc., o agregar categorías de características de emparedados, como la temperatura (fríos, calientes) o las capas (simples, varias).

Página 16

3. Si el agua del acuario se sobrecalentó, no hay un mecanismo de control para retornarla al rango deseado.

Este mapa de muestra es w,a de las maneras posibles de ordenar los términos. Note que algunos de ellos están unidos a más de uno de los demás términos. El mapa no incluye muchos términos que podrían agregarse.

Página 18

4.

(a) El control de actividad fue la variable independiente (eje x), y la frecuencia cardíaca, la dependiente (eje y ). (b ) Un gráfico de ltneas sería apropiado para estos datos, pero también puede usarse un gráfico de barras si la intensidad del ejercicio fue la misma en todos los sujetos. (c) Para mostrar la diferencia entre hombres y mujeres, los gráficos deberían tener líneas o barras separadas para cada sexo.

La retroalimentación negativa apaga el calentador.

EL CUERPO 1

1 Aparato respiratorio

Aparato cardiovascular

Aparato digestivo

Sistema inmunitaric

Sistema nervioso

Sistema endócrino

Aparato reproductor

1

~ Vasos sanguíneos

1 ¡eorazónl

Ji IPulmones l

i Ganglios linfáticos

' ICerebro l

1 Boca 11 Estómago 1 lntestino l

Página 22-23

figura l-14b: Los pájaros prefirieron la dieta A. Figura l-14c: Veinticuatro estudiantes respondieron las preguntas. Figura l-14d: Los ratones machos (línea azul) incrementaron su peso en mayor medida entre los días I y 2. Figura l-14e: (a) en la Figura l-14d, el investigador observó los cambios del peso corporal de los ratones machos y hembras en el tiempo. En la Figura l-14e, trató de determinar si había una relación entre el tiempo que el alumno pasaba estudiando para un examen y la calificación obte-

!

!

Aparato urinario

Sistema tegumentario

! Aparato locomotor

r-7 Glándula tiroidea

1 Vejiga 11 Riñones 1

1Testículos 1 1Ovarios 11 Útero 1

nida. (b) En la Fii¡ura J -14d. la variable independiente es el tiempo y la variable dependiente, el peso corporal. En la Figura l-14e, la variable independiente es el número de horas de estudio, y la dependiente, la calificación del estudiante. (c) La Figma 1-14d muestra que los ratones machos pesaban más que las hembras desde el inicio del experimento y que el peso corporal aumenta con el tiempo. La taza de incremento es práctkamente la misma en machos y en hembras, según muestran las líneas casi paralelas. L1 Figura l-14c muestra que más horas de eshtdio dieron e.amo resultado mejores notas en el examen.

Interacciones moleculares Moléculas y enlaces

32 38 38 39

La mayoría de las biomoléculas contienen carbono, hidrógeno yoxígeno Los electrones cumplen cuatro funciones biológicas importantes Los enlaces covalentes entrelos átomos crean moléculas Los enlaces no covalentes facilitan interacciones reversibles

Interacciones no covalentes

43 47 47

Las interacciones hidrofflicas crean soluciones biológicas La estructura molecular está relacionada con la función molecular Los iones de hidrógeno en solución pueden alterar laestructura molecular

Interacciones proteicas SO Las proteínas son selectivasrespecto de las moléculas alasque se unen SO Las reacciones de unión alas proteínas son reversibles SO Las reacciohes de unión obedecen la ley de acción de masas

51 52 56 56

La constante de disociación indica laafinidad Múltiples factores alteran la unión proteica El cuerpo regula la cantidad de proteínas en las células La velocidad de reacción puede alcanzar un máximo

e

erca de 100 años atrás, dos científicos, Aleksander üparin en Rusia )' John Haldane en lnglaterra, especulaban sobre cómo la vida podría haber aparecido en una Tierra primitiva cuya atmósfera consistía principalmente en hidrógeno, agua, amoníaco y metano. Sus teorías fueron puestas a prueba en 1953, cuando un científico de 23 años de edad Llamado Sranley Miller comb inó estas moléculas en un matraz cerrado y las h irvió durante una semana al tiempo que disparaba periódicamente descargas de electricidad a través de ellas, simulando rayos. Al finalizar su prueba, Miller encontró q ue se habían formado am inoácidos en el matraz. Con este simple experimento, había demostrado que era posib le crear moléculas orgánicas, h abitualmente asociadas con los seres vivos, a partir de p recursores inorg;inicos inertes. Los experimentos de Mille r fueron un intento temprano de solucionar uno de los más grandes misterios de la b iología: ¿cómo fue posible que un conjunto de sustancias quím icas llegar a adquirir por primera vez las complejas propiedades que asociamos con los seres vivos? Todavía no tenemos una respuesta a esta pregunta. Numerosas teorías científicas han sido propuestas, desde la Llegada de la vida en un meteorito proveniente del espacio exterior hasta la formación de moléculas en ven tilas hidrotermales en las profundidades del océano. 1ndependientemente de su o rigen, las moléculas asoc iadas a los organ ismos vivos tienen la capacidad de o rganiza rse en compa rtimentos, replicarse y actuar como catalizadores para acelerar las reacciones que, de lo contrario, sucederían de form a demasiado lenta para ser útiles. El cuerpo humano está muy distanciado de las formas de vida más primitivas, pero seguimos siendo una colección de sustancias químicas: so lucio nes diluidas de moléculas disueltas y suspendidas contenidas en compartimentos con paredes lipoproteicas. Las fuertes uniones en Lre los átomos, conocidas como enlaces quimicos, almacenan y transfieren la energía para sostener las funciones vitales. Interacciones más déb iles entre y den tro de las moléculas crean formas moleculares distinLivas )' perm iten a las moléculas b iológicas interactuar de manera reversible entre ellas. Este capítulo introduce algunos de los principios fundamentales de las interacciones moleculares que usted encontrará repetidamente en su estud io de la fisiología. Más del 50% del cuerpo humano es agua,

y debido a que la mayoría de sus molécul as están d isueltas en ella, analizaremos las propiedades de las soluciones acuosas. Si desea refrescar sus conocimientos sobre las características principales de los átomos, los enlaces qltimicos y las biomoléculas, encontrará una serie de revisiones de una o dos páginas que resum en la bioquím ica de acuerdo con su importancia para la fisiología. Puede poner a prueba su conocimiento sobre química y bioquím ica básicas con un cuestionario especial al fü1al del capítulo.

Moléculas y enlaces Hay más de 100 elementos quím icos conocidos sobre la Tierra, pero solo 3-oxígeno, carbono e hidrógeno- co nstituyen más del 90% de la masa corporal. Estos J, más 8 elemen tos adicionales, son considerados eleme11tos esenciales pri11cipales. Otros 19 eleme11tos esenciales menores son requeridos en cantidades ínfimas. Al final de este libro puede encontrar una tabla periódica que muestra los elementos esenciales principales y menores.

La mayoría de las biomoléculas contienen carbono, hidrógeno y oxígeno Las moléculas que contienen ca rbono reciben el nombre de moléculas org;foicas debido a que en su momento se creía que todas existían en el in terior de las plantas y de los animales o provenían de estos. A las moléculas orgánicas asociadas con los organismos vivos también se las Llama biomoléculas. Hay cuatro grupos principales de biomoléculas: los carbohit-Lratos, los lípidos, las proteínas)' los nucleótidos. El cuerpo utiliza los tres primeros grupos para obtener energía y como ladrillos para la construcción de los componentes celulares. El cuarto grupo, los nudeótidos, incl u)'e el ADN, el ARN, el ATP y el AMP cíclico. El ADN y el ARN son los componentes estructurales del material genético. El ATP (adenosina Lrifosfato ) )' las moléculas relacionadas transpo rtan energía, mientras que el AMI' cíclico (adenosina monofosfato cíclico; cAi\llP) y los compuestos relacionados regulan el metabolismo. Cada grupo de biomoléculas tiene una composició n y una estructura molecular características. Los lipidos están formados mayorita riamen te po r ca rbono e h idrógeno (a Fig. 2- 1). Los carbohidratos están constituidos principalmen te por carbono, hidrógeno y oxígeno en la proporción CH,O Fi g. 2-2). Las proteínas y los nudeótidos contienen nitrógeno además de carbono, hidrógeno y oxígeno <• Figs. 2-3 y 2-4). Dos aminoácidos, los ladrillos de las proteínas, también contienen azuíre. Si n embargo, no todas las biomoléculas son proteínas, carbohidratos o lípidos puros. Las proteínas conjugadas son moléculas de proteínas conjugadas con o tro tipo de biomolécula; por ejemplo, las proteínas se combinan con lípidos para fo rma r lipoproteínas. las lipoproteínas se encuentran en las membranas celulares y en la sangre, donde actúan como transportadoras de moléculas menos so lubles tales como el coleste rol. Las moléculas glucosiladas son moléculas a las que se ha adherido un carboh idrato. Las proteínas combinadas con carbohidratos fo rman las glucoproteínas. Los lípidos unidos a carbohidratos se convienen en glucolípidos. Las glucoproteinas y los glucolípidos, así como las lipoproteínas, son componentes importan tes de las membranas cel ulares (véase el Ca pítulo 3).

<•

Suplementos de cromo "Pierda peso al t iempo q ue gana músculos~ promete la publ icidad. "Evite las enfermedades card íacas". "Estabilice sus niveles de azúcar en sa ng re~ ¿Qué es esta sustancia milagrosa? Es picolinato de cromo, un suplemento nutriciona l an unciado para consumidores q ue buscan una solución rápida . Sin embargo, ¿funciona? ¿Y es seguro? Alg unos atletas, como Stan - el mediocampista estrella del equipo de fútbol americano universitario- , tienen una g ran confianza e n el producto. Stan toma diariamente 500 microgramos de picolinato de cromo. Sin embargo, muchos investigadores son escépticos y creen que no se han establecido la necesidad ni la seg uridad de los suplementos de cromo.

43

32

47

49

52

57

Bioquímica de los lípidos Los lípidos son biomoléculas formadas principalmente por carbono e hidrógeno. la mayoría de los lípidos tienen un esqueleto de g licerol y 1-3 ácidos grasos. Una característica importante de los lípidos es que son no polares y, por lo tanto, no son muy solubles en agua. Los lípidos pueden dividirse en dos amplias categorías.

l:. Las grasas son sólidas a temperatura ambiente. la mayoría de las grasas provienen de fuentes animales. l:. los aceites son líquidos a temperatura ambiente. la mayoria de los lípidos vegetales son aceites.

Constitución de los lípidos

Ácidos grasos

Los ácidos grasos son largas cadenas de átomos de carbono unidos a hidrógenos, con un grupo carboxilo (-COOH) o "ácido" en uno de los extremos de la cadena.

El glicerol es una molécula si mple de 3 carbonos que conforma el esqueleto de la mayoría de los lípidos.

Ácido palmítico, un ácido g raso saturado

H H l 1 H3c - c-c I 1 H H

H H H H 1 1 1 1 c-c-c-c1 I 1 1 H H H H

H H 1 1 c-c 1 1 H H

H H 1 1 c-c 1 1 H H

Glicerol

H H H H 1 1 1 1 c-c- c- c - c 1 1 1 1 '-OH H H H H

Los ácidos grasos saturados no tienen enlaces dobles entre los carbonos, por lo tanto, están "saturados" de hidrógeno. Cuanto más saturado sea un ácido graso, más probabilidades tiene de ser sólido a temperatura ambiente.

El glicerol más un ácido graso forma un monoglicérido.

1

+ 1 Ácido graso

Monoglicérido

Ácido graso

Ácido oleico, un ácido graso monoinsaturado

H H H H H H H H H H H H H H H H

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

El glicerol más d os ácidos grasos forma un diglícérido.

H3C- y - 9 - 9 - 9- 9 - 9 -9-c = c - 9 - 9 - y - 9 - 9 - 9 - 9 - c,OH HH H HH H H HHH HH HH

Oiglicérido

Los ácidos grasos monoinsaturados tienen un enlace doble entre dos carbonos de la cadena. Por cada enlace doble, la molécula tiene dos átomos de hidrógeno menos unidos a la cadena de carbono. Acido linoleico, un ácido graso poliinsaturado

HHH 1 1 1 H3c -y-c=c H

H HHHHHHHHH H HH 1 1 1 1 1 1 1 1 1 1 1 1 1 9- c=c - 9-c=c - 9 - 9 - 9 - 9 - y - 9 - 9 - c,OH H H HHH H HHH

Los ácidos grasos poliinsaturados tienen dos o más enlaces dobles entre carbonos de la cadena.

Ácido g raso

Ácido graso 1

El glicerol más tres Triglicérido ácidos grasos forma un triglicérido (triacilglicerol). Más del 90 % de los Ácido graso lípidos se encuentran en forma de triglicéridos.

Ácido graso

Ácido graso

Moléculas relacionadas con los lípidos Además de los lipidos verdaderos, esta categoría incluye tres tipos de moléc ulas relacionadas con los lípidos. Fosfolípidos

Eicosanoides

Esteroides

los eicosanoides (eikosi , veinte} son ácidos grasos de 20 carbonos modificados, con una anillo de carbono completo o parcial en un extremo y dos largas "colas" formadas por cadenas de carbono.

Los esteroides son moléculas relacionadas con los lípidos cuya estructura incluye cuatro anillos de

H

1

H - c - cH2 - cH2 - c11 2 - c - cH3 1

H3C

CH3

El colesterol es la fuente principal de los esteroides del cuerpo humano.

Los fosfolipidos tienen dos ácidos grasos y un grupo fosfato (- H2PO4). El colesterol y los fosfol ípidos son componentes fundamentales de las membranas celulares animales.

Ácido graso

HO OH

CH20H

OH

1

H3cc = o

Prostaglandina E2 (PGE2)

los eicosanoides tales como tromboxanos, leucotrienos y prostaglandinas actúan como reguladores de funciones fisiológicas.

Ácido graso

__..._ ,..,,....~ - ·OH

Grupo fosfato Cortisol

o

Bioquímica de los carbohidratos Los carbohidratos son las biomoléculas más abundantes. Deben su nombre a su estructura, literalmente, carbono {carba-} con agua {hydro-). La fórmula general de un carbohidrato es (CH20}n o CnH2nOn, que índica que por cada carbono hay dos hidrógenos y un oxígeno. Los carbohidratos pueden clasificarse en tres categorías: monosacáridos, disacáridos y polímeros complejos de glucosa llamados polisacáridos.

Monosacáridos Los monosacáridos son azúcares simples. Los monosacáridos más comunes son los ladrillos de los carbohidratos complejos y tienen cinco carbonos, como la ribosa, o seis carbonos, como la glucosa. Azúcares de cinco carbonos (pentosas) Ríbosa

Azúcares de seis carbonos (hexosas)

Desoxirríbosa

"ºV ""ºtµ" OH

OH

~

HO~OH~ H

H/ H 1 ó 1 -O'{ 1 C H 1 \. ?H H / 1 HO '!:,...),/ HO 1 1 H OH

' Y CH20H OH

OH Nótese que la única diferencia en tre la glucosa y la galactosa 1 es la disposición espacial de los grupos hidroxilo (-OH)

C5H10O4

.i Forma el esqueleto de azúcar-fosfato delARN.

Galactosa

H-C- OH

OH

C5H10O5

Glucosa (dextrosa)

Fructosa

.i Forma el esqueleto de azúcar-fosfato delADN.

Disacáridos Los d isacáridos consisten en glucosa más otro monosacárido.

Maltosa

Sacarosa (azúcar de mesa) Glucosa + Fructosa

Lactosa

Glucosa + Glucosa

• En notación científica abreviada, H OCH2 ~ H O ~ O H los carbonos en los anillos y sus átomos de hidrógeno asociados O HO no se escriben. Compárese esta HO CH2OH notación con la estructura de la OH OH glucosa en la fila de arriba.

Galactosa + Glucosa

~º"o~º"

H~

~

OH

H ; : cO " n H

OH

~O"

~~H OH

OH

Polisacáridos Los polisacáridos son polímeros de glucosa. Todas las célu las Animales vivas almacenan glucosa como reserva de ~ - - - - ~1 -- - - - ~ energía en forma de } polisacárido. Quitina** Glucógeno en animales invertebrados

+

Celulosa** Los humanos no pueden digerir celulosa y obtener 6H2 HOCH2 HOCH2 su energía, pese a k }-0, k que es el polisacárido ~ más abundante sobre la Tierra

:o:o:~

HOCH2 H0CK2 HOCH2

Moléculas de glucosa

•• La quitina y la celulosa son polisacáridos estructurales.

l___________

Levaduras y bacterias

Plantas 1

La digestión del almidón o del glucógeno produce maltosa.

g

t Almidón

a.

~

Dextrano

Bioquímica de las proteínas Las proteínas son polímeros constituidos por moléculas más pequeñas llamadas aminoácidos.

Aminoácido

Aminoácido

~ //0 N-C-C H/ 1 ' OH R

H,

H, Aminoácidos Todos los aminoácidos tienen un grupo carboxilo (-COOH), un grupo amino (-NH2), y un hidrógeno unidos al mismo carbono. El cuarto enlace del carbono se une a un grupo "R" variable. El nitrógeno {N) en el grupo amino - - ~ hace que las proteínas sean nuestra \ principal fuente dietaría de nitrógeno.

~

NH

-

/20

e- cf

----- i 2

Los grupos R difieren en su tamaño, forma y capacidad para formar puentes de hidrógeno o iones. Debido a los diferentes grupos R, cada aminoácido reacciona con otras moléculas en una manera única.

H,

H/

-

Abreviatura de Símbolo de una letra tres letras

Arainina

Ala Ara

Asoaraaina Asparagina o ácido aspárticc !Acido aspártico

Asn Asx Asp

Cisteína

Cys Glu

Ácido glutámico Glutamina Glutamina o ácido glutámico Glicina Histidina soleucina eucina isina \11etionina Fenilalanina Prolina Serina Treonina Triptófano Tirosina Valina

-

,.

,_

+ H/

I

'OH

R

En un enlace peptídico, el grupo amino - - - - - - de uno de los aminoácidos se une al grupo carboxilo del otro aminoácido, / ~ ~ ~ ~ //0 con la pérdida de agua. 1

1

R

R

'oH

Estructura de péptidos y proteínas

Veinte aminoácidos diferentes se encuentran comúnmente en las proteínas naturales. El cuerpo humano puede sintetizar la mayoría de ellos, pero, en diferentes etapas de la vida, algunos aminoácidos deben ser obtenidos a través de la dieta y son, por lo tanto, considerados aminoácidos esenciales.

Alanina

//0

N-C- C- N-C- C

'OH

Aminoácidos en las proteínas naturales

Aminoácido

~

N-C-C

A

Estructura primaria Los 20 aminoácidos que forman las proteínas se ensamblan formando polímeros llamados péptidos. La secuencia de aminoácidos en la cadena peptídica se llama estructura primaria . Asi como las letras de nuestro alfabeto se combi nan para crear d iferentes palabras, los 20 aminoácidos permiten un número casi infinito de combinaciones. Los péptidos varían en longitud entre dos y dos millones de aminoácidos:

R N

• Oligopéptido {oligo-, pocos}: 2-9 aminoácidos • Polipéptido: 10-100 aminoácidos

B

• Proteínas:> 100 aminoácidos

o e

Estructura secundaria

~

Secuencia de aminoácidos

E

Gin Glx

Q

Gly His

G H

lle Leu Lys Met Phe Pro Ser Thr Trp Tvr

1

\(a,¡

V

z

-Hélice o.

Estructura terciaria

L K M F

Las cadenas se pliegan

p

s T

w

y

-

Nota:

Estructura cuaternaria Múltiples subun idades se combinan

Unos pocos aminoácidos no se encuentran en las proteínas, pero tienen funciones fisiológicas importantes.

• Homocisteína: es un aminoácido que contiene azufre y en exceso se asocia con enfermedad cardíaca • Acido y-aminobutírico {ácido gamma-aminobutirico) o GASA: es una sustancia química sintetizada por las células nerviosas • Creatinina: es una molécula que almacena energía cuando se une a un grupo fosfato

Proteínas fibrosas Colágeno

Proteínas globulares Hemoglobina

Nucleótidos y ácidos nucleicos Los nucleótidos son biomoléculas que tienen un papel trascendental en la transferencia de energía y de información. Los nucleótidos individuales incluyen los compuestos de transferencia de energía ATP (adenosina trifosfato) y ADP (adenosina difosfato), así como AMP cíclico, una molécula importante para la transmisión de señales entre las células. Los ácidos nucleicos (o polímeros de nucleótidos) tales como el ARN y el ADN almacenan y transmiten información genética.

Nucleótido

Un nucleótido consiste en (1) uno o más grupos fosfatos, (2) un azúcar de 5 carbonos, y (3) una estruc tura anular de carbono-nitrógeno llamada base nitrogenada. NH2 1

C

N

N1/ '-e/ ~ 11 EH Base - - - - - - - + -HG.:;::. / N

Fosfato

°'-. / N

Azúcar HO

OH

consta de

Azúcar de 5 carbonos

Base nitrogenada

Fosfato

¡ Las purinas

1tienen una estruc tura anular doble. H C

N1/ 'e / 11

1

HG~

N

N

Las pirimidinas tienen un anillo simple.

~ CH

Ribosa

Desoxirribosa {de-, sin; oxy-, oxígeno}

,ocQJ"

o

11 Ho- P - 0 1

p ..._ /

HO

N

HO

H

Adenina

OH

+ Ribosa

i

Adenosina

Moléculas de nucleótidos individuales

Las moléculas de nucleótidos ind ivid uales tienen dos funciones críticas en el cuerpo humano: (1) captan y transfieren energ ía en forma de electrones d e alta energía o en enlaces fosfato y (2) colaboran en la comunicación intercelular.

+

Otro componente

2 grupos fosfato

+

Nicotinamida

+

2 grupos fosfato

+

Riboflavina

+

1 g rupo fosfato

Base

+

Azúcar

+

Grupos fosfato

Adenina

Ribosa Ribosa

+ +

3 g rupos fosfato

Adenina

+ +

NAD

Adenina

+

2 Ribosa

+

FAD

Adenina

+

Ribosa

cAMP

Adenina

+

Ribosa

Nucleótido consta de

ATP ADP

=

Función

2 grupos fosfato Captación y transferencia de energía

Comunicación intercelular

Los ácidos nucleicos (polimeros de nucleótidos) actúan en el almacenamiento y la transmisión de información. El azúcar de un nucleótido se une al fosfato del siguiente. creando una cadena alternada azúcar-grupos fosfato. Las cadenas azúcar-fosfato, o esqueleto, son las mismas para cada molécula de ácido nucleico.

Cadena de nucleótidos. B extremo del polímero que tiene un azúcar libre se llama extremo 3' ("tres prima"). El extremo del polímero con el fosfato libre se llama extremo 5'.

Extremo 5' ~ - - - - - -- Fosfato

-+-~ Las bases nitrogenadas se extienden al lado de la cadena.

Extremo3'

Extremo 5'

p Extremo3'

l

·•·••··········

Orientación antiparalela: el extremo 3' de una cadena está unido al extremo 5' de la segunda cadena.

Bases nitrogenadas

LEYENDA

~~A~~I [emailprotected]

Esqueletos de azúcar-fosfato

p

<:

ill

Timina

G

!Guanina ~

Puentes de hidrógeno

Citosina Uracilo

p

© © @

Puentes de

Extremo

hidrógeno

l.

Cadena 2 de ADN Extremos•

Fosfato

P

Azúcar

O

Cadena 1 de ADN El ARN (ácido ribonucleico) es un ácido nucleico de una sola cadena cuyo esqueleto contiene azúcar ribosa y cuatro bases: adenina. guanina, citosina y uracilo.

El ADN (ácido desoxirribonucleico) es una doble hélice, una estructura trid imensional que se forma c uando dos cadenas de ADN se unen mediante puentes de hidrógeno entre pares de bases complementarias. La desoxirribosa es el azúcar en este esqueleto y las cuatro bases son adenina, guanina, citosina y timina.

Apareamiento de bases

Las bases de una cadena forman puentes de hidrógeno con las bases de la cadena adyacente. Esta unión sigue reglas muy especificas: t Dado que las purinas son más grandes que las pirimi dinas, las limitaciones espaciales siempre aparean una purina con una pirimidina. t La guanina (G) forma tres puentes de hidrógeno con la citosina (C). t La adenina (A) forma dos puentes de hidrógeno con la timina (l) o con el uracilo (U).

Apareamiento de las bases guanina-citosina

Se requiere más energía para rom per el puente de hidrógeno triple de G;;;c que el puente doble de A::::T o A: :::U

Apareamiento de las bases adenina-timina

Adenina

.....

38

Capítulo 2 Interacciones moleculares

Grupos funcionales comunes

Nótese que el oxígeno, con dos electrones para compartir, a veces forma un enlace doble con otro átomo. Abreviatura

Amino

Carboxilo (ácido)

Hidroxilo

- NH 2

- COOH

- OH

Fosfato

Cationes

Estructura del enlace

.,,,,...- H -

N

-----.._ H

-c /....___ ºOH -

0 -H

-

OH 1 0 P=

11

Iones importantes del cuerpo

2 O

1

OH

Muchas hiomoléculas son polímeros, grandes moléculas conformadas por unidades repeti Livas (poly-, muchas,+ -mer, una parle). Por ejemplo, Lanto el glucógeno como el almidón son polímeros de glucosa. Se diferencian en la forma en que las moléculas de gl ucosa se adh ieren unas a o Lras, como se puede ver en la parte inferior de la Figura 2-2. Algunas combi naciones de elementos, conocidas como grupos funcionales, se encuentran repet idamente en las moléculas biológicas. Los álamos de un grupo funcional tienden a moverse de molécula a molécula como una unidad. Por ejemplo, los grupos hidroxilo, - OH, comunes en muchas moléculas b iológicas, son añadidos o el iminados como un Lodo en lugar de como átomos de hidrógeno u oxígeno. Los grupos amino, -N H,, son la finna de los aminoácidos. El grupo fosfato, - H1 PO, , cumple un rol en muchos procesos cel ulares importan Les, Lales como transferencia de energía y regulación proteica. Los grupos funcionales más comunes están listados en el • Cuadro 2- 1.

3

4

Aniones

Na•

Sodio

c1·

Cloruro

K•

Potasio

HCO 3·

Bicarbonato

c a2+

Calcio

HPO 2·

Fosfato

Hidrógeno

so•2·

Sulfato

Mg2+

Magnesio

Iones. Si un álamo o molécula gana o pierde uno o más electrones, adquiere una ca rga eléct rica y se conv ier te en un ión. Los iones son la base para las señales eléctricas en el Ctterpo. Los iones pueden ser átomos individuales, como el ión sodio Na· )' el ión clo ruro CJ·. Otros iones son combinaciones de á tomos, tales como el ión bicarbonato HCO,-. Los iones im portan tes del cue rpo están listados en el • Cuadro 2-2. Electrones de alta energía. Los electrones en ciertos átomos pueden capturar la energía del ambien te y trans ferirla a oLros á tomos. Esto permile q ue la energía sea u tilizada para la s ínte• sis, el movimiento y otros procesos vitales. La energía liberada tamb ién puede se r emi tida como radiació n. Por ejemplo, la biolumin iscencia en las luciérnagas es luz visible em ilida por electrones de alla energía q ue regresan a su estado normal de baja energía. Radicales libres . Los radicales libres son molécu las inestables con un electrón no pareado. Se piensa que con lribu)•en al envejecimiento y al desarrollo de ciertas enfermedades, como a lgunos cánceres. Los radicales lib res y los elec trones de al ta energía son tratados más adelan le.

Los electrones cumplen cuatro funciones biológicas importantes

El rol de los electrones en la formación del enlace mo lecular se anal iza en la secció n s igu iente. Hay cuatro tipos de enlace comunes, dos fuertes y dos débiles. Los enlaces covalente e ión ico son enlaces fue rte.s po rque req uieren canlidades significativas de energía para fo rmarse o romperse. Los puentes de hidrógeno y las fuenas de Van der Waals son enlaces más déb iles, q ue req uieren mucha menos ene rgía para romperse. Las interacciones entre las moléculas con diferentes tipos de enlaces son responsables de la u Lilización y la lransferencia de energía en las reacciones metabólicas así como en u na variedad de otras interaccio nes reversibles.

Un átomo de cualquier elemento tiene una combinación ún ica de protones y electrones que deLermina las prop iedades del elemento (a Pig 2-5). Estamos particularmente interesados en los electrones porque cumplen cuatro funciones en la fisiología:

Los enlaces covalentes entre los átomos crean moléculas

Revisión 1. Nombre tres elementos esenciales principales que se encuentrenenel CUefPO humano. 2. ¿Cuál es lafórmula generalde un carbohidrato? 3. ¿Cuál e; la fórmula química de un grupo amino? ¿Y la deun grupo carboxilo?

J

Enlaces covalentes. La disposición de los electrones en el nivel de energía externo (capa) de un átomo detenn ina la capacidad de un elemen to de unirse con otros elementos. Los electrones comparLidos po r los ,ítomos forman enlaces covalentes fuerles y así crean moléculas.

Las moléculas se fonnan cuando los átomos comparten pares de electrones - un electrón de cada átomo- para crear enlaces covalentes. Estos fuertes enlaces reqtúeren energía para romperse. Es posible predeci r cuántos enlace.~ covalen tes puede formar un átomo sabiendo cuántos electrones no pareados hay en ~u capa externa, ya que un átomo es más estable cuando todos sus electrones est,\n pareados ( a Fis . 2-6).

Moléculas y enlaces

¿Qué es el picolinato de cromo? El cromo (Cr) es un elemento esencial que ha sido relacionado con un metabolismo de g lucosa normal. En la dieta, el cromo se encuentra en la levad ura de cerveza, el brócoli, los hongos y las manzanas. Debido a que e l cromo de la comida y los suplementos de cloruro de cromo son poco absorbidos en el tract o digestivo, u n científico desarrolló y patentó el compuesto picolinato de cromo. El picol inato, derivado d e ami noácidos, a umen ta la captación de cromo en el in testino. A pa rtir de 2001, la ingesta adecuada (IAJ de cromo recomendada para hombres de 19-50 a ños de edad es de 35 µ g/día (para las mujeres es de 25 µ g/ día). Como hemos visto, Stan consume más de 10 veces esta ca ntidad.

39

puestas principalmen te po r carbono e h idrógeno, tales como los ácidos grasos mostrados en la Figura 2-6a, tienden a ser no po ta.res. Esto se debe a q ue el carbo no no atrae los electrones tan fuertemente como lo hace el oxígeno, de lo cual resulta que los carbonos y los h idrógenos compa rten los electrones uniformemen te,)' la molécttla no tiene regiones de ca rga parcial.

los enlaces no covalentes facilitan interacciones reversibles Los enlaces iónicos, los p uentes de hid rógeno )' las fuerzas de Van der \Vaals son enlaces no e.avalentes. Cumplen fu nciones impo rtantes en los procesos fisiológicos, incl uyendo el pH, la estrnctura molecula r y la un ión revers ible en tre las moléculas.

P1 : Encuentre el cromo e n la tabla periódica de ele mentos. ¿Cuál

Enlaces i6nicos Los iones se fo rman cuando un átomo tiene u na

es su n úmero atómico? ¿Cuál es su masa atómica? ¿Cuántos electrones tiene u n átomo de cromo? ¿Qué elementos cercanos al cromo son también elemen tos esenciales?

atracción tan fuerte por los electro nes q ue q uita a o tro áto mo u no o más electrones. Po r ejemplo, un átomo de cloro necesita so lo un electrón para completar los últ imos ocho lugares en su capa externa, por lo que le q uita un electró n a un átomo de sodio, el cual sostiene débilmente un único electrón en su capa externa ( Fig. 2-6c}. El átomo q ue gana electrones adqu iere una carga nega tiva (-1) por cada electrón añadido, ento nces el á tomo d e cloro se conv ierte en el ión cloruro Cl-. Los iones cargados negativamen te se llaman aniones. Un átomo q ue cede electrones adqujere una ca rga posiLiva (+1) por cada electrón pe rdido. Po r ejemplo, el á tomo de sod io se convierte en un ión sod io Na+. Los iones cargados posi tivamen te se llaman cationes. Los enlaces iónicos, tamb ién conocidos como /Uracciones electrostáticas, resultan de la atracdón entre iones con cargas opuestas ( recuérd ese el principio básico de la electricidad q ue dice que las cargas opuestas se atraen y las iguales se repe len). En u n cristal de sal de mesa, q L1e es la forma sólida del NaCl ion izado, los enlaces ión icos enlre los iones Na- y et- alternados mantienen a los iones en u na eslructura perfectamente ordenada.

32 . 43

47

49

52

57

Po r ejemplo, un átomo de h idrógeno tiene un electrón no pareado)' un lugar vacío en su capa externa. Debido a que el h idrógeno solo tiene un electrón para comparLir, siemp re forma un enlace covalen te. El ox ígeno tiene seis electro nes en una capa externa q ue puede contener ocho. Esto quiere decir q ue el oxigeno puede forma r dos enlaces covalen tes y completar su capa externa con electrones. Si átomos ad)'acentes comparten dos pares de electrones en luga r de un solo par, el resultado es u n enlace doble, rep resentado por tLna línea doble ( = ). Si dos á tomos comparten tres pares de electrones, forman LLn en lace triple.

Moléculas polares y no polares Algu nas moléculas desar rollan regiones de carga parcial pos itiva y negativa cuando los pa res de electrones en sus en laces covalen tes no son compartidos un ifo rmemen te en tre los átomos unidos. Cuando los electrones se comparten de modo des igual, el átomo con la mayo r a tracció n po r los electrones adquiere una leve ca rga negativa (de nom inada 6-) y el átomo con la atracción más débil por los electrones desarrolla una ligera carga pos itiva (6"). Estas moléculas son llamadas moléculas polares porque se pued e decir que tienen extremos positivo y negativo o polos. Ciertos elementos, particularmen te el n iLrógeno )' el oxígeno, tienen una fuerte atracción por los electrones y se los encuentra con frecuencia en moléculas polares. Un buen ejemplo de una molécula polar es el agua (H 2O ). El oxígeno, que es más gran de )' más fuerte, atrae los elecLro nes del hidrógeno hacia sí. Esta atracc ión deja los dos átomos de hidrógeno de la mo lécula con LLna ca rga parc ial positiva y el átomo de oxígeno con una carga parcial negati va a causa de los electro nes d esigualmente co mpartidos ( Fig. 2 -6b). Nótese q ue la ca rga neta de la molécula de agua en su co nj unto es cero. La polarid ad del agua la convie rte en un buen solvente, y to da la vida como la conocemos está basada en soluciones acuosas. Una molécula no polar es aquella cuyos elect ro nes compa rtidos están disLribuidos ta n uniformemente q ue no hay regiones de ca rga parcial positiva o negativa. Por ejemplo, las moléculas com-

Puentes de hi,ir6ge110 Un puente de hidrógeno es una fuena débi l de atracción entre un átomo de h idrógeno y un átomo cercano de oxígeno, ni trógeno o ll úor. No se ga nan, se p ierden n i se comparten electrones en un p uente de h idrógeno. En su lugar, las regiones op ues lamente ca rgadas de molécu las pola res se atraen entre sí. Los puentes de hidrógeno pueden fo rmarse en tre átomos de moléculas vecinas o en tre átomos en diferen tes partes de una m isma mo lécula. Por ejemplo, una molécu la de agua puede un irse medi an te puentes de hidrógeno con hasta otras cuatro mo léculas de agua. Como resultado, las moléculas se ali nea n con sus vecinas en una forma más o menos ordenada ( Fig. 2-6d ). Los p uentes de hidrógeno en lre las mo léculas son los respo nsables de la tens ión superficial del agua. La tensión supe rficial es la ÍL1erza de a tracción entre las moléculas de agua que hace q ue esta fo rme gotas esféricas cuando cae o que se amonto ne cuand o se derrama sobre una superfi cie no absorben te ( Fig. 2-6d). La a lta cohes ión (cohaesus, aferrarse) del agua la hace difíci l d e estira r o deformar, como p uede halJer no tado al intentar levantar un vaso h úmedo q ue está "pegado" a una mesa de supe rficie lisa a través de u na delgada lám ina de agua. La tensión super ficial del agua influye en la función p ttlmo nar (descrita en el Capítulo L7J.

• FIGURA2-5 REVISIÓN

Átomos y moléculas Los elementos son el tipo más simple de materia. Existen más de 100 elementos conocidos,• pero solo 3 -oxígeno. carbono e hidrógeno- componen más del 90% d e la masa corporal. Estos 3 elementos, más otros 8 , son los elementos esenciales principales. Otros 19 elementos esenciales menores son necesarios en cantidades ínfimas. La partícula más pequeña de cualquier elemento es un átomo {atamos, indivisible}. Los átomos se unen compartiendo electrones para formar moléculas.

Elementos esenciales plincipale

Elementos esenciales menores

H, C, O, N, Na,

U, F. Cr, Mn, Fe, Co, Ni, Cu, Zn, Se, Y, I, Zr, Nb, Mo, Te, Ru, Rh, La

Mg, K, Ca, P, S, CI

• En la retiración de contratapa se puede encontrar una tabla periódica de element os.

Protones: ~ determinan el elemento (número atómico)

Helio, He

El helio (He) tiene dos protones y dos neutrones, entonces su número atómico es = 2, y su masa atómica es=4

Protones + neutrones en el núcleo = masa atómica

Moléculas

Neutrones: determinan el isótopo

t-------+1

Electrones: (• forman enlaces covalentes • cuando se ganan o se en orbitales alrededor del núcleo pierden crean iones captan y almacenan energía • crean radicales libres

Isótopos y iones

Un átomo que gana o pierde neutrones se convierte en un isótopo del mismo elemento.

gana un neutrón

2H, Isótopo de hidrógeno

1H, Hidrógeno

pierde un electrón

H+, Ión hidrógeno Un átomo que gana o pierde electrones se convierte en un ión del mismo elemento.

Átomos 1-- - - - - - - + 1 2 o más átomos comparten electrones para formar

tales como

Agua (H2O)

PROTEÍNAS

r-----l..l

Aminoácidos

Secuencia de aminoácfdos

Hélice a o lámina plegada 13

-~~~~

Arg ]

Forma globular o fibrosa

Proteínas

Trp )-

Secuencia de aminoácidos Glucoproteinas CARBOHIDRATOS

Monosacáridos

~

Polisacáridos

Disacáridos

Carbohidratos

Lípoproteinas 1Glucógeno¡

Biomoléculas

1 Almidón Celulosa

1

Glucolípidos

LÍPIDOS

Glicerol 1

Monoglicéridos

H

Diglicéridos ~ Triglicéridos

Ácidos grasos

Lípidos

Moléculas relacionadas con los lipidos 1 Fosfolípidos

Eicosanoides Ácido oleico, un ácido graso 1 Esteroides

NUCLEÓTIDOS 1

cAMP, cGMP

~-_,_,., ATP, ADP, FAD. NAD 1

ARN, ADN

Enlaces moleculares Cuando dos o más átomos se unen compartiendo electrones, c rean unídades llamadas moléculas. La transferencia de electrones de un átomo al otro o el hecho de que dos átomos compartan electrones es una parte crítica para la formación de los enlaces. que son las uniones entre los átomos.

Enlaces covalentes

Los enlaces covalentes se generan cuando los átomos comparten electrones. Estos enlaces requieren mucha energía para formarse o romperse. (a) Moléculas no polares

Las moléculas no polares tienen una distribución uniforme de electrones. Por ejemplo, las moléculas compuestas principalmente por carbono e hidrógeno tienden a ser no polares.

Ácido g raso

(b) Moléculas polares Enlaces

Las moléculas polares tienen regiones de carga parcial (o+ o o-). El ejemplo más importante de una molécula polar es el agua.

Polo negativo Molécula de agua

Polo positivo

..

H: O: H

o

¡¡'

'H

H20

Enlaces no covalentes (c) Enlaces íónicos Los enlaces iónicos son atracciones electrost áticas entre iones. Un ejemplo común es el cloruro d e sodio.

Átomo de sodio

Átomo de cloro

El sodio cede su único electrón retenido d ébilmente al cloro, creando iones sodio y cloruro, Na+ y c1-.

Ión de sodio (Na+)

Ión de cloro (CI-)

Los iones sodio y cloruro tíenen capas externas estables que están ocupadas completamente por electrones. Debido a sus cargas opuestas, se atraen entre si y, en estado sólido, los enlaces iónicos forman un c ristal de c loruro de sodio (NaCI).

(d) Puentes de hidrógeno

Los puentes de hídrógeno se forman entre un átomo de hidrógeno y un átomo cercano de oxigeno , nitrógeno o flúor. Entonces, por ejemplo, las regiones polares de Puente _ _,__ _ _ _, de moléculas de agua adyacentes les permiten formar puentes de hidrógeno hidrógenos entre si.

Los puentes de hidrógeno entre las moléculas de agua son los responsables de la tensión superficial del agua.

(e) Fuerzas de Van der Waals

Las fuerzas de Van der Waals son atracciones débiles y no especificas entre los átomos.

Interacciones no covalentes

Fuerzas de Van der W11als Las fuerzas de Van der \"laals son aLracciones déb iles, no específicas, entre los núcl eos de cualq uier á tomo y los electrones de los átomos cercanos. Dos átomos débilmen te atraídos enLre sí por fuerzas de Van der \·Vaals se acercan cada vez más hasta que están tan p róximos que sus electrones comienzan a repelerse. Consecuen temente, las fuerzas de Van de r \•Vaals perm iten a los átomos agruparse m,ls estrechamen te y ocupar un mínimo espacio. Una so la atracció n de Van der \"laals entre átomos es muy déb il.

Revisión 4, Los electrones en un átomo o enuna molécula, ¿son másestables cuando estánpareados o

no pareados? S. Cuando un átomo de un elemento gana o pierdeunoo más electrones,~ llama _ __ de ese elemento. 6, Unir cada tipo de enlace consudescripción: (a) enlace covalente 1. fuerza deatracción débil entre el hidrógeno y eloxígeno

o el nitrógeno 2. se forma cuando dosátomoscompanen uno omás pares de electrones (c) puente de hidrógeno 3. fuerza deatracción débil entre los átomos (d) fuerza deVan derWaals 4. se forma cuando un átomo pierde uno o más electrones y los cedea un segundo átomo

Un anu ncio publicitario sobre e l cromo afirma que este mejora la transferencia de glucosa - el azúcar sim ple q ue ut ilizan las células como combustib le para todas sus actividades- desde la sangre hacia el inte rior de las células. En aque llas personas con diabetes mell it us, las cél ulas son incapaces de incorporar la glucosa eficienteme nte desde la sang re. Parecía lógico, por lo ta nto, eval uar si el agregado de cromo a la dieta mejoraría la captación de glucosa en personas con diabetes. En un estudio ch ino, pacientes diabéticos q ue recibieron 500 microgramos de picoli nato de cromo dos veces por día mostraron una mejora significativa en su diabetes; no así los pacientes q ue recibieron 100 microgramos o placebo. P2 : Si la gente t iene una deficiencia de cromo, ¿usted diría que su

nivel de glucosa en sangre será menor o mayor que lo normal? A partir de los resultados del estudio chino, ¿puede usted concluir q ue todas las personas con diabetes padecen una deficiencia de cromo?

(b) enlace iónico

Interacciones no covalentes Muchos tipos di ferentes de interacc iones no covalentes pueden ocurrir entre y dentro de las moléculas como resultado de los cua tro tipos diferentes de enlaces. Por ejemplo, el hecho de que una molécula esté cargada, no cargada o parcialmente cargada dete rmina si puede disolverse en agua. Los en laces covalen tes y no covalentes determi nan la forma y la función molecular. Fina lmente, las in teracciones no covalentes median la asociació n reversible de las proteínas con o tras moléculas y crean apaream ientos iunc ionales, como los que oetu·ren entre enzimas y sustratos o receptores de señal y sus ligan dos.

Las interacciones hidrofílicas crean soluciones biológicas La vida como la conocemos está basada en soluciones acuosas que

se aseme_jan en su composición iónica al agua de mar diluida. El cuerpo h umano adulto está compues to por un 60% de agua apro ximadamente. Na\ K· y c 1- son los iones principales en los fl uidos corporales, mientras que o tros iones están en menor proporción. Todas las moléculas )' los compo nentes celulares es tán di sueltos o suspend idos en estas solucio nes. Por estas razones resulta ú til comprender las prop iedades de las so luc iones, rev isadas en la • Figu ra 2-7. El grado hasta el cual una molécula es capaz de disolverse en un solven te es la solubilidad de esa molécula: cuanto más fácilmen te se disuelve, mayor es su so lubi lidad. El agua, el solvente b iológ ico, es polar, por lo que las molécu las que se disuelven fácilmen te en agua son polares o molécLLlas ió nicas cuyas reg iones positiva y negativa interactúan con facil idad co n el agua. Po r ejemplo,

43

32

39 . 47

49

52

57

s i se colocan cristales de NaC I en agua, las regiones polares de las mo léculas de agua rompen los enlaces iónicos en tre el sodio y el cl oro, lo q ue ocasiona la disolució n de los crista les ( a Fjg. 2-8a). Las mo léculas que son solubles en agua se denominan hidrofílicas 1lzydro-, agua, + -pliilic, amante). En contraste, las moléculas tales como los aceites que no se disuel ven bien en agua se denom inan h idrofóbicas (- phobic, que odia). Las sustancias h idrofób icas suelen ser moléculas no polares que no pueden fo rma r puen tes de hidrógeno con las mo léculas de agua. Los lípidos (grasas y aceites) son el grupo de moléculas biológicas más hidrofóbico. Cuando se colocan en una solució n acuosa, los líp idos no se di suelven. En su lugar, se separan en disti ntas capas. Un ejemplo fam iliar es el de l aceite flotando sobre el vinagre den tro de una botella de aderezo para ensalada. Para po der d isolverse en los íl ui dos corporales, las moléculas hidrofóbicas deben combinarse con u na molécu la h idrofíl ica que las transpo rte en la sol ució n. Por ejemplo, el coles tero l, u na grasa a nima l comú n, es una mo lécula hidrofób ica. La grasa de u n pedazo de carne colocado en u n vaso co n agua tibia Ilota hasta la parte superio r sin di solverse. En la sangre, el colesterol no se d isuelve a menos que se una a moléculas transpo rtadoras solubles en agua. Q uizá usted conozca la combinación del colesterol con sus transpo rtadores h idrofílicos como coles te ro l- H DL y co lesterol-LDL, las fo rmas "buena" y "mala" del coles tero l asoc iadas a enfe rmedad ca rdíaca. Algunas moléculas, tales como los fosfolípidos, ti enen regio nes tan to polares como no po lares ( Fi~. 2-8b). Esta naturaleza dual les permi te asociarse tanto entre ellas (in teracciones h id rofób icas) como con moléculas polares de agua (interacciones hidrofílicas). Los fosfolíp idos son el componente pr incipal de las membranas biológicas.

Soluciones La vida como la conocemos está basada en soluciones acuosas que se asemejan en su composición iónica al agua de mar diluida. El cuerpo humano adulto está compuesto por un 60% de agua aproximadamente. Los iones sodio, potasio y cloruro son los iones principales en los fluidos corporales. Todas las moléculas y los componentes celulares están disueltos o suspendidos en estas soluciones. Por estas razones, las propiedades de las soluciones cumplen un rol fundamental en el funcionamiento del cuerpo humano. TERMINOLOGÍA

Un soluto es cualquier sustancia que se d isuelve en un liquido. El grado hasta el c ual una molécula es capaz d e d isolverse en un solvente es la solubilidad de esa molécula. Cuanto más fácilmente se disuelve una molécula, mayor es su solubilidad. Un solvente es el líquido en el cual los solutos se disuelven. En las soluciones biológicas, el agua es el solvente universal.

""•L

~~

Una solución es la combinación de solutos disueltos en un solvente.

1/ -~ ~ La concentración de una solución es la cantidad de soluto por unidad

y

I

de volumen de solución.

Concentración = cantidad de soluto/ volumen de solución

EXPRESIONES DE LA CANTIDAD DE SOLUTO • Masa (peso) del soluto antes de disolverse. Frecuentemente se expresa en gramos (g) o miligramos (mg). • La masa molecular se calcula a parti r de la fórmula q uímica de una molécula. Es la masa de una molécula expresada en unidades de masa atómica (urna) o, más frecuentemente, en daltons (Da), siendo 1 urna = 1 Da. M

I _ SUMA asa moIecu ar -

rL

masa atómica de cada elemento

X

el número de átomos de] cada elemento

Ejemplo ¿Cuál es la masa molecular de la glucosa, C6H1206?

Respuesta Elemento Carbono Hidrógeno Oxígeno

# de átomos Masa atómica del elemento 6 12 6

12,0umax6 = 72 1,0umax 12 = 12 16,0 uma x 6 = 96

Masa molecular de la glucosa = 180 urna (o Da)

• Los moles (mol) son una expresión del número de moléculas de soluto, sin considerar su peso. Un mol =6,02 x 1023 átomos, iones o moléculas de una sustancia. Un mol de una sustancia tiene la misma cantidad de partículas que un mol de cualquier otra sustancia, así como una docena de huevos tiene el mismo número de unidades que una docena de rosas • Masa molecular en gramos. En el laboratorio utilizamos la masa molecular de una sustancia para medir moles. Por ejemplo, un mol de glucosa (con 6,02 x 1023 moléculas) tiene una masa molecular de 180 Da y pesa 180 g ramos. La masa molecular de una sustancia expresada en gramos se d enomina masa molecular en gramos. • Los equivalentes (eq) son una unidad utilizada para los iones, donde 1 equivalente = molaridad del ión x el número de cargas que tiene el ión. El ión sodio, con su carga de+1, tiene un equivalente por mol. El ión fosfato de hidrógeno (HP042 -) tiene dos equivalentes por mol. Las concentraciones de iones en la sangre son frecuentemente informadas en miliequivalentes por litro (meq/ L).

G

PREGUNTAS

1. ¿Cuáles son los dos componentes de una solución? 2. La concentración de una solución se expresa como: a. cantidad de solvente/volumen desoluto b. cantidad de soluto/volumen de solvente c. cantidad de solvente/volumen de solución d. cantidad de soluto/volumen de solución 3. Calcule la masa molecular del agua, H20. 4. ¿Cuánto pesa un mol de KCI?

EXPRESIONES DE VOLUMEN

Conversiones útiles

El volumen habitualmente se expresa en litros (L) o mililitros (ml) {mí//i-, 1/ 1.000). Una medida convencional de volumen en medicina es el decilitro (dl ), que es 1/1 0 de un litro, o 100 ml .

10

-=-1. - l

Prefijos

deci- (d}

• 1 litro de agua pesa 1 kilogramo (kg) (kilo- , 1.000)

".'" il

1 X 10-1

1/1 0

mili- (m)

1/1 000

micro- (µ)

1/1 000 000

1

JOr

X 10-3

1 X 1o-6

nano- (n)

1/1 000 000 000

1 X 10-9

pico- (p}

1/1 000 000 000 000

1 X 10-12

• 1 kilogramo = 2,2 libras

- 1

--

::i e:: 4

::-1 '"-l - 1

EXPRESIONES DE CONCENTRACIÓN • Soluciones porcentuales. En un laboratorio o farmacia, los científicos no p ueden medir los solutos en moles. En lugar de eso, utilizan el peso como medición más convencional. Entonces, la concentración del solut o puede ser expresada como un porcentaje de la solución total, o solución porcentual. Una sol ución al 10% significa 10 partes de soluto por cada 100 partes de solución total. Las soluciones peso/volumen, utili zadas para solutos que son sólidos, se expresan habitualmente como g r/1 00 m l de solución o mg/dl . Una forma anacrónica de expresar mg/ dl es mg%, donde % significa cada 100 partes o 100 ml. Una concentración de 20 mg/dl también puede ser expresada como 20 mg%.

º

PREGUNTAS

5.¿Cuál está más concentrada: una solución de glucosa 100 mM o una solución de glucosa O, 1 M? 6. Al preparar una solución de glucosa al 5%, ¿por qué no se pesan 5 gramos de glucosa y se añaden a 100 ml de agua?

Ejemplo

Las soluciones utilizadas para las infusiones endovenosas (EV) frecuentemente se expresan como soluciones porcentuales. ¿Cómo se prepararían 500 m l de una solución de dextrosa (glucosa} al 5%?

Respuesta Solución al 5% = 5 g de glucosa disuelta en agua en un volumen de solución final de 100 ml 5 g de glucosa/100 ml = ¿? g/500 ml 25 g de glucosa añadiendo agua hasta obtener un volumen final de 500 ml

• Molaridad es el número d e moles de soluto en un litro de solución, y se puede abreviar como mol/ Lo como M. Una solución de glucosa uno molar (1 mol/ l , 1 M) contiene 6.02 x 1023 moléculas de glucosa por litro de solución. Se obtiene disolviendo un mol (180 gramos) de glucosa en suficiente agua para hacer un litro de solución. Las soluciones b iológicas típicas están tan disueltas que las concentra- se expresan usualmente como mili moles por litro (mmol/l o mM). Ejemplo

¿Cuál es la molaridad de una solución de dext rosa al 5% ?

Respuesta 5 g de glucosa/100 ml = 50 g de glucosa/1000 ml (o 1 L} 1 mol de glucosa = 180 g de glucosa 50 gil x 1 mol/ 180 g = 0,278 moles/l o 278 mM

Interacciones moleculares (a) Interacciones hidrofílicas

Las moléculas que tienen regiones polares o enlaces iónicos interactúan fácilmente con el agua. Esto les permite d isolverse sin inconvenientes en ella. Las moléculas que se disuelven fácilmente en agua son llamadas hidrofílicas {hydro-, agua, + philos-, amante}.

l

fil

Capas d•

hidratación~

e¡ ~

Moléculas de agua

~

&)

g

t>.

Molécula de glucosa

Las moléculas de agua interactúan con los iones u otras moléculas polares para formar capas de hidratación al rededor de los iones. Esto rompe los puentes de hidrógeno entre las moléculas de agua, reduciendo de esa manera la temperatura de congelamiento del agua (depresión del punto de congelamiento).

~

G

~

6'

9

&\

ca

M olécula de glucosa en solució

(b) Interacciones hidrofóbicas

Debido a que tienen una distribución uniforme de electrones y carecen de polos positivo o negativo, las moléculas no polares no tienen regiones de carga parcial y, por lo tanto, tienden a repeler las moléculas de agua. Las moléculas como estas no se disuelven fácilmente en agua y se dice que son hidrofóbicas {hydro-, agua, + phobos, miedo}. Las moléculas tales como los fosfolípidos tienen tanto regiones polares como no polares, que cumplen roles críticos en los sistemas biológicos y en la formación de membranas biológicas.

Los fosfolipidos se acomodan de tal forma que las cabezas polares están en contacto con el agua y las colas no polares se alejan de ella. Agua Cabeza hidrofílica 1--....:::.. Colas hidrofóbicas

Cola no polar de ácidos grasos Modelos moleculares

CXXC(:X::0--

Cabeza hidrofilica

Agua

Modelo estilizado

Esta característica permite a las moléculas fosfol ipidicas fom1ar barreras, la base para las membranas biológicas que separan compartimentos.

(e) Forma molecular

Los ángulos de los enlaces covalentes, los enlaces iónicos. los puentes de hidrógeno y las fuerzas de Van der Waals interactúan para crear la forma distintiva de una biomolécula compleja. Esta forma cumple un rol critico en la función de la molécula.

1

1

NH 1

; -· · ·,,

C=O 1

H -C-C J-1.¡~ Cf½-C-H ~

1

O=C ,

I

'·- ··' Puente disu lfuro

1

NH ,

LEYENDA Puentes de hidrógeno o fuerzas de Van der Waals

+-

Enlace iónico

+ 1111111+ ] Repulsión iónica - 111111-

~ Puente d isulfuro

Interacciones no covalentes

47

Revisión

7. ¿Qué moléculas se disuelven más fácilmente en agua. las polares o las no pola!6? 8. Una molkulaque se disuelve fácilmenteen agw se denomina hidro__ica. 9. ¿Por qué lasa!de mesa (NaCI) se disuelve en agua?

La estructura molecular está relacionada con la función molecular la forma de una molécula está estrechamente relacionada con su función. Los enlaces moleculares - tanto los covalentes como los débiles- cumplen un rol crítico en la determinación de la estructura mo lecular. Es dif[ci l mostrar en papel la forma tridimensional de una molécula, pero muchas moléculas tienen formas características debido a los ángulos de los enlaces covalentes entre sus átomos. Por ejemplo, los dos átomos de hidrógeno de la molécula de agua de la Figura 2-6b están unidos al oxígeno por un enlace CU)'º ángulo es de 104,5°. Los enlaces dobles en una larga cadena de ácidos grasos hacen que las cadenas se retuerzan o se doblen, como se observa en el modelo tridimensional del t\cido oleico de la Figura 2-5. Los enlaces no covalentes débiles también contribu yen a la estructura molecular. Las complejas dobles hélices de una molécula de ADN ( Fig. 2-4 ) son el resultado tanto de los enlaces covalentes entre bases adyacentes de cada cadena como de los puentes de hidrógeno que conectan las dos cadenas de la hélice. Las proteínas tienen las formas más comp lejas )' variadas de todas las biomoléculas. Las dos estructuras secundarias más comunes para las cadenas polipeptídicas son la hélice a (alfa) y las láminas plegadas j3 (beta) (Fjg. 2-3). Los ángulos de los enlaces covalentes entre los aminoácidos crean la espiral de la hél ice Cl o la firma zigzagueante de las cadenas /3 de las láminas plegadas. las cadenas plegadas~ adyacentes se estabiliilln mediante puentes de hidrógeno, q ue se muestran como ... en la Figura 2-3. La configuración de la )¡~mina plegada es muy estable y se encuentra en muchas proteínas destinadas pRra usos estructurales. Las proteínas con otras funciones p ueden tener una mezcla de láminas plegadas ~ y hélices a. Las proteínas también son categorizadas en dos grandes grupos según su forma tridimensional: fibrosas y globulares (véase la Fi¡¡. 2 -3 ). Las proteínas fibrosas pueden ser láminas plegadas ~ o largas cadenas de hélices u . Las proteinas fibrosas son insolubles en agua y forman componentes estructurales importantes en células y tejidos. Los ejemplos de esto incluyen el c0Mge110, una proteína fibrosa que se encuentra en muchos tipos de tejido conectivo, tales como la piel, y la queratina, una proteína fibrosa hallada en el pelo y las uñas. Las p roteínas globulares tienen cadenas de aminoácidos q ue se pliegan sobre sí m ismas para crear una estructura terciaria compleja que contiene bolsillos, canales o prot uberancias. La estructura terciaria de las proteínas globulares surge parcialmente de los ángulos de los en laces covalentes entre los aminoácidos y de los puen tes de hidrógeno, las fuerzas de Van der Waals y los en laces iónicos que estabilizan la forma de la molécula. Adem,\s de los enlaces no covalentes, los puentes disulfuro (S-S) cumplen un rol importante en la forma de muchas proteínas

El crom o se e ncue ntra en muchas formas iónicas. El c romo usualm e nte hallado e n los siste mas bio lógicos y e n su plementos dietarios es e l catión Cr'•. Este ión se llama trivalente porque tiene una ca rga neta d e +3. El catión h exavalente, C.-6", con u na carga de +6, se utiliza e n la industria, tanto e n la m anufactura de ace ro inoxidable como e n e l cromado de piezas m e tálicas.

P3 : ¿Cuántos e lectrones ha p erdido e l ión hexavale nte d e l cromo? ¿Y e l ión trivale nte ?

32

39

43

.

49

52

57

globulares ( Fig. 2-8c). El aminoácido cisteína contiene azufre como parle de un grupo su/fhidrilo (-SH). Dos cisteínas en diferentes partes de la cadena polipeptídica pueden unirse mediante un puente d isulfuro que junta las dos secciones de la cadena.

Los iones de hidrógeno en solución pueden alterar la estructura molecular Los puentes de h idrógeno son una parte importante de la estrucLUra molecular. Sin embargo, los iones de hidrógeno libres ( H•) en so lución también pueden participar de puentes de hidrógeno )' fuerzas de Van der Waals. Si H+ libres rompen los enlaces no covalentes de una molécula, la forma de la molécula, o co11formaci611, puede cambiar. Un cambio en la forma puede alterar o destruir la capacidad de la molécula para funcionar. La concentración de H· libres en los íluidos corporales, o acidez, se mide en térmjnos de pH . La • Figura '.l -9 repasa la química del pH y muestra una escala con los valores de pH de diversas sustancias. El pH no rmal de la sangre en el cuerpo humano es 7,-10, ligeramente alcalino. La regulación del pH corporal dentro de un rango lim itado es critica, ya que un pH sanguíneo más ácido que 7,00 (pH < 7,00) o más alcalino que 7,70 (pH > 7,70 ) es incompaLible con la vida. ¿De dónde provienen los iones h idrógeno de los íluidos corporales? Algunos de ellos provienen de la disoc iación de moléculas de agua en iones H· y OH-. Otros, de los ácidos, moléculas que liberan H· cuando se disuelven en agua ( Fjg ?-9). Muchas de las moléculas que se forman a part ir del metabol ismo no rmal son ácidos; por ejemplo, el ácido carbónico se genera en el cuerpo a partir de C<\ (dióxido de carbono) y agua. En solución, el ácido carbónico se disocia en unión bicarbonato)' un ión hidrógeno: C01

+ H._,O ~ H 2CO, (ácido carbónico) ~

H~ + HCO,.

Nótese que, cuando un hidrógeno forma parte de la molécula intacta de ácido carbón ico, no contribuye a la acidez. Solo los H· libres co11trib11ye11 a /11 co11ce11tració11 de iones hidrógeno. Continuamente agregamos kido a nuestro cuerpo a Lravés del metabolismo; entonces, ¿cómo hace el cuerpo para mantener un pH no rmal? Una respuesta es a través de los amortiguadores de pH

pH ÁCIDOS Y BASES Un ácido es una molécula que aporta H+ a una solución.

Una base es una molécula que reduce la concentración de H+ de una solución al combinarse con los H+ libres.

• El grupo carboxilo, --COOH, es un ácido, ya que en solución tiende a perder su H+:

• Las moléculas que producen iones hidróxido. • Otra molécula que actúa como una base es el amoníaco, NH3, que reacciona con OH -,en una sol uc ión son bases debido a que el hidróxido se combina con el H+ para formar agua. un H+ libre para formar un ion amonio:

R-COOH -

R-OH -+ R+ + OH- -+ OH- + H+ -+ H2O

R-COO- + H+

NH3 + H+ -+ NH4+

pH La concentración de H+ en los fluidos corporales se mide en términos de pH. • La expresión pH significa "potencial de hidrógeno".

1

Ej emplo

Esta ecuación se lee como "el pH es igual al logaritmo negativo de la concentración del ion hid rógeno". Los corchetes son la notación para "concentración" y, por convención, las concentraciones se expresan en meq/L. • Utilizando la regla de los logaritmos que dice que-log la ecuación del pH (1) puede reescribirse así: 2

Respuesta pH = -log [H+] pH = - log [1 0-7]

¿Cuál es el pH de una solución cuya concentración de ion hid rógeno [H+] es 10-7 meq/L?

pH = -log [H+]

Utilizando la regla de los logaritmos, esto se puede reescribir como pH

;e= log(1/;c),

= log (1/1 0-7)

Utilizando la regla de los exponentes aue dice 1/10-X = 10-X

¡lit! = log (1/ [H+l)

pH Esta ecuación muestra que el p H está inversamente relacionado con la concentración de H+. En otras palabras, a medida que la concentración de H+ aumenta, el pH baja.

= log 107

el logaritmo de 107 es 7, entonces, la solución tiene un pH de 7.

El agua pura tiene un valor de pH de 7,0. lo cual quiere decir q ue su concentración de H+ es 1 x 10-7 M. Jugo de limón Ácido estomacal

Secreciones pancreáticas

Amoníaco de uso 1 M NaOH doméstico P reductos icarbonato Soluciones químicos para de sodio jabonosas la depilación

Tomates, uvas

Vinagre, cola

J

Orina Saliva

(4,5-7)

1

1

1 1

1 2

1

3

Las soluciones ácidas han ganado H+ de un ácido y tienen un pH menor a 7. Et pH de una solución se mide en una escala numérica entre O y 14. La escala de pH es logarítmica, lo que significa que un cambio en el valor del pH de una unidad indica un cambio de 10 veces en [H+]. Por ejemplo, si una solución cambia de p H 8 a pH 6, ha ocu rrido un incremento de 100 veces (1 02 o 10 x 10) en [H+].

4

5

1

1

6 6,5 7

l

1

1 1 7,7 8 8,5 9

1

10

1

El pH normal de la sangre en el cuerpo humano es 7,40. La regulación homeostática es crítica porque un pH sanguíneo menor a 7,00 o mayor a 7,70 es incompatible con la vida.

11

12

13

Las soluciones básicas o alcalinas tienen una concentración de H+ menor que la del agua pura y tienen un valor de pH mayor a 7.

º

PREGUNTAS 1. Cuando el cuerpo se vuelve más ácido, ¿el pH aumenta o disminuye?

2. ¿Cómo pueden la orina, el ácido estomacal y la saliva tener valores de pH fuera del rango compatible con la vida y aun formar parte de un organismo vivo?

Interacciones proteicas (buffers). Un buffe r es cualquier suslancia que modera los cambios en el pH. Muchos buffers con Lienen an iones que lienen una alta afinidad po r los H· . Cuando H · lib res se añaden a una solución amorLiguadora de pH, los an iones de es La se unen a esos H· y min imizan así cualqu ier cambio en el pH. El anión bicarbonato, HCO,·, es un amo rliguador de pH importanLe del cue rpo humano. La siguien Le ecuac ión muesLra cómo una soluc ión de bicarbonato de sodio actúa como buffer cuando se le añade ácido clorhídrico (HCI). Cuando se coloca en agua, el ácido clo rhídrico se separa, o disocia, en H • y Cl· y genera altas concentraciones de H· (pH bajo). Sin embargo, cuando el HCI se disoc ia en una solución de bica rbonato de sodio, algunos de los iones bicarbo naLo se combinan con algunos de los H· para fo rmar ácido ca rbónico no di sociado. "Gloqueando" los H· ag regados de esla ma nera se eviLa que la concentración de H+ de la sol ución cambie signi ficalivamente y se mi nimiza el cambio en el pH.

J

-1

5

6

[

H'

+

CJ·

J\cido clorhídrico

+ HCO,- + Na' Bicarbonato de sodio

H2CO, + Cl· + Na·

~ ~

Ácido carbónico

Oomro de sodio (sal de mesa)

Revisión

7

49

Lransportado res de membrana se analizan en detalle en el Capítulo 5). Molécul as de señalización. Algunas proleínas y péptidos peq ueños acLúan como hormonas y oLras moléculas señalizadoras. (Diferentes Lipos de moléculas de se ñalización se descri ben en los Ca píLulos 6 y2-) Receptores. Las proteínas que se unen a moléculas seüalizadoras e inician respuestas celulares se llama n receptores. (Los receptores se analizan junto co n las moléculas de se ñalización en el Capítulo 6.) Proteínas de unión. Estas proteínas, halladas principalmente en el líquido extracelular, se unen y transpo rtan moléculas a través de l cuerpo. Los ejemplos de esLas prOLeínas con los que ya se ha Lopado incluyen la proteína transportadora de oxJgeno hemoglobina y las proteínas lranspor Ladoras de colesLerol, Lales como las LDL (lipoproleínas de baja densidad). lnmunoglobulinas. EsLas proteínas inmu nológicas exLracelulares, Larnb ién llamadas anticuerpos, ayudan a proteger el cuerpo. (Las funciones inmunes se anali zan en el CapíLulo 24.) Proteínas reguladoras. Las proteínas reguladoras encienden y apagan o aumentan y dism inuyen los procesos celulares. Po r ejemplo, las proteínas reguladoras co nocidas como factores de 1ra11scripció11 se unen al ADN y altera n la expresión génica y la sínLesis proteica. Los delalles de las proteínas regulado ras se pueden encontrar en libros sob re biología celular.

1O. Para ser clasificada como un ácido, ¿qué debe hacer una molécula cuando es disuelta en agua? 11. ¿El pH es unaexpresión de laconcentración de qué en una solución? 12. Cuando el pH aumenta, la acidez _ __

Interacciones proteicas Las interacciones moleculares no covalenles suceden entre muchas biomoléculas diferentes y a menudo involucran las proteínas; por ejemplo, las membranas biológicas están formadas por asociaciones no covalentes de fosfolípidos y proLeínas. Las proleínas glucosiladas y los lípidos glucosilados en las membranas celulares forman una "cubierta de azúcar" sobre las superficies celulares, donde ayudan en el agrupamienlo (aggregare, unirse) y la adhesión (ad/werere, pegarse) celular. Las proteínas cumplen ro les importantes en tan Las funciones celulares que pueden co nsiderarse las "bestias de ca rga" del cuerpo. La mayoría de las proteínas solub les pueden encasillarse dentro de alguna de las siete amp lias caLegorías siguienLes: 1

2

Enzimas. Algunas proLeinas actúan como enzimas, caLalizadores biológicos que acele ran las reacciones químicas. Las enzimas cumplen un rol impo rtante en el meLabolismo (el tema se analiza en los Ca pítulos 4 y 22). Transportadores de membrana. Las proLeínas en las membranas celulares ayudan a Lransporlar sustancias de un lado a oLro entre los compa rtimentos inlra )' extracelular. Estas pro teínas pueden fo rmar canales en la membrana cel ular o un irse a las moléculas )' transportarlas a través de la memb rana. (Los

Se sabe que la forma hexavalente del cro mo utilizado en la indus· tria es tóxica para los humanos. En 1992, fu ncionarios del Sistema de Evaluación y Servicio de Información de Riesgos de Ca lifornia advirtieron que la inhalación de polvo, vapor o gases ele cromo sometía a los trabajadores del cromo y del acero inoxidable a un riesgo aumentado de cáncer de pulmón . l os fu ncionarios no encontraron riesgo para la población por el contacto normal con superficies cromadas o de acero inoxidable. En 1995 y 2003, una posible conexión entre la forma trivalente del cromo (Cr'·J y el cáncer se obtuvo a partir de estudios in vitre (vitrum, vidrio; es decir, un tubo de ensayo) en los cuales células de mamíferos se mantuvieron vivas e n cultivos tisulares. En estos experimentos, las células expuestas a niveles moderadamente elevados de picolinato de cromo desarro llaron cambios potencialmente ca ncerígenos.' P4: A partir de esta información, ¿puede ust ed concluir que el cromo hexavalente y el trivalente son igualmente tóxicos? *D.M. Steams et al. Chromium(IU) picofinate produces chromosome damage in Chinese hamster ovary cells. FASEB J 9: 1643- 1648, 1995.

D. M. Stearns el o/. Chromium(III) tris(picolinate) is m utagenic at the hypoxanthine (guanin-e) phosphoribosyttransferase locus ín Chines.e hamster ovary cells... Mutotion Res Genet Toxico/ Enviran Mutogen 513: 135- 142, 2002.

32

39

43

47 .

52

57

SO

Capítulo 2 Interacciones moleculares

Aunque las proteínas so lub les son muy diversas, comparten a lgunas características comunes. Todas se u nen a o tras moléculas a través de interacciones no cova lentes. la un ión, que ocurre en un s iti o de la mo léntla p ro teica denominado luga r de uni ón , exhibe propiedades que serán a nalizadas brevemente: especiücidad, afin idad, competición y saturación. Si la unió n de u na mo lécula a una proteína inicia u n proceso, como ocur re con las enzimas, los transportadores de membrana y los recep tores, podemo. describ ir la velocidad de actividad del proceso y los factores que mod ulan o alteran d icha velocidad. Cualquie r molécula o ión que se une a o tra moléc ula se denom ina ligando (ligare, unir o atar). Los ligandos q ue se unen a enzimas y transportadores de membrana también se llaman sustra tos ( sub-, debajo,+ stratum, capa). Las moléculas de señalización proteicas y los factores de transcripc ión pro teicos son ligandos. l as inm Lmoglobulinas se unen a ligandos, pero el comp lejo inm unoglobuli na-ligando en sí mismo se conv ierte en u n ligando (para más detalles, véase el Capítulo 24).

Las proteínas son selectivas respecto de las moléculas alas que se unen l a rapacidad de las proteínas para un irse a un ligando determinado o a un grupo de ligandos relacionados se llama especificidad. Algunas proteínas son muy específicas con respecto a los ligandos a los q ue se unen, m ientras que o tras se unen a grupos enteros de moléculas. Por ejemplo, las enzimas conocidas como peptidasas se unen a ligandos polipeptídicos y rompen los enlaces peptídicos, sin imporrn r cuáles dos aminoácidos estén unidos por ese en lace. Po r esta razón, las peptidasas no se consideran muy especí ficas en su acción. En contraste, las aminopeptidasas también rompen enlaces peptídicos, pero son más específicas. Se unen solo a un extremo de una cadena pro teica (el extremo con un grupo amino no un ido) y pueden actua r ún icamente sobre el en lace peptídico terminal. La unión al ligando requ iere complementariedad molecular. En otras palabras, el ligando y el lugar de unión de la proteína deben ser complementarios o compatibles. En la unión proteica, cuan do el ligando )' la pro teína se acercan u no a la otra, las interacciones no covalentes entre el ligando y el lugar de uni ón de la proteína permiten que las dos moléculas se unan . A pa rtir de estudi os de enzimas y otras pro teínas de u nión, los científicos han descubierto que el lugar de unión de una proteína y la forma de su ligando no necesitan encajar de fo rma exacta. Cuando el l ugar de un ión y el ligando se aproxi ma n, comienza n a interactua r a través de puentes de hidrógeno, en laces iónicos y fue rzas de Van der Waals. El lugar de unión de la proteína luego cambia de forma (co11formaci611) para coincidi r más estrechamen te con el li gando. Este modelo de adap tación inducida de las interacciones p ro teína- ligando se muestra en la • figura 2-1O.

Las reacciones de unión a las proteínas son reversibles La medida en la cual una pro teína es atraída a un ligando se denomina afinidad de la proteína por el ligando. Si una proteína tiene una aha afin idad po r un ligando determinado, es más probable que se una a ese ligando que a un ligando por el cual tiene una alt nidad menor.

Lugar de unión PROTEÍNA

Modelo de adaptación inducida En este modelo de unión proteica, la forma del lugar de unión no es una correlación exacta de la forma del ligando (L).

• FIGURA 2-1 O Modelo de adaptación inducida de la unión proteína-ligando (L)

l a un ión proteica a un ligando puede escribirse uti lizando la misma notació n que utilizamos para 1·epresen tar las reacciones químicas: P + L ~ PL

donde P es la proteína, Les el ligando y P l es el complejo p roteínaligando un ido. la ílecha doble indica que la un ión es reversible. Las reaccio nes de unión revers ib le Uegan a un estado de eq uilibrio, en el cual la velocidad de unión (P + L ~ PL) es exactamente igual a la velocidad de separación o disociación ( P + L <- PL). Cuando una reacción está en equ ilibrio, la proporción enLre la concentración del producto, o complejo p roteina-l igando [PL], y las concen traciones de los reactivos es siempre la misma. Esta p ropo rción se llama constante de eq11ilibrio K, y se apl ica a todas las reacciones q uímicas 4 reversibles: K = _ [_PL _]_ '4

{P] [L]

Los corchetes alrededor de las letras indican las concentraciones de la proteína, del ligando y del complejo pro teína-ligando.

Las reacciones de unión obedecen la ley de acción de masas El equilib rio es un estado d inámico. En los seres vivos, las concentracio nes de p roteína o ligando cambian constantemente debido a síntesis, degradación o movi miento de u n compa rtimento a o tro. ¿Qué sucede con el equilibrio cuando la concenLración de Po L camb ia? l a respuesta a esta pregunta se muestra en la a .Figura 2- 11, q ue comienza con una reacción en eq uilib rio (fig J_ 11a). En la Figura 2- l l b, el equilibrio se altera cuando se agrega más pro teína o ligando al sistema. Entonces, la proporció n de [P L] con respecto a [P] [L] d ifiere de la K,q· En respuesta a esto, la velocidad de la reacción de un ión aumenta para converti r cierta cantidad de P o L añadida en complejo p ro teína-li gando (Fig. J- 1 le). A medida que la velocidad alcanza su valor de equilibrio nuevamente, la velo cidad de la reacción hacia la de recha dismi n uye hasta que, fi nalmen te, el sistema akanza la velocidad de eq uilibrio u na vez más ( Fig. 2-

Interacciones proteicas

Ley de acción de masas: cuando la unión a proteínas está en equilibrio, la proporción de componentes unidos y disociados se mantiene constante. (a) Reacción en equilibrio

(P] (LI

íl¡H

,,

Velocidad de la reacción hacia la derecha (r1)

[PLI

~

(PL] -

[PI [LI - Keq

velocidad de la reacción hacia la izquierda t 2)

(b) Equilibrio alterado Se añade más P o L al sistema .......,

...

~--~·+·!

• •• 1 , ,•• ,

[PLI [PI [L] < Keq

S1

bia de senlido para restablecer la condición de equilibrio. (Nótese que la ley de acción de masas no es la misma que la ley de equilibrio de masas [véase eJ Capítulo 1 J.) Un ejemplo de este pri nci p io en funcionamiento es el transporte de ho rmonas esteroideas en la sangre. Los esteroides so n h idroíóbicos, por lo que más del 99% de estas hormonas se encuentra unido en la sangre a proteínas transportadoras. La proporción de equilibr io [PL]/[P] [Lj es 99% hormona unida/!% hormona disociada. Si n embargo, solo la hormona disociada o "libre" puede atravesar la membrana celular e ingresar a las células. A medida que la hormona libre sale de la sangre, la proporción de equilibrio se altera; enwnces, las p roteínas transpor tadoras libera n algo de la hormona unida hasta q ue la proporción 99/ 1 se restablece n uevamente. Es te mismo principio se aplica a las reacciones enz imá ticas y metabó licas. Cambiand o la concentración de uno de los participantes en una reacc ión química, tienen u n efecto de reacc ión en cadena que altera las concentraciones de los o tros participantes de la reacción. Revisión

13. Considere lareacción del ácido carbónico, lacual es reversible: (c) La velocidad de la reacción r1 se incrementa para convertir algo de P o L añadidos en producto PL

co, +H,O

= H,co,

(ácidocarbónico) ==

H·+HCO;

Si laconcentración dedióxido de carbooo enel cuerpo aumenta, ¡qué sucede con laconcentración deácido carbónico (H,CO,)? ¿Quéocurre con el pH?

La constante de disociación indica la afinidad Para las reacciones de unión a las proteínas, en las cuales la ecuación de equilibrio es una representación cuanlitativa de la afinidad de la proteína de unión por el ligando, la recíproca de la constan te de equilibrio se llama co nstante de disociación ( Kd): (d) Equilibrio restablecido cuando

(P] [LI

[PL]

[PI [L] =

K

una vez más oq

[PLI -+

La proporción entre unido y disociado es siempre la misma en el equilibrio. • FIGURA 2- 11

La ley de acción de masas

l.J..41 [P l, [L] y [PL] han aumentado po r encima de sus valo res iniciales, pero la proporción de equ ilibrio se ha restaurado. la si tuación descrita es un ejemplo de una reacción reversible q ue obedece a la ley de acción de masas, una relación simple que se apl ica a las reacciones quimicas tanto en un tubo de ensa)'O como dentro de una célula. Usted puede haber aprendido esta ley en la clase de quím ica como el principio de LeChdtelier. En términos mu}' generales, la le)' de acción de masas dice que cuando una reacción está en eq uilibrio, la proporción entre los productos y los sust ratos es siempre la misma. Si la proporción se altera mediante el agregado o la eliminación de uno de los participantes, la ecuación de la reacción cam-

K d

= [P] [l] [PL]

ULilizando el álgeb ra para reo rganiu r la ecuación, tamb ién se puede expresar como

[PL] = [P] [L] Kd A partir de la ecuación reorganizada, usted debería poder ver que cuando la Kd es grande, el valor de {PL] es pequeño. En otras palabras, w1a consta nte de d isociación Kd grande sign ifica poca unión entre proteína y ligando, }' podemos decir que la proteína tiene poca a finidad por el ligando. A la inversa, un Kd pequeña es una constante de di~ociación menor y signi fica un ma)'Or valor de [PL], lo que indica una mayor afinidad de la proteína por el ligando. Si una proteína se une a muchos ligandos relacionados, una comparación de sus valo res de Kd nos puede decir cuál ligando es más propenso a unirse a la p ro teína. Los ligandos relacionados compiten por los lugares de unión, y se dice que son competidores. La competició n entre ligandos es una propiedad uni versal de la unión a las proteínas. l os ligandos que compilen e imitan las acciones de los otros se llaman agonisLas (ngo11is1, competidor). Los agonistas pueden existir

S2

Capítulo 2 Interacciones moleculares

en la naturaleza, como la 11icoti11a, el quimico hallado en el tabaco, que im ita la actividad del neurotransmisor aceti/coli1111 al uni rse a la misma proteína receptora. Los agonistas también pueden ser s intetizados aplicando lo que los cientí ÍLcos aprenden del estudjo de los lugares de un ión de proteínas y ligandos. La capacidad de las moléculas agonistas de imitar la actividad de los ligandos naturales ha conducido aJ desarro llo de muchos fárm acos.

Revisión 14. Un investigador está tratzndo de diseñar una droga que se adhiera a una proteína receptora celular particular.La molécula candidata Atiene una K, de4,9 para ese receptor. la molé·

cula Btiene una K, de0,3. ¿Qué molécula tiene más potencial para tener éxito como droga?

Múltiples factores alteran la unión proteica

Activaci611 Algunas proteínas está n inactivas cuando son sinteli2a-

l a aÍLnidad de una proteína por un ligando no es siempre constante. Factores químicos y físicos pueden a.Iterar o modular la aÍLn idad de unión o incluso pueden elim inarla totalmente. Algunas proteínas deben ser activadas antes de tener un luga r de unión funcional. En esta sección analizamos algunos de los procesos que han evolucionado para permitir la activación, la modulación y la inactivación de la unión proteica.

Stan ha estado tomando picolinato de cromo porq ue oyó que incrementaría su fuerza y masa muscular. Luego, un amigo le contó que la Administración de Alimentos y Medicamentos (FOA, por sus siglas en inglés) había dicho que no había evidencia que mostrase que el cromo ayudara a aumentar la masa muscular. En un estudio,* un grupo de investigadores administraron diariamente a jugadores de fútbol americano altas dosis de picolinato de cromo durante un pe ríodo de entrenamiento de dos meses. Hacia el final del estudio, los jugadores que habían tomado los suplementos de cromo no habían aumentado su masa ni su fuerza muscular más que los jugadores que no habían tomado los suplementos. Utilice Google Académico (http://scholar.google.com) para buscar la revisión de la FOA sobre el picolinato de cromo. Mire los artículos que se listan antes de contest ar la siguiente pregunta. PS: Con base en la revisión de la FOA, el estudio de Hatlm ark et al. (que no demostró un desarrollo muscular aumentado a partir de los suplementos de cromo) y los estudios que sugieren q ue el picolinato de cromo podría ocasionar cáncer, ¿usted piensa que Stan debería seg uir tomando picolinato de cromo?

* M.A Hallmark et al. Effects of chromium and resistive training on muscle strength and body compositíon. Med Sci Sports Excercise 28(1): 139-144, 1996.

32

39

43

47

49

lsoformas Aquellas proteínas estrechamente relacionadas, cuya función es similar pero cÜÍLeren en su afinidad por los ligandos, se den ominan isoformas. Por ejemplo, la proleina transportadora de oxígeno hemoglobi11a Liene múltiples isoformas. Una molécula de hemoglobina liene una estructura cua ternaria que consiste de cuatro sub unidades (véase Eig ?- 3). En el fe to en desarrollo, la isoforma de la hemoglob ina tiene dos cadenas O'. (alfa ) y dos cadenas y (gamma) que conforman las cuatro subunidades. Poco después del nacimiento, las moléculas de hemoglobina fetal se destruyen y son reemp lazadas por hemoglobina aduha. La isofo rma de la hemoglo bina adulta man tiene las dos isoformas de la cadena O'., pero tiene dos cadenas ~ (beta) en lugar de las cadenas y. Tanto la isofonna adulta como la fetal de la hemoglobina se unen al oxígeno, pero la isofo rma fetal tiene una mayor aÍLnidad po r ese elemento. Esto la hace más efic iente para ob te ne r oxígeno desde la placenta.

57

das en la célula. Antes de que una proteína de este tipo pueda activarse, ciertas enzimas deben cortar una o más porciones de su molécula (a Fi g. 2- t2a ). Las hormonas proteicas ( un tipo de molécula señaliz.adora ) y las enzimas pertenecen a dos grupos que comúnmente son sometidos a este tipo de activació11 proteolítica (/ysis, liberar). Las formas inactivas de estas proteínas son frecuentemente. identificadas con el p refijo pro- (antes): prohormona, p roenzima, pro insulina, por ejemplo. En cambio, algunas enzimas inact ivas tienen el sufijo -ógeno añadido al nombre de la enzima activa, como en tripsinógeno, la forma inactiva de la tripsina. La aclivac ión de alg unas proteínas requiere la presencia de un cofactor, que es unión o un pequeño grupo funcional orgánico. Los cofacto res deben adherirse a la proteína antes de que el lugar de unión se active y se una al li gando ( Fig. 2- 12c). Los cofactores iónicos indu)•en el Ca 2- , el Mg2+ y el Fe 2• • Muchas enzimas no funcionan s in sus cofactores.

Modulación La capacidad de una proteina para unirse a un ligando e iniciar una respuesta puede ser a lterada por di versos factores, indu)'endo la temperatura, el pH y las moléculas que interactúan con la proteína. Un facto r que inOu)'e, ya sea en la unió n a la p ro teína o en la act ividad proteica, se llama modulador. Hay dos mecanismos b¡\sicos po r los cuales tiene lugar la modulación. El modulador ( l ) cambia la capacidad de la proteína para un irse al ligando o (2) cambia la actividad de la pro teína o su capacidad para generar una respuesta. El • Cuad ro 2-3 resume los diferentes lipos de modulación. Los moduladores químicos son moléculas que se unen covalente o no covalentemente a las proteínas y alteran su capacidad de unión o su actividad. Los moduladores q uímicos pueden activar o aumenta r la unión a un ligando, disminuir la capacidad de unión o inactivar completamen te la proteína, tras lo cual se vuelve incapaz de unir cualq uier ligando. La inactivación puede ser tanto reversible como irreversible. Los antagonistas, también llamados in/1ibidores, son moduladores qLúmicos que se unen a una proteína y disminuyen su actividad. Muchos son moléculas simples que se unen a la proteína y b lo quean el luga r de un ión si n generar una respuesta. Son como el muchacho que se cuela en la fila a la entrada del cine para hablar

Activación e inhibición proteica ACTIVAC IÓN (a) Activación proteolítica: La proteína está inactiva hasta que se eliminan algunos fragmentos peptídicos.

Fragmentos peptíd icos

Proteína activa

Proteína inactiva

(b) Un activador alostérico es un modulador que se une a una proteína lejos del lugar de unión y la activa

(c) Los cofactores son necesarios para obtener un lugar de unión activo.

COFACTOR

PROTEÍNA INACTIVA

~

e.::::::::- l ugar de

/

unión

L2

/

PROTEÍNA ACTIVA

e .'----s::--

l ugar de unión

Activador alostérico

La proteína sin el modulador es inactiva.

El modulador se une a la proteína lejos del lugar de unión.

Sin el cofactor adherido, la proteína no es activa.

La unión del cofactor activa a la proteína.

INHIBICIÓN

(d) Un inhibídor competitivo bloquea la unión del ligando al lugar de unión

(e) Un inhibidor alostérico es un modulador que se une a la pro teína lejos del lugar de unión y lo inactiva.

lohib<E"'"" PROTEÍNA ACTIVA

PROTEÍNA ACTIVA

PROTEÍNA INACTIVA

PROTEÍNA INACTIVA

La proteína sin el modulador es activa.

El modulador se une a la proteínalejos del lugar de unión y lo inactiva.

54

Capít ulo 2 In teracciones moleculares

Factores que afectan la unión aproteínas

Esenciales para la actividad de unión Cofactores

Requeridos para la unión del ligando al lugar de unión

Activación proteolítica

Convierte la forma inactiva en act iva al eliminar parte de la molécula. Ej emplos: enzimas digestivas, hormonas proteicas

Moduladores y factores que alteran la unión o la actividad lnhibidor competitivo

Compite directame nte con el ligando uniéndose reversiblemente al lugar de unión

lnhibidor irreversi ble

Se une al lugar de unión y no puede ser desplazado

Modulador alostérico

Se une a la proteína lej os del lugar de unión y cam bia su actividad; puede ser inhibidor o activador

Modulador covalente

Se une covalentemente a la proteína y cambi a su actividad. Ej emplo: grupos fosfa to

pH y t emperatura

Alteran la forma tridimen sional de la proteína rompiendo puentes de hidrógeno o S- S; puede ser irreversible si la proteína se desnaturaliza

con su novia, la cajera. A él no le intere.sa comprar una entrada, pero impide que la gente en la fila detrás de él pueda comprar en Lradas para la película. Los inhib idores competitivos son antagonistas reversibles que comp ilen con el liga ndo habitual por el lugar de unión ( Pi g. ?- l 2d). El grado de inhibición depende de las concentraciones relaLivas del inh ibido r compelitivo y del ligando, así como de las afi nidades de la proteína por ambos. La unión de los inh ib idores compelilivos es reversible: el aumenLo de la concentración del ligan do puede desplazar al inhibidor compeli tivo y disminui r la inhibición. Los aht-ngonistas irreversibles, por otro lado, se unen fuertemente a la proteína y no pueden ser desplazados por competició n. Los fármacos antagonistas han demosLrado ser úL iles en el lratam iento de muchas enfermedades; por ejemplo, el tamoxifeno, un antagon isla del receptor de estrógenos, se utiliza en el tratamiento de los cánceres de mama dependien Le.s de hormonas. Los moduladores alostéricos }' covalenLes pueden ser a ntagonisLas o acLi vado res. Los moduladores alosLéricos (a/los, otro, + stereos, sólido) se unen reversiblemente a una proteína en un siLio regulador lejos del silio de unión}', al hacer esto, camb ia n la forma del sit io de unión. Los illhibidores a/ostéricos son antagonisLas que dism inuyen la afin idad del si Lio de unión por el ligando e inhiben la

actividad de la pro Leína ( Fig. 2- l 2e). Los cictivadores a/ostérícos aumentan la probab ilidad de unión entre p ro leína y ligan do y aumentan la acti vidad de la p ro Leína (Fj g ? . 1?h); po r ejemplo, la capacidad de un ir oxígeno de la hemoglobina cambia con la modulación alostérica del dióxido de carbono, los H+ y muchos otros facto res (véase el C~pí•ulo 18) . Los moduladores covalentes son álomos o grupos funcionales que se unen covalentemente a las proteínas y alteran sus propiedade.s. Como los moduladores alosLéricos, los modulado res covalen Les pueden aumen lar o disminuir la capacidad de unió n de una proleína o su actividad. Uno de los moduladores covalen Les más com unes es el grupo fosfaLo. Muchas proteínas en la célula pueden ser activadas o inaclivadas cuando un grupo fosíaLo forma u n enlace covalente con ellas ( un proceso conocido corn o fosfori/a.ci6n). Uno de los moduladores químicos mejor conocidos es el anlibióLico penicili na. Alexander Flemi ng descub rió este comp uesto en 1928, cuando notó que el hongo Penicillium inhibla el crecimiento bacteriano. Hacia J938, investigadores extrajeron el ingredienLe act ivo penicilina de este moho y lo ulilizaron pa ra tratar infecciones en humanos, pero no fue hasLa 1965 que los investigadores descifraron exactamenle cómo actuaba esLe antib iótico. La penicilina es un antagonista que se une a una protelna bacleriana clave al imitar al ligando normal. Debido a q ue la penicilina forma enlaces irrompibles co n la proteína, esta es inhibida irreversiblemente. Sin la pro leína, la bacleria es incapaz de formar una pared celular rígida. Sin pared celular rígida, la bacLeria se hincha, se rompe y muere.

Factores físicos Las condiciones ílsicas, como la temperatura y el pH (acidez), pueden tener efectos trágicos sob re la eslructu.ra y la fun ción pro te icas. Pequeños cambios en el pH o la temperatura acLúan como modulado res para aumenta r o disminuir la actividad t• Fig. 2- l 3a). Sin embargo, una vez que esLos facLores sobrepasan u n cierto valor críLico, rompen los en laces no covalentes que man Lienen la conformación terciaria de la proLeína, esta pierde su forma y, j un to con esLO, su actividad. Cuando la proteína p ierde su conformac ión se dice que esLá desnaturalizada. Si usted alguna vez ha freído un hue vo, habrá observado cómo sucede esLa transformació n en la proleí na albúmina de la clara del huevo, la cual cambia de un estado viscoso y Lransparente a un estado firme }' blanco. Los io nes h id rógeno, a una concen Lración su ficienlemente alta como para ser llamada ácida, tienen un e fecto sim ihu sobre la esLrucLura proteica. En la preparación del cev iche, el plato nacional de Ecuador, el pescado crudo se mar ina en jugo de lima. El jugo de lima ,leido conliene iones h id rógeno q ue rompen los p uentes de hidrógeno de las proteínas muscula res del pescado, causando su desnaluralización. Como resuhado, la carne se VL1elve m,\s fi rme y opaca, como si hubiera sido cocinada con calor. En pocos casos, la act ividad p uede ser restablecida si se regresa a la temperaLura o al pH o rigin al; enLonces, la proLeína recupe ra su forma como si nada h ubiese suced ido. Habitualmente, sin embargo, la desnaLuralización produce una pérdida permanente de la act ividad. C iertamente, no hay manera de "des freír" un huevo o "descocinar" una po rción de pescado. La in lluencia potencialmente o mino sa de la temperatura y del pH sobre las pro leínas es una de las razo nes por las cuales estas va riab les son reguladas Lan cuidadosamente por el cuerpo.

• •

Factores que influyen sobre la actividad proteica+

(a) Temperatura y pH Los cambios en la temperatura y el pH pueden romper la estructura proteica y ocasionar pérdida de función.

Proteína activa con conformación terciaria normal

º

PREGUNTA ¿La proteína es más activa a 30 ºC o a 48 ºC ?

Proteína desnaturalizada

20

40

30

50

Esta proteína se desnaturaliza alrededor de los 50 ºC.

60

Temperatura (ºC)

(b) Cantidad de proteína

{e) Cantidad de ligando

La velocidad de reacción depende de la cantidad de proteína. Cuanta más proteína haya, mayor será la velocidad.

Si la cantidad de proteína de unión se mantiene constante, la v elocidad de la reacción depende de la cantidad de ligando hasta el punto de saturación.

3

U) ...._

U)

a,

O)

.s ""

ci'Í Q)

PREGUNTAS • ¿Cuáles la velocidad cuando la concentración de la proteína es igual a A? • Cuando la velocidad es de 2,5 mg/s, ¿cuál es la concentración de la proteína?

2

::,

a. <J) Q) ~

Q)

-o -o -o

"' ·¡:;

1

.2

~

o

.s

4

-

Velocidad máxima en la saturación

-

-

-- --, , - - - - - - - - --1

"'

ci'Í Q)

::,

º

3 a. <J) l!' (1)

-o 2 -o -o "' ·¡:; o 1

PREGUNTA ¿Cuál es la velocidad cuando la concentración de ligando es de 200 mg/mL?

J

o A

B

c

Concentración proteica -

En este experimento, las cantidades de ligando permanecen constantes.

25

50

75

100

125

150

175

Concentración de ligando (mg/mL) En este experimento, la cantidad de proteína ligadora fue constante. A la máxima velocidad, se dice que la proteína está satu rada.

S6

Capítulo 2 Interacciones moleculares

Revisión

1S. Una cada químico con su/s acóórv'es. (a) Modulador alostérico l. Se une lejos del lugar de unión (b) lnhibidorcompetitivo 2. Se uneallugarde unión (c) Modulador covalente 3. Solo inhibe la act~~dad 4. Inhibe oaumenta la actividad

El cuerpo regula la cantidad de proteínas en las células l a característica final de las proteínas en el cuerpo h umano es que la cantidad de u na determinada proteína varía con el ti empo (frecuen temen te, de una manera regu lada). El cuerpo tiene meca nismos que le permiten mon itorizar si necesita proteínas particulares en mayor o menor can Lidad. Vías de señalización complejas, muchas de las cua les involucran proteínas, o rdena n a las cél ulas fabr ica r nuevas proteínas o romper ( degradar) las proteínas existentes. EsLa producc ión p rogramada de nuevas prote ínas ( recepto res, enzimas y transportadores de membrana en particula r) se denom ina regulación p or incremento. A la inversa, la eliminación prog ramada de p rotelnas se denomi na regulación por dis minución. En ambas instancias, se ordena a la célula fabrica r o elim inar pro teínas para modificar su respuesta. La ca ntidad de proteína presen te en u na célula tiene una inll uenc ia directa sob re la magnit ud de la respuesta cel ula r. Po r ejemplo, el gráfico de la Figura ?-l3b muestra los res ultados de un experimen to en el cual la cantidad de ligando se man tiene co nstante, mientras que la cantidad de proteína varía. Como muestra el gráfico, un incremento en la cantidad de la p roteína presente ocasiona un altmen lo de la respuesta. Como analogía, p iense en las cajas registradoras de un supe rmercado. Imag ine q ue cada cajero es una enzima, los c\ iente.s que esperan son moléculas de li gando y la gente que sale del local con sus compras es los productos. Cien d ien tes pueden ser atend idos 1m\s rápidamen te cuando hay 25 cajas ab iertas que cuando solo hay l Ocajas. As imismo, en una reacción enzimáLica, la presencia de más moléculas pro teicas (enzimas) sign iiica que más lugar de unión están disponibles para interactuar con las moléculas de li gando. Como resultado, los ligan dos son convertidos en producto más n\pidamente. La regulación de la concentración pro te ica es un a estrategia importan te que ut iliza n las células para con trola r sus procesos fü iológicos. l as cél ulas mod ifican la cantidad de una proteína in fl uye ndo ta nto en su síntesis como en su degradac ión. Si la síntesis p ro teica supera su degradación, la proteína se acum ula )' la velocidad de reacción aumenta. Si la degradación proteica sobrepasa su síntesis, la can tidad de p ro teína d isminuye, así como la veloc idad de reac-

ción. Incluso cuando la can Lidad de proteína es constante, existe una renovació n persistente de moléculas de proteína.

la velocidad de reacción puede alcanzar un máximo Si la concentración de una proteína en una cél ula es constan te, entonces la concentración del ligan do determ ina la magnitud de la respuesta. Menos ligandos activa n menos proteínas y la respuesta es baja. A medida q ue las concentracio nes de ligando aumentan, también lo hace la magnitud de la respuesta, hasta un máximo en el cual todos los lugares de un ión proteicos están ocupados. La figura 2- 13c muestra los resultados de un experimen Lo típ ico en el cual la co ncenLració n de proteína es constante pero la concentración de ligando va ría. A bajas concentraciones de ligando, la velocidad de respuesta es d irectame nte p roporcio nal a la concenlrac ión del ligando. Una vez q ue la concemración de las mo léculas de ligando supera cierto nivel, las moléculas de proteí na no tienen más luga r de unió n libres. Las proteí nas está n completamen te ocupadas, y la velocidad alcanza un valor máximo. Esta co nd ición se conoce como sa turación. La saturación se ap lica a enzimas, transpo rtado res de memb rana, receptores, pro teínas de un ión e inmunoglobulinas. Una analogía de la saturación apareció, en los p rimeros tiías de la telev isión, en la seri e Yo amo a Lucy. Lucille Ilall trabajaba en la cin ta transportadora de un a fábrica de golosi nas llenando con chocolates los pequeños moldes de papel de una caja de bombones. Al inicio, la cinta transportadora se movía lentamente y ella no tenía di ficultad para tornar el bombón y colocarlo de ntro de la caja. De forma grad ual, la ci nta comenzó a trae r los bombones más ráp idamente y Lucy debió aumentar su ve locidad de empaque para poder man tener el ritmo. Final men te, la cinta le traía los bombones tan velozmente que no podía embalarlos a Lodos en las cajas, ya q ue estaba trabajando a su máxima velocidad. Ese era el punto de saturación de Lucy. ( ¡Su so lución fue llenar con bombones tamo su boca como las cajas! ) En concl usión, usted h a aprendido sob re las importantes y casi u niversales prop iedades de las proteínas so lubles. Repasará estos conceptos muchas veces a medida que estudie los sistemas orgán icos del cuerpo. Las p ro teínas insolubles del cuerpo, que son los componentes estructurales pr incipa les de células y tej idos, son estudiadas en cap ítulos posteriores. Revisión

16. ¿Qué le sucede a lavelocidadde una reacción enzimática a medidaque la cantidad de enzi· ma pres¿nte disminuye? 17. ¿Qué lesucede a la velocidadde una reacóóo enzimática cuandola enzima ha alcanzado la saturación?

Interacciones proteicas

S7

Suplementos de cromo En este tema relacionado, usted aprend ió que las aseveraciones sobre la capacidad d e l picoli nato de cromo para aumentar la m asa muscular no han sido apoyadas por evidencia de experimentos c ien· tíficos controlados. También aprendió que hay estud ios q ue s ugie re n q ue a lgunas variantes de la forma biológica t rivalente del cromo pue·

den ser tóxicas. Para saber más sobre investigaciones actuales, d iríja· se a PubMed (www.pubmed.gov) y busque "picolinato de cromo" (utili· ce las comillas). Compa re lo que encu entre con los resultados de una búsqueda similar en Google. ¿Debería usted creer todo lo que lee e n la Web? Ahora, compare sus respuestas con las del cuadro de repaso.

Pregunta

Hechos

Integración y análisis

1. Encuentre e l cromo en la tabla periódica de e lementos.

La tabla periódica organiza los elementos de

N/0*

acuerdo con su nümero atómico. Según la tabla, el cromo (Cr) tiene un número ató· mico de 24 y una masa atómica p romedio de 52.

N/0

¿Cuántos electrones tiene un átomo de cromo?

El número atómico de un e le mento = número de protones en un átomo. Un átomo tiene igual número de protones que de electrones.

El número atómico del cromo es 24; por lo tanto, un átomo de cromo tiene 24protones y 24 electrones.

¿Cuáles e lementos cercanos al cromo son también elementos esenciales?

Molibdeno, manganeso y h ierro.

N/0

2. Si la gente tiene una deficiencia de cromo, ¿usted diría que su nível de glucosa en san· gre será menor o mayor que lo normal?

El cromo ayuda a transportar g lucosa desde la sangre hacia las células.

Si el cromo está ausente o falta, menos gluco· sa saldría de la sangre y la glucosa sanguínea sería mayor que lo normal.

A partir de los resultados del estudio chino, ¿puede usted concluir que todas las person as con diabetes padecen una deficiencia de cromo?

Las dosis más altas de suplementos de cromo disminuyeron los niveles e levados de glucosa en sangre, pero las dosis más bajas no tienen efecto. Éste es solo un estudio, y no se tiene información sobre estudios si milares de otros lugares.

Contamos con evidencia insuficiente a partir de la información presentada como para sacar una conclusión sobre el rol de la defic iencia de cromo en la diabetes.

3. ¿Cuántos electrones ha perdido el ión hexavalente del cromo? ¿Y el ión trivalente?

Por cada e lectrón perdido por un ión queda un protón cargado positivamente en e l núcleo del ión.

El ión hexavalente del cromo, Cr"-+, tiene seis protones no pareados y, por lo tanto, ha p e r· dido seis electrones. El ión trivalente, Cr'•, ha perdido tres electrones.

4. A partir de esta información, ¿puede usted concluir que el cromo hexavalente y e l trivalente son igualmente tóxicos?

La forma hexavalente es utilizada en la industria y, cuando es inhalada, se ha relacionado con un aumento del riesgo de cáncer de pulmón. Muchos estudios han demostrado esta asocia· ción, por lo que e l Sistema de Evaluación y Servicio de Información de Riesgos de California ha emitido advertencias a los trabajadores del cromo. La evidencia al día de hoy de la toxicidad del cromo trivalente en e l picolinato de cromo proviene d e estudios realizados en células aisla· das en cultivos tisulares.

Aunque la toxicidad d el C~ está bien esta· blecida, la toxicidad del Cr,. no ha sido d e ter· minada concluyentemente. Estudios realiza-

¿Cuál es el número atómico d el cromo? ¿Cuál es su masa atómica?

S. Con base en el estudio que no demostró un desarrollo muscular aumentado a partir de los suplementos de cromo y los estudios que sugieren que e l picolinato de cromo podría ocasionar cáncer, ¿usted piensa que Stan deberfa seguir tomando picolinato de cromo?

Ninguna evid~nciaexperimental apoya un papel del picolinato de cromo en el aumento de la masa o la fuerza muscular. Otra investigación sugiere que e l picolinato d e cromo puede causar cambios cancerosos en células aisladas.

32

39

43

47

49

dos en células in vitro pueden no ser aplica· bles a humanos. Se debe realizar estudios adiciona les en los cuales se administre a ani· males dosis razonables de picolinato de cromo por un período de tiempo extenso.

La evidencia presentada sugiere que para Stan no hay ningún beneficio p roveniente de tomar picolinato de cromo y puede haber riesgos. Utilizando el análisis de riesgo-beneficio, la evi· dencia apoya el abandono de los suplementos. Sin embargo, tal decisión es responsabilidad personal de Stan. Él debería mantenerse informado sobre nuevos desarrollos que cambia· rían el análisis de riesgo-beneficio.

SS

Cap ítulo 2 Interacciones moleculares

Prueba de revisión de química Utilice esta prueba para saber qué áreas de química y bioquímica básica debería repasar. Las respuestas se encuentran al final del capítulo. El titulo sobre cada grupo de pregunt as se refiere a una figura que trata sobre el tema.

l l. Escriba las fórmulas qtumtcas para cada molécula representada. Calcule la masa molecular de cada molécula.

b)

O= C= O

Átomos y moléculas (Fig. 2-S) Una cada partícula subató mica de la columna de la izquierda con todas las frases de la columna de la derecha que la describan. Una frase puede ser utilízada más de una vez.

OH

e) l. electrón 2. neutrón 3. protón

(a) uno tiene una masa atómica de 1 uma (b ) se encuentra en el núcleo ( e ) tiene carga negativa (d ) cambiando el número de esta partícula en un átomo se crea tm nuevo elemento (e) añadiendo o peHliendo esta partícula un átomo se convierte en un ión (f} ganar o perder esta partícula genera un isótopo de ese elemento (g) determina el número atómico de un elemento (h ) contribuye a la masa atómica de un elemento

4. Los isótopos de un elemento tienen el mismo número de _ _ _ _ y

- - - - , pero difieren en el número de _ _ _ _ Los isótopos inestables emiten energía llamada _ _ __ S. Nombre el elemento asociado con cada uno de estos símbolos: C, O, N,y H . 6. Escriba el símbolo de una o dos letras de cada uno de estos elemen tos: fósforo, potasio, sodio, azufre, calcio y cloro. 7. Utilice la tabla periódica de elementos del final del libro para responder las siguientes preguntas: (a) ¿Qué elemento tiene 30 protones? (b) ¿Cuántos electrones hay en un átomo de calcio? (e) Encuentre el número atómico y la masa atómica promedio del iodo. ¿Cual es el símbolo del iodo? 8. Un ión magnesio, M¡f', ha (ganado/perdido) dos (protones/ne11tro-

11es/e/ectrones). 9. 1:1 H" también es llamado protón. ¿Por qué se lo llama así? 1O. Utilice la tabla periódica de elementos del final del libro para responder la~ siguientes pregunta~ sobre un átomo de sodio: (a) ¿Cuántos electrones t iene? (b) ¿Cuál es su carga eléctrica? (c) ¿Cuántos neutrones tiene el átomo promedio? (d) Si este átomo perdiese un electrón, se llamaría a11ión/catió11. (e) ¿Cuál setía la carga eléctrica de la sustancia creada en (d )? ( f ) Escriba el símbolo químico del ión al que se hace referencia en ( d ) . (g) ¿En qué se transfonna el átomo de sodio si pierde un protón de su núcleo? (h) Escriba el símbolo químico al que se hace referencia en (g).

H

H

H

H

1

1

1

1

H - C1

H

d)

-fº

c-c-c-c

J

J

CH3 H

1

'-oH

NH2

Lípidos (Eig 2· l ) 12. Una cada lípido con su mejor descripción:

( a) triglicerido (b) eicosanoide (c) esteroide ( d ) aceite (e) fosfolípidos

J . fom1a más comun de hpido en el cuerpo 2. líquido a temperatma ambiente, habitualmente proveniente de las plantas 3. componente importante de la membrana celular 4 . estructura compuesta por anillos de carbono 5. ácido graso modificado de 20 carbonos

13. Utilice las fórmulas químicas dadas para decidir cuál de los siguien-

tes ácidos grasos es el más insaturado: (a) C 18HJ6O, (b) C 18 H3.0 2 (c ) c,.H.•Pi

Carbohídratos {Fjg. 2-21 14. Una cada carbohidrato con su descripción: (a) almidón (b) quitina (c) glucosa (d ) lactosa (e) glucógeno

J. monosacárido 2. disacárido, se encuentra en la leche 3. forma de almacenamiento de glucosa en los animales 4. forma de almacenamiento de glucosa en las plantas 5. polisacárido estructural de invertebrados

Proteínas (Fjg. 2-31 15. Una estos términos correspondientes a proteínas y aminoácidos: (a) ladrillos estructurales (b) deben ser incluidos en nuestra dieta (c) catalizadores proteicos que aceleran la velocidad de las reacciones químicas (d ) secuencia de aminoácidos en una proteína (e) cadenas proteicas plegadas en una estructura en forma de pelota

1. aminoácidos

2. 3. 4.

5. 6.

7.

esenciales estructura primaria aminoácidos proteínas globulares enzimas estructura terciaria proteína, fibrosas

Pregun tas 16. ¿Qué aspecto de la estructura proteica permite a las proteínas tener

Nucleótidos (Fig. 2-4)

más versati lidad que los lípidos o los carbohidrntos? 17. Los enlaces peptídicos se forman cuando el grupo _ _ _ _ de un aminoácido se une con el ____ de otro aminoácido.

18. Nombre los tres componentes de un nucleótido. 19. Compare la estmctura del ADN con la del ARN.

59

20. Distinga entre purinas y pirimidinas.

Resumen del capítulo Este capítulo introduce las i11teraccío11es molecul11res entre las biomoléculas, el agua y los iones que subyacen en muchos de los temas principales en fisiología. Estas interacciones son parte integral del flujo de i11for111ación, almacenamiento y transferencia de energúi y de las prop-iedades mecánicas de las células y tejidos en el cuerpo.

14. El pH de una solución es una medida de su concentración de iones

Moléculas y enlaces

Interacciones proteicas

1. Los cuatro grupos principales de biomo léculas son: carbohidrntos, lípidos, proteínas y nucleótidos. Todos ellos contienen carbono, hidrógeno y oxígeno. (p. 33; Figs. 2-1, 2-2, 2-3 y 2-4 ) 2. Las proteínas, los Jípidos y los carbohidratos se combinan para formar glucoprotemas, glucolípidos o lipoproteínas. (p. 40; Fig. 2-5 ) 3. Los electrnnes son importantes para los enlaces covaJentes y iónicos, la captura y transferencia de energia y la fom1ación de radicales libres. (p.-12 ) 4. Los en laces covalentes se forman cuando átomos adyacentes comparten uno o más pares de electrones. \ p. 42; Fig. 2-6) 5. Las moléculas polares tienen átomos que comparten elech·ones de modo desigual. Cuando los átomos comparten electrones uniformemente, la molécula es no polar. (p. 42; Fig. 2-6) 6. Un átomo que gana o pierde electrones adquiere una carga eléctrica y se denomina ión. (p. 42; Fjg 2-6) 7. Los enlaces ió1úcos son enlaces fuertes que se forman cuando iones con cargas opuestas se atraen entre sí. (p. 42) 8. Los p uentes de h idrógeno débiles se forman cuando átomos de hidrógeno de moléculas polares son atrnídos por átomos de oxígeno, nitrógeno o flúor. Los puentes de hidrógeno entre las moléculas de agua son los responsables de su tensi6n superficial. (p. 42; fjg, ?-6) 9. Las fuerzas de Van der 'Waals son enlaces débiles que se forman cuando los átomos se atraen entre sí. (p. 42)

16. la mayona de las prnteínas solubles en agua funcionan como enzima~.

Interacciones no covalentes

hidrógeno. Cuanto más ácida es la solución, menor es su pH. (p. 48; fjg J-9) 15. Los amortiguadores de pH o buffers son soluciones que moderan los cambios del pH. (p. 49)

transportadores de membrana, moléculas de seí\alización, receptores, proteínas de unión, inmunoglobulinas o factores de rranscripci6n. (p. 49)

17. los ligandos se unen a las prnteínas en un lugar de unión. Según el

18.

19.

20. 21. 22. 23. 24.

Líquidos y electrolitos: homeostasis ácido-base 10. El solvente universal para las soluciones biológicas es el agua. (p. 46;

fig. 2-8) 11. La faci lidad con la cual una molécula se disuelve en un solvente se llama solubilidad en ese solvente. Las moléculas hidrofílicas se disuelven fácilmente en agua, pero las moléculas hid rofóbicas no. (p. 46) 12. La estructura molecular es generada por los á11gulos de los enlaces covalentes y por débiles interacciones no covalentes dentro de la molécula. (p. 46; Fig. 1-8) 13. Los H· libres en solución pueden romper los enlaces no covaJentes de una molécula y alterar su capacidad para funcionar. (p. 48)

Preguntas Nivel 1: Revisión de hechos y términos 1. Nombre los cuan-o tipos de biomoléculas. Dé un ejemplo de cada tipo que sea relevante para la fisiología. 2. ¿Verdadero o falso? Todas las moléculas orgánicas son biomoléculas.

25.

modelo de adaptación inducida de tmión a proteínas, la~ formas del ligando y del lugar de unión no necesitan encajar exactamente. (p. 50; Fig. 2- 10) Las proteínas son específicas respecto de los ligandos a los que se unen . La atracción de una proteína hacia su ligando se denomina afinidad de esa proteina por el ligando. La constante de disociación ( Kd) es una medida cuantitativa de la afinidad de una proteína por un ligando determinado. (p. 50) Las reacciones de unión reversibles llegan a un equilibrio. Si el equilibrio se altera, la reacción sigue la ley de acción de masas y cambia en el sentido en que se restablece la proporción de equilibrio. (p. 5 1: Eig J_ 11 ) los ligandos pueden competir por el lugar de unión de una proteina. Si ligandos competidores imitan su actividad, son agonistas. (p. 51 ) Las proteínas estJ"echamente relacionadas que tienen fi.mciones similares pero diferentes afinidades por los ligandos se llaman isoformas. (p. 52) Algunas proteínas deben ser activadas por activación proteolítica o por adición de cofactores. (p. 53; Fig. 2-12) Los inhibidores competitivos pueden ser desplazados del lugar de unión, pero los antago1ústas irreversibles no. (p. 53; Fig. 2 -1 2} Los moduladore.s alostéricos se unen a las proteína~ en tm sitio que no es el de w1iém. Los moduladores covalentes se unen mediante enlaces covalentes. Ambos tipos de moduladores pueden activar o inhibir la proteína. (p. 53; Eig ? - 1? ) 'Jemperaturas o pH extremos desnaturalizan las proteínas. (p. 55; Fig. 7- 11)

26. Las células regulan sus proteínas mediante la regulación por incremento o la regulación por disminución de la sintesis o degradación de proteínas. La cantidad de proteína influye directamente sobre la magnitud de la respuesta celular. (p. 55; l'ig. 2- 13 ) 27. Si la cantidad de proteína (como una enzima ) es constante, la canti dad de ligando determina la respuesta celular. Si todas las proteínas de unión (tales como las enzimas) se saturan con ligando, la respuesta alcanza su máximo. (p. 55; Fig. 2-13 )

Véanse las respuestas en el apéndice A

3. Cuando los átomos se unen fuertemente entre sí, tal como H 2O u 0 2, una unidad se denomina _ _ __ 4. Un átomo de carbono tiene cuatro electrones no pareados en una capa externa con espacio para ocho electrones. ¿Cuántos enlaces covalentes formará un átomo de carbono con otros átomos?

Capítulo 2 Interacciones moleculares

60

5. Complete los espacios con el tipo de enlace que corresponda. En un enlace ____ , los electrones son compartidos por los átomos. Si los electrones son atraídos más fuertemente hacia un átomo que hacia el otro, se ruce que la molécula es _ _ _ _ Si los electrones son compartidos uniformemente, se dice que la molécula es

6. Nombre dos elementos cuya presencia contribuya a que una molécula se convierta en una molécula polar. 7. Basandose en lo que conoce emp tricamente sobre la tendencia de las sigu ientes sustancias a disolverse en agua, diga si son molécula~ polares o no polares: azúcar de mesa, aceite vegetal. 8. Un ión cargado negativamente se llama - - - -, y un ión cargado positivamente se llama _ _ __ 9. Defina pH de una solución. Si el pH es menor a 7, la solución es ____; si el pH es mayor a 7, la solución es _ _ __ 1O. Una molécula que modera los cambios en el pH se denomina 11. Las proteínas que se combinan con lípidos se llaman----, y las proteínas que se combinan con carbohidratos se llaman ____. 12. Una molécula que se une a otra molécula se llama _ _ __ 13. Una estas definiciones con sus términos (no se utilizan todos): (a) la capacidad de una proteína para unirse a una molécula pero no a OO'a

(b) la parte de una molécula proteica que se w1e al ligando (c) la capacidad de una proteína para alterar su forma cuando se w1e al ligando Ca2 •

l. inhibición irreversible 2. adaptación inducida 3. lugar de unión 4. especificidad 5. saturación

14. Unión que, como o debe estar presente para que una enzima pueda funcionar se llama _ _ __ 15. Se ruce que una proteína cuya estructura es alterada a tal punto que su actividad es nula está _ _ __

Nivel 2: Revisión de conceptos

• • • • • • •

concentración equivalente puente de hidrógeno hidrofilico hidrofóbic.o molaridad mol

• • • • • •

(a) La sustancia A debe unirse a una emima y aumentar su actividad. (b) La sustancia B debe imitar la actividad de una molécula señalizadora normal del sistema nervioso. (c) La sustancia C debería bloquear la actividad de un receptor de membrana.

1. antagonista 2. inhibidor competitivo 3. agonista 4. activador alostérico 5. modulador covalente

Nivel 3: Resolución de problemas 21. Se lo convoca para ayuda r en la autopsia de un ser extraterrestre cuyos

restos han sido naidos a su laboratorio. El análisis quím ico informa: 33% C, 40% O, 4% H, 14% N y 9% P. A partir de esta información, usted concluye que las células contienen nucleótidos e, posiblemente ADN y ARN. Su asistente pide que le explique cómo es que sabe esto. ¿Qué le dice? 22. Cuanto más arduamente trabaja una célula, mayor es el CO0 que produce. El CO, es transportado por la sangre según la siguiente ecuación:

CO, + H,O ,.........:. H 2CO 3 (ácido cru·bónico) ,.........:. H ' + HCO,¿Que efecto tiene el trabajo intenso realizado por sus células musculares sobre el pH sanguíneo?

Nivel 4: Problemas analíticos

Mg2 - ,

16. Ejercicio de mapeo: convierta la lista de términos en describa las soluciones.

20. Se le pide que dise11e algunos fármacos para los propósitos desa-itos debajo. Elija la/s característica/s conveniente/s para cada droga de la lista numerada.

Lm

mapa que

molécula no polar molécula polar sol ubilidad soluto solvente agua

17. Una solución en la cual [H "J = 10·3 Mes ____ (ácida/básica) , mientras que una solución en la cual [H 'j = 10-10 Mes _ _ __ (ácida/básica) . Calcule el pH de estas soluciones. 18. Nombre tres nucleótidos o ácidos nucleicos l' mencione por qué cada uno de ellos es importante. 19. Usted sabe que dos proteínas solubles son isoformas entre st. ¡Qué puede decir sobre sus estTucturas, funciones y afinidades por los ligandos?

23. Calcule la cantidad de NaCl que debería pesar para preparar un litro de NaCl al 0,9% . Explique cómo prepararía un litro de esta solución. 24. Una solución 0,1 M de NaCl contiene 58,5 g de sal por litro. (a)

¿Cuántas moléculas de NaCI hay en esta solución? (b) ¡Cuántos milimoles de NaCl hay? (c) ¿Cuántos equivalentes de Na• hay? (d) Exp rese 58,5 g de NaCl por litro como una solución porcentual. 25. ¿Cómo prepararía 200 mL de una so lución de glucosa al 10%? Calcule la molaridad de esta solución. ¡Cuántos milimoles de glucosa hay en 500 ml de esta solución? (Sugerencia: ¡Cuál es la masa molecular de la glucosa?) 26. El grafico que se muestra más abajo representa la unión de moléculas de oxigeno [O, ) a dos proteínas ruferentes, núoglobina y hemoglobi na, en un rango de concentraciones de oxígeno. Basándose en el gráfico, ¿qué proteína tiene mayor afinidad por el oxJgeno? Explique su razonamiento.

o"'

"'"'

'O

·e

:,

"' e

2e

4U-+- l - - - rh - - - - - - + - - - - - - - - I

a.

fl

'*-

O

20

40

60

Concentración de oxigeno (mm de mercuño)

80

Respuestas

61

Respuestas

1

Respuestas a las preguntas de revisión

Página 38 l. Los elementos esenciales principales son O, C, H, N, P, Na, K, Ca, Mg,

S, CI. 2. C,H.~P. o (CH,()). 3. Un grupo amino es - NH 2• Un grupo carboxilo es -COOH .

Página 42 4. apareados 5. ion 6. (a) 2, (b) 4, (c) 1, (d ) 3 Página 47 7. las polares 8. hidrofilica 9. Los iones Na· y CI- forman puentes de bichógeno con las moléculas de agua polares. Esto rompe los enlaces iónicos que mantienen íntegros los cristales de NaCI. Página 49 10. Un ácido se disocia en uno o más H· y aniones. 11. el p H es la concentración de H· . 12. baja Página 51 13. El ácido carbónico aumenta y el pH disminuye.

6. Los 5 g de glucosa agregan volttmen a la solucion, por lo que, si comenzamos con 100 ml de solvente, obtendremos más de 100 ml de solución. Página48 rigura 2-9: 7. Una acidez aumentada significa que la concentración de H I aumenta y el p H disminuye. 8. La orina, el ácido estomacal y la saliva no forman parte del medio interno del cuerpo (véase el Cuadro].] en la página 4 ). Página SS fi!S\ura 2-13: (a ) La proteína es más activa a 30 ºC. (b) A una concentración proteica A, la velocidad es de l mg/s. Cuando la velocidad es de 2,5 mg/s, la concentración proteica es C. (e) Cuando la concentración de ligando es de 200 mg/c\L, la velocidad es de 4 mg/s.

@Respuestas a Ia prueba de rev1s1on .. , de qu1m1ca , . l. c, e 2. a, b, t~ h 3. a, b, d, g, h 4. protones y electrones; neutrones. Radiación. 5. carbono, oxígeno, nitrógeno e hidrógeno

6. P, K, Na, S, Ca, CI 7. (a) Zinc, (b) 20, (c) número atómico 53; masa atómica promedio =

Página 52 14. L"l molécula B es un mejor candidato, ya que su KJ menor significa que tiene una maror afinidad para unirse.

126,9. Jodo = l. 8. El Mg'· ha perdido dos electrones. 9. La pérdida del electrón del hidrógeno genera un protón. 10. (a ) 11, (b ) cero, (c) 12, (d ) catión, (e) + 1, (f) Na- , (g) neón, (h ) Ne

Página 56 15. (a ) 1, 4. (b ) 2, 3. (e) 4 (se puede ttni r en cualquier lugar) 16. A medida que la cantidad de proteína disminuye, la velocidad de reacción baja. 17. Si nna proteína ha akan7A"ldo la saturación, la velocidad se encuentra en su máximo valor.

l l. (a ) C6H " 0 6 (glucosa); p. 111 . 180, (b ) CO,; p. m. 44, (c) leuc.ina, C6H 13NO,; p.m. 131, (d) CJH 7 NO, (alanina); p.m. 89 12. (a ) 1, {b ) 5, (c) 4, (d ) 2, (e) 3

oRespuestas a las preguntas de las figuras Página 44 Figura 2-7: 1. Una solución se compone de un soluto y tm solvente. 2. (d ) 3. 18 mna = 18 Da 4. 74,5 g

13. Los ácidos grasos insaturados tienen enlaces dobles entre carbonos.

14. 15. 16.

17.

18. 19.

Página 45

Figura 2-7; 5. Una solución 0,1 Mes igual a una solución 100 mM , lo que significa que las concentraciones son iguales.

20.

Cada enlace doble elimina dos hidrógenos de la molécula, por lo tanto, (c} C ,6H.,,,O, es el más insaturado, ya que tiene la menor cantidad de hidrógenos. (a) 4, (b ) S, ( c) 1, (d ) 2, { e) 3 (a ) 3, {b ) 1, (c) 5, (d ) 2, (e) 4, 6 Las proteínas están compuestas por 20 aminoácidos diferentes que pueden estar unidos en distintas cantidades y en una variedad de secuencias casi infinita. amino, carboxilo (o viceversa) uno o más grupos fosfato, un azucar de 5 carbonos y una base. ADN: molécula de doble cadena con adenina, guanina, citosina y timina unidas en una hélice a; el az(1car es la desoxirribosa. ARN: molécu la de cadena simple con uracilo en lugar de timina más el azúcar ribosa. Las purinas tienen dos ani llos de carbono. Las pirimidinas tienen un anillo de carbono.

Compartimentación: células y tejidos Compartimentos funcionales del cuerpo

63 65

La luzde algunos órganos se comunica con el exterior Funcionalmente, el cuerpo tiene tres compartimentos de líquidos

Membranas biológicas

65 66 66 68

69

La membrana celular separa la célulade su entorno Las membranas están formadas principalmente por lípidosy proteínas Los lípidos de membrana forman una barrera hidrófoba Las proteínas de membrana pueden estar unidas laxa o estrechamente alamembrana Los hidratos de carbono de membrana se adhieren alos lípidos yalas proteínas

Compartimentos intracelulares

69 69 72 72 73 74 74 74 76

Las células están divididas en compartimentos El citoplasma incluye el citosol, las inclusiones, las fibras y los orgánulos Las inclusiones están en contacto directo con el citosol Las fibras proteicas citoplasmáticas se presentan en tres tamaños Los microtúbulos forman centríolos, cilios yflagelos El citoesqueleío es un andamiaje modificable Las proteínas motoras generan movimiento Los orgánulos forman compartimentos para funciones especializadas El núcleo es el centro de control de la célula

Tejidos corporales

78 78 80

85 89

La matriz extracelular cumple muchas funciones Las uniones celulares mantienen unidas las células para formar tejidos Los epitelios ofrecen protección yregulan eJ intercambio Los tejidos conectivos actúan como sostén ybarrera Los tejidos muscular ynervioso son excitables

Remodelación tisular

90 90

La apoptosis es unaforma ordenada de muerte celular Las células madre pueden crear células especializadas nuevas

Los órganos 91 La piel

ué es un comparLimento? Podemos pensar en algo totalmente cerrado, como una habitación o una caja con tapa. Pero no todos los compartimentos son completamente cerrados; piense en los cubículos modulares que conforman las oficinas modernas. Y no todos los compartimentos funcionales tienen paredes; piense en la gran sala de recepción de un hotel, div idida en diferentes sectores median te la cuidadosa disposición de alfombras y muebles. El pr imer compartimento vivo probablemente haya sido una célula sencilla cuyo líquido intracelttlar se separó del medio externo por medio de una pared hecha de fosfolípidos y proLeínas: la mem brana celular. Las células son la unidad funcional básica de los organismos vivos, y una célula individual puede llevar a cabo todos los procesos vitales. A medida q ue las células evolucionaron, adquirieron compart imentos intracelulares separados del líquido intracelular por medio de membranas. Con el tiempo, grupos de organismos uniceluhtres comenzaron a cooperar y a especializar sus funciones,)' eventualmenLe dieron origen a los organismos mulLicelulares. A medida que estos organismos multicelulares evolucionaron y se volvieron más grandes y más complejos, sus cuerpos se dividieron en diversos comparLimentos funlionales. Los compartimentos representan para los organismos Lanto una ventaja como una desventaja. Son una ventaja debido a q ue sep,tran los procesos bioquímicos que podrían enLrar en conflicto; por ejemplo, la síntesis proteica se lleva a cabo en un compartimento subcelular mient ras la degradación proteica ocurre en oLro. Las barreras entre los compartimentos, ya sean dentro de la célula o dentro del cuerpo, perm iten a los contenidos de un compartimento diferenciarse de los conLenidos de los compartimentos adyacentes. Un

Q

ejemplo extremo es el compa rtimento intracelular llamado lisosoma, con un pH interno de 5 ( Fig. 2 -9). Este pH es tan ácido que, si el liso soma se rompe, puede dañar severamente o incluso malar la célula que lo contiene. La desventaja que presentan los compartimentos es q ue las barreras que los separan pueden d ificultar la transferencia de sustancias necesarios desde un compartimento hacia otro. Los organismos vivos superan este problema a través de mecanismos especializados que transportan sustancias específicas a través de las membranas. (Transporte de membrana es el tema del Ca pítulo 5.) En este capítulo exploraremos el tema de la compartimenLación, comenzando por los diversos compart imentos que subdividen al cuerpo humano, de.sde las cavidades co rporales hasta los comparlimentos subcelulares llamados orgánulos. Luego examinaremos cómo grupos de células con funciones similares se unen para formar los tejidos)' órganos del cuerpo. Continuando el tema de las in teracciones moleculares, también analizaremos cómo las diferen tes moléculas y fibras en células y tejidos dan origen a sus propiedades mecánicas: su forma, fuerza y flexibilidad y las conexiones que rmmlienen unidos los tejidos.

Compartimentos funcionales del cuerpo El cuerpo humano es un compartimento complejo separado del mundo exterior por capas de células. Anatómicamente, el cuerpo se divide en tres grandes cavidades: la cavidad craneal (a la cual nos referimos habitualmente como cránec>), la wvidad torácicn (también lla mada t6mx) y la cavidad abdamiuopelvia11a Fig. 3- la). Las cavidades están separadas por huesos y tej idos y recubiertas por membra11as

<•

t isu/ares.

La cavidad craneal ( t.Tanium, cráneo) contiene el cerebro, nuestro centro de control principal. La cavidad torácica está limitada hacia los costados y en su extremo superior por la columna y las costillas, mientras que el diafragma fonna el piso. El tórax contiene el corazón, envuelto en una membrana llamada pericardio (peri-, alrededor, + cardiwn, corazón), y los dos pulmones, envueltos por sus respectivas

Elpapanicolaou salva vidas El doctor Georg e Papanicolaou ha salvado las vidas de millones de mujeres al popularizar este método de detección temprana del cáncer de cuello uterino. En los últimos 50 años, las muertes por cáncer cervical han disminuido d rásticamente en países que utiliza n la prueba de Papanicolaou de forma rutinaria. Por el contrario, el cáncer cervical es una de las ca usas principales de muerte en las regiones donde este método no se aplica habitualmente, como África y Centroamérica. Si es detectado tempranamente, el cáncer de cuello uterino es uno de los tipos de cá ncer más tratable. Hoy, Jan Melton, que tuvo un resultado cito lógico anormal unos meses atrás, vuelve al consultorio de la doctora Baird, su médica de cabecera, para repetir e l estudio. los resultados pueden determinar si debe someterse al tratamiento para cáncer ce rvica l o no.

72

84

90

92

pleuras. El abdomen y la pelvis forman una cavidad continua, la cavidad abdo111inopelvi111111. El peritoneo recubre internamente el abdomen y rodea los ó rganos dentro de él (estómago, intestinos, hígado, páncreas, vesícula biliar y bazo). Los riñones se ubican fuera de la cavidad abdominal, entre el peritoneo y los músculos de la espalda, inmediatamente por encima de la cintura. La pelvis contiene los órganos reproductores, la vejiga y la porción termina l del colon.

la luz de algunos órganos se comunica con el exterior Los órganos huecos, como el corazón, los pulmones, los vasos sangtúneos y los inLesLinos, forman otro grupo de compartimentos den t ro del cuerpo. El interior de cua lquier órgano hueco se denomina luz {lumi11, ventana). La luz puede estar total o parcialmente llena de aire o líquido. Por ejemplo, la luz de los vasos sanguíneos está llena de sangre.

63

Niveles de organización: compartimentos corporales COMPARTIMENTOS CORPORALES

(b) FUNCIONALES: compartimentos de los líquidos corporales

(a) ANATÓMICOS: las cavidades corporales

L

1 POSTERIOR : ANTERIOR

~

r

El líquido extracelular (LEC) se encuentra fuera de las células.

t

Células (líquido intracelular, LIC)

~ El plasma El líquido intersticial sanguíneo es el líquido envuelve la extracelular mayoria de dentro de los las células. vasos sanguíneos.

)

Adipocito: 50-150 µm

óvulo: 100µm

Glóbulo rojo: 7,5µm

-

+- Cavidad

abdominal

1

__(-}+-- Cavidad

Cavidad abdominopelviana

pelviana

Glóbulo blanco: 15 µm Célula de músculo liso: 15-200 µm de largo

i

1 1

Las células se subdividen en compartimentos intracelulares (véase la Fig. 3-4).

• (c) Los compartimentos están separados por membranas

Membrana pericárdica

El pericardio es un tej ido que envuelve al corazón.

Las membranas tisulares tienen muchas células.

Tej ido conectivo laxo Aumentado, el pericardio se ve como una capa de células planas sostenidas por tejido conectivo.

Las bicapas fosfolipídicas forman las membranas celulares.

Cada célula del pericardio tiene una membrana celular que la envuelve.

La membrana celular es una bicapa fosfolipidica.

Membranas biológicas

Para algunos órganos, la luz es, en esencia, una prolongación del medio exterior, y las sustancias dentro de el la no forman parle realmente del medio interno a menos que atraviesen la pared del órgano. Por ejemplo, creemos que nuestro Lraclo digestivo está "dentro" de nuestro cuerpo, pero, en realidad, su luz forma parte del medio externo (véase el Cuadca )-)). Como analogía, considere el oriíicio de una cuenca de un collar. El orificio atrav iesa la cuenta, pero no se encuentra dentro de elht. Una forma interesante de ilustrar esta distinción entre los medios interno)' externo de la luz es mediante la bacteria Escherichia coli. Este organismo vive y se reproduce normalmente dentro del colon, un compartim ento internali zado cuya luz se continúa con el medio exterior. Cuando la E. coli reside en este lugar, no daña a su hospedero. Sin embargo, si la pared intestinal es perforada a causa de una enfermedad o de un accidente, la E. coli ingresa al medio interno, lo que puede resultar en una grave infección.

Funcionalmente, el cuerpo tiene tres compartimentos de líquidos En fisiología, habitualmente estamos más interesados en los compartimentos funlionales que en los anatómicos. La mayoría de las cél ulas del cuerpo no están en contacto directo con el mundo exterior. En su lugar, su medio externo es el líquido extracelular if lg. 1-3). Si pensamos en todas las células del cuerpo como una unidad, podemos dividi r al cuerpo en dos compartimentos principales de líqu idos: ( 1) el líquido e.xrrncelular (LEC) fuera de las células y (2) el líquido intracelular ( LIC) dentro de ellas ( Fig. 3- lb). El líquido extracelular se subdivide en el plasma, la parle líquida de la sangre, y el líqLúdo intersticial (imer-, entre, + stare, estar), que envuelve a la mayoría de las cél ulas del cuerpo. La pared d ivisoria entre el LEC y el LIC es la membrana celular.

Membranas biológicas

membrana se describía como un tejido que recubría una cavidad o separaba dos compartimentos. Incluso bO)' en día hablamos de membranas mucosas en la boca y en la vagina, la membra11a pl7itoueal que reviste el interior del abdomen, la membrana pleural que recubre las superficies pulmonares y la membrana pericárdica que rodea al corazón. Estas membranas visibles son tejidos: rapas finas y translúcidas de células. Cuando los científicos pudieron ver las células a través de un m icroscopio, la naturaleza de la barrera entre el líquido intracelular y el medio externo se convirtió en un tema de gran interés. Hacia el año 1890, los científicos habían concluido que la superficie externa de las células, la membrana celular, era una fina capa de lípidos que separaba los lfquidos acuosos de los ambientes interno y externo. Ahora sabemos que las membranas cel ulares consisten en microscópicas capas dobles (biaipas) de fosfolípidos con moléculas proteicas insertas en ellas. Por lo tanto, la palabra membrana puede aplicarse tanto a un tejido como a una capa diviso ria fosfolipídica-pro teica ( Fig. 3- lc). Para mayor confusión, las membranas tisulares son frecuentemente representadas en las ilustraciones de los libros como una sola línea, lo que induce a los estudiantes a pensar que tienen una estructma sim i· lar a la membrana celular. En esta sección, usted aprenderá más sobre estas membranas fosfolipídicas que crean compartimen tos en las células.

la membrana celular separa la célula de su entorno Existen dos fo rmas sinón imas para nombrar la membrana celular. membrana plasmática y plasmalema. En este libro utilizaremos la forma membrana celular, en lugar de membm.11a plasmática o plasmalema, para evitar cualquier confusión con el plasma sanguíneo. Las funciones generales de la membrana celular inclu)•en: 1

La palabra membrana (membra11r1, piel) tiene dos significados en biología. Antes de la invención del microscopio, en el siglo dieciséis, una

1

3 El cá nce r es una condición en la cual un peq ueño grupo de células comienza a dividirse de manera incontrolable y no pued e diferenciarse e n cél ulas especializadas. Las cél ulas ca ncerosas que se origi nan en un tejido pueden escaparse de él y disemin arse hacia otros órganos a través del aparato circu latorio y de los vasos linfáticos, un proceso denominado metástasis. P1 : ¿Por qué el tratamiento contra el cáncer se concentra en

matar las células cance rosas?

63 . 72

84

90

92

65

4

Aislamiento físico. La membrana celular es una barrera fisica que separa el Líquido intracel ular dentro de la célula del liquido extracelular del medio extracelular. Regulación del intercambio con el entorno. La membrana celular controla el ingreso de iones y de nutrientes a la célula, la eliminación de los desechos celulares)' la liberación de productos desde la célula. Comunicación entre la célula y su entorno. La membrana celular cont iene proteinas que permiten a la célula reconocer y responder a las moléculas o a los cambios en su entorno. Cualq uier alleración en la membrana celular p uede afectar las actividades de la célula. Sostén estructural Las proteínas de la membrana celular man tienen en su lugar el citoesqueleto, el andamiaje estructural interno de la célula, para conservar la forma celular. Las proteínas de membrana también forman uniones especializadas entre cél ulas adyacen tes o entre las células y la matriz extracelular (extra, afuera), que es el material extracelular sintetizado y secretado por las células. (Secreción es el proceso por el cual una célula libera una sustancia hacia el espacio extracelular.) las uniones célul a-célula y célul a- matriz estabilizan las estructuras de los tejidos.

66

Capítu lo 3 Compartimentación: células y tejidos

¿Cómo puede la membrana celular llevar a cabo funciones Lan diversas? La respuesLa se encuenLra en nuestro modelo act ual de la estructma de la membrana celular.

Las membranas están formadas principalmente por lípidos y proteínas DLirante las primeras décadas del siglo veinle, los investigadores que inten Laban descifrar la estructLtra de la membrana celula r fragmentaron células y anal izaron su composición. Descubr ieron que todas las membranas biológicas consisten en una comb inación de lípidos y proteínas más una pequeña cantidad de h idraLos de carbono. Sin embargo, una esLruCtLLra única y uniforme no podía explicar la gran va riedad de propiedades de las membranas halladas en diferentes tipos de células. ¿Cómo podía el agua aLravesar la membrana celular de un glóbulo rojo y, al mismo tiempo, no se r capaz de atravesa r la membrana de ciertas células de los túbulos renales? La explicac ión debía encontrarse en la disposición molecular de las proteínas y los lípidos de las diversas membranas celulares. La proporción entre proteínas y lípidos varía ampliamen Le, dependiendo del origen de la membrana (• Cuadro 3- 1). Generalmente, cuanto más acLiva es una membrana desde el pmlto de vista meLabólico, mayor cantidad de p roteínas con Liene. Por ejemplo, Lres cuartas partes de la membrana interna de tma milocondria, que contiene enzimas para la producción de ATP, son proLeínas. Este anál isis qu ímico de las membranas resultó úti l pero no expl icaba la disposición estructura l de los lípidos y las p roteínas en una membrana. Est udios reali zados en la década de 1920 sug irieron que había suficiente can Lidad de líp idos en una determi nada á rea de membrana para c rear una doble capa. El modelo de b icapa fue modificado en la década de 1930 pa ra poder expli ca r la p resenc ia de las proteínas. Con la aparición del m icroscopio electrónico, los c ientíficos pudieron ver la membrana celu lar por primera vez. El modelo de la década de 1960, de acuerdo con lo observado mediante la microscopía electrónica, era el de un "emparedado de mantequilla": una chtra capa de líp idos entre dos capas oscuras de pro teína. En los pr imeros años de la dfrada de 1970, la técnica de microfotografía electrón ica por criofracLura reveló la verdadera d isposición tridimens ional de líp idos y pro teínas en las membranas celulares. l3asándose en lo que los cie ntíficos habían ap rend ido observando las membranas criofractmadas, en 1972 S. J. Singer y G . L. Nicholson propusieron el modelo d el mosaico fluido de la membra-

na. La • Figura 3- 2 destaca las características principales de este modelo contemporáneo de la estructura de la membrana. Los fosfolipidos de las membranas biológicas están d ispuestos mayorita riamente en una bicapa, de Lal forma que las cabezas de fosfato se ub ican en la superficie de la membrana )' las colas lipíd icas se encuenLran escondidas en el centro de la membrana ( Fig. 3-?b). La membrana celular est,\ tachonada de moléculas proteicas, como uvas pasas en una rebanada de b udín, y la superficie extracel ular tiene glucoproteínas y gl ucolípidos. Todas las membranas celula res tienen un espesor relativamente uniforme de aproximadamen te 8 nm.

Los lípidos de membrana forman una barrera hidrófoba Tres Lipos principales de lípidos conforman la membrana celular: los fosfolípidos, los esfingolípidos y el colesterol. Los fosfolípidos están compuestos por un esqueleto de glicerol con dos cadenas de ,leidos grasos que se extienden hacia un extremo y un grupo fosfato que se ext iende hacia el otro extremo. La "cabeza" de glicerol-fosfato de la molécula es polar y, por lo tanto, hidrófila. La "cola" de ácidos grasos es no polar y, por lo tan to, hidrófoba. Cuando son colocados en una solució n acuosa, los fosfolípidos se orientan de tal forma que las cabezas polares de las moléculas interactúan rnn las moléculas de agua, mientras que las colas no polares de ácidos grasos se "ocultan" interpon iendo las cabezas polares entre ellas y el agua. Esla disposición se puede observar en tres estructuras: las miceJas, los liposomas )' las b icapas fosfol ipídicas de la membrana celular (Fig. 3-2a). Las micelas son pequeñas golas con una sola capa de fosfolíp idos dispuestos de tal forma que el in terior de la micela está formado por las colas h idrófobas de los ácidos grasos. Las micelas son importan tes para la digeslión y la absorción de las grasas en el trae.Lo d igestivo. Los liposomas son grandes esLruCtLLras esfér icas cuyas paredes están formadas por bicapas fosfolipídicas. Esta disposición crea un cenlro hueco con un núcleo acuoso q ue puede ser llenado con moléculas h idrosolubles. Los biólogos piensan que una estructura similar a Llll liposoma fue la precursora de la primera célula viva. Hoy en d ía, los liposomas son uLilizados como medio de administración de fármacos y cosméticos a través de la p iel. Los fosfolípidos son el principal tipo de lípidos de las membranas, pero alg unas membranas tienen también can tidades signiricativas de esfingolípidos. Los esfingolípidos también tienen colas de ácidos grasos, pero sus cabezas pueden estar formadas por fosfolípidos o glucolípidos. Los esfingolípidos son ligeramen te más largos que los fosfolípidos.

Composición de algunas ventanas

• Proteínas

Lípidos

Hidratos de carbono

Me mbrana del glóbu lo rojo

49%

43%

8%

Me m bran a de mielina alred edor d e las célu la s ne rvio sas

18%

79%

3%

Me mbrana mitocondrial inte rn a

76%

24%

0%

Membrana

a

FIGURA3-2 FUNDAMENTOS

La membrana celular (a) Fosfolípidos de membrana

Los fosfolípidos de membrana forman bicapas, micelas y liposomas. Todas estas estructuras se disponen de tal forma que las colas no polares no están en contacto con las soluciones acuosas. como el líquido extracelular.

Cabeza polar (hidrófila) Modelo estilizado

Cola no polar de ácidos grasos (hidrófoba) 1

se pued en disponer como La bicapa lipídica forma una lámina.

1 •

1

Las micelas son gotas de fosfolípidos. Son importantes para la d igestión de los lípidos.

. .. -

1

1

!

Los liposomas tiene en un centro acuoso.

-· -

Las proteínas periféricas pueden ser eliminadas sin alterar la integridad de la membrana.

Las proteínas transmembrana atraviesan la bicapa lipídica.

Esta proteína integral de membrana atraviesa la membrana siete veces.

Hidrato de-

Liquido extracelular

Las cabezas fosfolipídicas están en cont act o con los compartimentos acuosos intra y extracelulares.

Las colas lipídicas forman la capa interna de la membrana.

periférica Proteínas del citoesqueleto Membrana celular

Las moléculas d e colesterol se introducen dentro de la capa lipídica.

Líquido intracelular

~ .,,_- Bucle citoplasmático

(c) Mapa conceptual sobre los componentes de la membrana celular

l

Membrana celular] 1

compuesta por 'f

Fosfolípidos, esfíngolípidos

Colesterol

forman

t Bicapa lipídica 1

funciona como

forman

forman

t

t

Glucolípidos 1

Glucoproteínas

:::::1 c uyas funcidnes incluyen

t

Barrera selectiva entre el citosol y el medio externo

Proteínas

Hidratos de carbono

Estabilidad estructural

Reconocimiento celular Respuesta inmunológica

68

Capítulo 3 Compartimentación: células y tejidos

Liposomas para salud y belleza Muchas personas escuchan por primera vez el término liposoma en relación con cremas cosméticas que prometen admi nistrar ciertas sustancias a las células que las necesitan. Sin embargo, ese no es el único uso para estas pequeñas estructuras. Los producto· res de cosméticos simplemente han adoptado una técnica médi· ca desarrollada para mejorar la administración de medicamentos. En medicina, los núcleos de liposomas se llena n con medicamen· tos o con fragmentos de ADN para terapia génica. Luego, los lipo· somas se aplica n sobre la piel o se inyectan en el torrente sangui· neo. Para que la administración del fármaco sea más específica, hoy en día los investigadores pueden crear inmunolipasomas, los cuales utilizan anticuerpos para reconocer tipos específicos de células cancerosas. Al dirigir los medicamentos hacia las células en tratamiento, los investigadores esperan aumentar la efectivi· dad de los medicamentos y disminuir los efectos adversos. Para aprender más sobre este tema, busque en Goog le liposomas como vía de administración de fármacos o inmunoliposomas.

El colesterol también es una parle imponanLe de muchas mem branas celulares. Las moléculas de colesterol, que son principalmente hidrófobas, se inLroducen entre las cabezas hidrófilas de los fosfolípidos ( Fig. 3-2b). El colesterol ayuda a las membranas a impermeabiliLarse contra peq ueñas moléculas hidrosolubles y las mantiene flexi bles en una amplia gama de temperaturas.

hacia el líquido extracelular. Los hidratos de carbono pueden adherirse a los bucles extracelulares y los grupos íosfato pueden Lmirse a los bucles intracelulares. La rosforilación de proteínas es un m~lOdo regulador que ut ilizan las células para modificar la función proteica. Las proteínas de membrana se clasifican en familias de acuerdo con la cantidad de segmentos transmembrana que posean. Muchas proteínas de membrana de importancia fisiológica tienen siete segmentos Lransmembrana, como se muestra en la Figura 3- 2c; otras atrav iesan la membrana solo una vez, y otras, hasta l 2 veces. Las proteínas transmembrana están estrechamente unidas a la membrana, pero no de forma covale nte. Los 20-25 aminoácidos que conforman los segmentos proteicos q L1e atraviesan la bicapa son no polares. Esto permite a dichos aminoácidos formar fuertes interacciones no covalentes con las colas lipídicas de los fosíolípidos de membrana, lo que los mantiene firmemente en su lugar. Hoy en día se sabe que algunas proteínas de membrana que antes eran consideradas proteínas periféricas son, en realidad, proteínas andadas a Lípidos ( Fig. 3-2b). Algunas de estas proleínas están covalentemente unidas a colas lipídicas que se introducen en la bicapa. Otras, que solo se encuentran en la superficie celular externa, son mantenidas en su posición median Le un anclaje GPI, que consisle en un líp ido de membrana más una cadena de azúcar-fosfato. (GPI significa glucosilfosfatidili11ositol.) Muchas proteínas ancladas a lípidos se encuenlran asociadas a esfíngolípidos de membrana, lo que lleva a la formación de parches de membrana especializados llamados balsas lipídicas <• Eig 3-1 ). Las colas más largas de los esfingolípidos elevan las balsas lipídicas por encima de los fosfolípidos adyacentes.

Lasproteínas de membrana pueden estar unidas laxa o estrechamente a la membrana Según algunas estimaciones, las proteinas de membrana podrían corresponder a un tercio de todas las proteinas codificadas en nuestro ADN. Cada célula tiene entre I O y 50 tipos diferentes de proteinas insenas en sus membranas. las proteínas de membrana pueden ser descriLas de muchas formas diferentes. las proteínas integrales de membrana se encuentran estrechamente adheridas a la membrana )' la única manera en que pueden ser eliminadas es alterando la estructura de la membrana con detergentes u otros métodos destinados a destruir su integridad. Las proleínas integrales de membrana incluyen las proteínas transmembrana y las proteínas ancladas a lípidos. las proteínas periféricas (periphería, circLmferencia) se encuentran adher idas a otras proteínas de membrana mediante interacciones no covalentes y pueden ser separadas de la membrana mediante métodos químicos sin alterar su inLegridad. Las proteínas periféricas incluyen enzimas y algunas proteínas estructurales de unión que anclan el citoesqueleto (el "esqueleLo" interno de la cél ula) a la mem brana (Fif!. 3-?b ). las proteínas transmembrana (tra11s-, a Lravé.s de) Lambién son llamadas proteínas atravesadoras de membra11a porque sus cadenas proteicas se extienden a través de Lodo el espesor de la membrana celular (Fiu. 3-2c}. Cuando una proteína atraviesa la membrana más de una vez, bucles de la rndena de aminoácidos sobresalen hacia el ciloplasma y

• FIGURA 3-3 Las balsas lipídicas están hechas de esfingo/ípidos. Los esfingolípídos (de color na ranja) son más largos que los fosfolípi· dos y se elev an por encima de los fosfolipidos de membrana (de color negro). Una enzim a anclada a lípidos, la fosfatasa alcalina placentaria (de color amarillo), está asociada casi siempre a una balsa lipídica. Imagen cortesía de D. E. Saslow sky, J. lawrence, X. Ren, D. A. Brown, R.M. Henderson y J. M. Edw ardson . la fosfatasa alca lina placentaria es atraída eficientemente hacia las balsas en las bicapas lipídicas. J. Biol. Chem . 277: 26966-26970, 2002.

Compartimentos intracelulares De acuerdo con el modelo del mosaico fl uido o rigi nal de la

membrana celular, las proteínas de membrana podrían move rse laLeralmenle de un lugar a otro, d irigidas por fibras proteicas que corren por debajo de la superficie de la membrana. Sin embargo, los invest igadores han descub ierto que esLo no es cierlO para wdas las proteínas de membra na. Algunas p roteínas in tegrales está n andadas a las p ro teínas del c itoesque leto (Fig. 3-2b) y, por lo ta nto, son inmóvi les. La capacidad del citoesqueleto para restri ngi r el movimienLo de las proteínas integrales de membrana permite a las células tener polaridad, mediante la cual diferentes áreas celulares tienen diferentes pro teínas y, por lo tanto, dife rentes prop iedades. Esto es particularmente importante en las células q ue fo rman los epitelios de transporte, como usted pod rá observar en mú ltiples tej idos del cuerpo.

Los hidratos de carbono de membrana se adhieren a los lípidos ya las proteínas La mayoría de los h idratos de carbono de membrana son azúcares adher idos a las p roteínas de membrana ( glucoproteínas) o a los Jipidos de membrana (glucolíp idos). Se encuen tran exclusivame nte sobre la superficie externa de la célula, donde forman una capa protectora denominada glucocáliz (glyco-, duke, + kalyx, cáscara o vaina). Las glucop roteínas de la superficie celular Lienen un papel clave en la respuesta inm une del cuerpo. Por ejemplo, los grupos sanguíneos Al30 están determinados po r el número y la composición de los azúcares adher idos a los esfingolípidos de membrana. La Figura 3-2c es un mapa que resume la organ ización de la estructura de la membrana celular.

Revisión

1. Nombre tres tipos de Upidos que se encuentran las membranas celulaies. 2. Describa tres tipos de proteínas de membranay cómose relacionan con la membrana celular. 3. ¿Por qué los fosforipidos de las membranas celulares formanuna bicapa en lugar deformar

unacapa simple? 4. ¿Cuántas bicapas fosfolipidicas debe atravesar una sustancia que ingresa a una célula?

Compartimentos intracelulares Mucho de lo que conocemos sobre las células prov iene del estudio de organismos unicelulares simples, pero los seres humanos so n mucho más complejos, con trillones de cél ulas en sus cuerpos. Se ha estimado que hay más de 200 tipos diferentes de células en el cuerpo h umano, cada tipo cel ular con sus propias características eslruL'turales y funcionales. Durante el desa rrollo, las células se especializan y adquieren formas )' func iones específicas. Todas las células del cuerpo heredan la misma informac ión genética en su ADN, pero ninguna utiliza toda esta información . Durante la diferenciación, solo los genes seleccionados se acti van )' transforman la célula en una unidad especial izada. En la mayoría de los casos, la forma y el tamaño final de una cél ula y

69

sus contenidos re!lejan su función. La Figura 3- lb muestra algunas de las diferen tes cél ulas del cuerpo humano. Aunque estas células maduras se ven muy d istintas entre sí, todas eran iguales en su com ienzo, en el embrión, y conservan muchas características en común.

Las células están divididas en compartimentos La organización estructural de una cél ula se puede comparar con la

de una ciudad amurallada medieval. La ci udad se encuentra separada de los campos que la rodean po r medio de una al ta muralla, y tan to el ingreso como el egreso está n estrictamente controlados por p uertas que pueden se r ab iertas o cerradas. En SL1 inte rior, la ci udad se divide en calles y diversos conjuntos de e.asas)' locales comerciales con variadas funciones. Den tro de la ciudad, un gobernante, que habi ta en el castillo, supervisa las idas y ven idas cotidianas de los ciudadanos. Debido a que la ci udad depende de la comida y de los materiales que se encuentra n fuera de las murallas, el gobernante negocia con los granjeros que viven en el campo. Los invasores extranjeros son sie mpre una amenaza, por lo que el gobernante se comun ica y coopera con los gobernantes de las ciudades vecinas. En la célula, el lím ite externo es la membnu1a celular. Al igual que la muralla de la ciudad, con trola la circulac ión de s ustancias entre el interior y el ex terio r celula r abriendo )' cerrando "puertas" hechas de pro teína. El interior celular se divide en compartimentos en lugar de casas y loca.les comerciales. Cada uno de estos compartimentos tiene un propósito específico que con tribuye a la función de la célula como un todo. En la célula, el ADN del núcleo es el "gobernante en el e.astillo'; que controla ta nto el funcionamiento interno de la cél ula como sus interacciones co n otras células. Al igual que la ciudad, la célula depende del abastecimien to proveniente de su a mb iente externo. Además, debe comun icarse y cooperar con otras células para mantener el fu nc ionam iento del cuerpo de forma coordinada. La • Figwa 3-4a ~s LU1a representación general de la estructura celular. Las cél ulas del cue rpo están rodeadas por el líquido extracelular, una sol ució n diluida de agua y sal. La membrana celula r separa el amb ien te in terno de la célula tel líquido intracelular) del líquido extracelular. lnternamen te, la cél ula se divide en citopltwna )' núcleo.El citoplasma consta de una parte líqLúda llamada citosol, partículas insolubles llamadas inclusiones, fibras proteicas insolub les y estructuras u nidas a la membra na conocidas en su conjun to como orgánulos. La Figura 3-4 muestra una célula epitelial típica del intest ino delgado, la cual posee la mayo rí,1 de las estructuras halladas en las células an imales.

El citoplasma incluye el citosol, las inclusiones, las fibras ylos orgánulos El citoplasma incluye todo el material dentro de la membrana celular exceptuando el núcleo. El citoplasma tiene cuatro componen tes: Citosol (cyto• , célula, + sol[ uble]) o líquido intracelular: el cito sol es Lll1 !luido semigelatinoso separado del líquido extracelular por la membrana cel ular. El citosol con tiene tliversas sustancias disueltas: nutrientes, proteínas, iones y p roductos de desecho.

Estructura celular (a) Esta es una representación general de la estructura celular. La membrana celular separa el ambiente interno de la célula (el líquido intracelular) del líquido extracelular. Internamente, la célula se divide en citoplasma y núcleo. El citoplasma consta de una parte líquida llamada citosol, estructuras unidas a la membrana llamadas orgánulos, partículas insolubles llamadas inclusiones y fibras proteicas que forman el citoesqueleto.

(b) Citoesqueleto

Las microvellosidades aumentan ~ ~l j¡.....:;~- -,el área superficial. Están sostenidas por microfilamentos. Los microfilamentos forman una red 11------::~=~dentro de la célu la, por debajo de la membrana celular. ~~,__Los microtúbulos son el tipo de fibra más grande del citoesqueleto. Los filamentos intermedios incluyen

LA CÉLULA

C<é..--·l-'!r_Jr.-<"°T-,lamiOSina Y la queratina.

está comiuesta por

t Membrana celular

-, Citoplasma

Núcleo

¡

1

¡

Citosol Orgánulos con membrana

¡

l

Inclusiones

Fibras proteicas

,

O \.... o o

..•. o o

o

t Mitocond ria t Gotas lipídicas t Citoesqueleto t Ret1culo endo- t Gránulos de t. Centriolos plasmático

t Aparato de

glucógeno

t Ribosomas

t. Cilios t. Flagelos

Golgi t Lísosomas t Peroxisomas

Uquido extracelular

(c) Peroxisomas

Los peroxisomas contienen enzimas que degradan ácidos grasos y materiales que provienen del exterior.

(d) Lisosomas

(e) Centríolos

Los lisosomas son pequeñas vesícu las de almacenamiento que contienen poderosas enzimas digestivas.

Los centríolos se forman a partir de microtúbulos y del movimiento del ADN durante la división celular. Centríolos

(f) Membrana celular La membrana celular es una bicapa fosfolipid ica tachonada de proteínas que actúan como anclas estructurales, transportadores, enzimas o receptores de señal. Los glucolipidos y las glucoproteinas se encuentran solo sobre la superficie extracelular de la membrana. La membrana celular actúa como una compuerta y como una barrera entre el citoplasma y el liquido extracelular.

(g) Mitocondria .,..;;;:i;----

Membrana externa Las mitocondrias son orgánulos entre esféricos y elípticos con una doble membrana que Espacio intermembrana forma dos compartimentos separados dentro del orgánulo. La matriz interna está rodeada por una membrana que se p liega formando crestas. El espacio intermembrana, que se Crestas encuentra entre las dos membranas, cumple un rol importante en la producción de ATP. Las mitocondrias son el principal lugar de síntesis de ATP en la célula. Matriz

(h) Aparato de Golgi

o

Vesículas ~ ..:,,...- Cisternas

El aparato de Golgi consiste en una serie de sacos curvados y huecos llamados cisternas, apilados uno encima de otro y rodeados de vesículas. El aparato de Golgi participa en la modificación de las proteínas y su empaquetamiento.

(i) Retículo endoplasmático (RE) ' - - - RE rugoso

El retículo endoplasmático (RE) es una red de túbulos membranosos interconectados que son una continuación de la membrana nuclear externa. El retículo endoplasmático rugoso tiene una apariencia granular debido a los ríbosomas adheridos a su superficie citoplasmática. El retículo endoplasmátíco liso no tiene ribosomas y se ve como túbulos membranosos lisos. El RE rugoso es el principal lugar de síntesis proteica. El RE liso sintetiza lipidos y, en algunas células, concentra y almacena iones de calcio.

RE liso

(11 Núcleo Envoltura nuclear

Nucléolo

Poros nucleares

El núcl eo está rodeado por una envoltura nucl ear formada por una doble membrana. Ambas membranas de la envoltura están perforadas por poros que permiten la comunicación con el citoplasma. La membrana externa de la envoltura nuclear se conecta con la membrana del retículo endoplasmático. En las células que no están en división, el núcleo aparece relleno de un material granular esparcido aleatoriamente, compuesto por ADN y proteínas. Habitualmente, el núcleo contiene entre uno y cuatro corpúsculos más grandes, formados por ADN , ARN y proteínas, que se ti ñen de negro y son llamados nucléolos.

72

Capítulo 3 Compartimentación: células y tejidos

Las inclusiones están en contacto directo con el citosol Al realizar una prueba de Papanicolaou para la detección del cáncer cervical, se toma una muestra de tejido del cérvix (cuello) del útero con un dispositivo similar a un pequeño cepi llo. Las células se colocan en un líquido conservante que luego se envía a un laboratorio. Allí, la muestra se procesa, se coloca e n un portaobjetos y es analizada prim ero por una computadora y, luego, por un citólogo e ntrenado. La computadora y el citó logo intentan detectar signos de displasia (dys-, anormal, + -p/asia, crecimiento o multiplicación celular), un cambio en e l tamaño y en la forma de las células que sugiera ca mbios cancerosos. Las células cancerosas, usualmente, se reconocen por un núcleo agrandado rodeado por una ca ntidad relativamente escasa de citoplasma. El primer papanicolaou de Jan mostró todas las características de la displasia. P2: ¿Qué es lo que ocurre en las células cancerosas que explique el gran tamaño de sus núcleos y la ca ntidad relativamente escasa de citoplasma?

63

2

65

84

90

92

las fibras proteicas citoplasmáticas se presentan en tres tamaños

Los otros componentes del citoplasma - inclusiones, fibras y org;in ulos- están suspendidos en el citosol. Las inclusiones son partículas de materiales insolubles. Algu nas son n utrien tes almacenados. Otras son responsables de funciones celulares especiíicas. A veces, estas estructu ras se denominan

orgánulos sin membrana. 3 4

Las incl usiones de las células no tienen membranas que las limi ten y, por lo tanto, están en contacto directo con el citosol; po r este motivo, el intercambio de sustancias entre las inclusiones y el citosol no requiere transporte a trav~s de una membrana. Los nutrien tes se almacenan como gránulos de glucógeno y gotas de lípidos. La ma)'0· ría de las inclusiones que tienen funciones distin tas al almacenam iento de nutrientes están hechas de proteína o combinaciones de ARN y proteína. Los ribosomas (Fig. 3-4i) son peque1ios gránulos densos de ARN y proteína que fabrican las proteínas sigu iendo las instrucciones del ADN celular (véase el Capítulo 4 para m;\s detalles). Los ribosomas ad heridos a la superíicie citosólica de los o rgánulos se llaman ribosomas fijos . Aquellos SLL~pendidos lfüremente en el citosol son ribosomas libres. Algunos ribosomas libres fo rm an grupos de I Oa 20 un idades, conocidos corno polirribosomas. Un ribosoma q ue está fijo puede liberarse y conve rt irse en uno libre rápidamente. Los ribosomas son muy numerosos en las cél ulas que sintetizan proteínas para exportar fuera de la célula.

Las fibras proteicas insolubles form an el sistema de sostén in terno de la célula o citoesqueleto. Los orgánulos - "pequeños órganos"- son compartimen tos limi tados po r membrana que cumplen roles específicos dentro del funcionamiento general de la célula. Po r ejemplo, los o rgánulos Uamados mitocondrias generan la mayor parte del ATP celular, y los o rgánulos llamados lisosomas actúan como el aparato d igestivo de la célula. Los orgánulos funcionan de forma integrada,)' cada uno de ellos se encarga de una o más funciones celulares.

Las tres fami lias de fibras proteicas citoplasmáticas se clasiíican según su diámetro y su composición prote ica Cuadro 3-2). Todas las fibras son polímeros de p roteínas más pequeñas. Las más delgadas son las fibras de actina, también llamadas microfilame11tos. Los filamentos intermedios son un poco más grandes y p ueden estar formados por di ferentes tipos de proteínas, incluyendo la querati11a, en el cabello y la p iel, y los 11euro[damen10s de las células nerviosas. Las fibras proteicas más grandes son los microtúbulos huecos, hechos de una proteína llamada tubulina. Un gran número de proteínas accesorias se asocia con las fibras proteicas celulares. Las íibras proteicas insolub les de la cél ula cumplen dos funciones generales: sopo rte estructural y movim ien to. El soporte estructural viene dado principalmente por el citoesqueleto. El movim iento de la célula o de los elementos dentro de ella tiene lugar con la ayuda de fibras proteicas y de un grupo de enzimas especializadas llamadas proteínas motoras. Estas funlio11es se describen en mayor detalle en las secciones siguientes.

<•

Diámetro de las fibras proteicas del citoplasma

Diámetro

Tipo de proteína

Fun ciones

Microfilamentos

7 nm

Actina (globular)

Citoesqueleto; se asocia con la miosina para la contracción mu scular

Filamentos intermedios

10 nm

Queratina, proteína de neurofilamentos (filamentos)

Citoesqueleto, cabello y uñas, barrera protectora de la p iel

Microtúbulos

25 nm

Tubu li na (globu lar)

Movimiento de cilios, flagelos y cromosomas; transporte intracelular de orgánulos; citoesqueleto

Compartimentos intracelulares

73

Los microtúbulos forman centríolos, cilios y flagelos Las fibras proteicas citoplasmáticas de mayor tamaño, los m icrotúbulos, crean las complejas estructuras de cen tríolos, cilios )' flagelos que están invol ucradas en cierto tipo de movimien to celular. El centro organizador de 111icroiúb11/os de la célula, el centrosoma, ensambla monómeros de tubulina para formar m icrntúbulos. El centrosoma se ve como una región teñida de color oscuro ubicada cerca del núcleo celula r. En la mayoría de las célu las an imales, el cenLrosoma contiene dos centríolos, como se muestra en la cél ula típica de la Figura 3-4e. Cada cenLríolo es un haz. cilíndr ico de 27 microtúbulos, dispuestos en nueve Lripletes. Durante la d ivisión celular, los centríolos dirigen el movim ien to de las cadenas de ADN. Las cél ulas que pierden su capacidad de d ividirse, e.orno las células nerviosas maduras, carecen de cenlríolos. Los cilios son estructuras corlas, similares a pelos, que se proyectan desde la superficie celular como las cerdas de un cep illo ( ciliwn, en latín, sign ifica 'pestaña'). La mayoría de las células tiene un único ci lio corlo, pero aquellas que recubren las vías aéreas superiores y parte del tracto reproductor femeni no est,\n cubiertas de cilios. En estos tejidos, el movimiento cilia r, de tipo ondulatorio, genera corrien tes que barren los líq uidos o las secreciones de la superficie celula r. La superficie de un cilio es una con tinuación de la membrana celula r. El núcleo de los ci lios móviles contiene nueve pares de micro túbulos que rodean un par central (• Fig. 3-Sb). Los microtúbulos final izan dentro de la célula en el cuerpo basal. Estos cilios se mueven rítmicamente hacia atrás y hacia adelan te cuando los pares de microtúbulos del núcleo se deslizan en tre sí con la ayuda de la proteína motora di11eí11a. Los flagelos tienen la rnisma disposición de microtúbulos que n Lmu.::amenu~ nac1a atras y nana aueJan te cuanuu 10::. pares ue m1cro túbulos del núcleo se deslizan en tre sí con la ayuda de la proteína motora di11eí11a. Los flagelos tienen la rnisma disposición de microtúbulos que los cilios, pero son considerablemente m,\s largos ( flagellum, en !aún, significa 'látigo'). Los ílagelos se encuentran en células que llotan libremen te; en los humanos, la única célula llagelada es el espennatozoide. Un espermatozoide tiene un único llagelo, en rnntraste con las

Los cilios sonsensores l os cilios del cuerpo no se limitan a las vías aéreas y al tracto reprod uctor femenino. Los científicos saben desde hace años que la mayoría de las células del cuerpo contiene un único cilio estacionario, o no móvil, pero creían que estos cilios primarios solita· rios eran principalmente un remanente evolutivo de poca importancia. Los cilios primarios difieren estructuralmente de los ci lios móviles, ya que ca recen del par central de microtúbulos que se encuentra en los cilios móviles (es decir, tiene n una disposición 9 + O en lugar de 9 + 2; véase la Fig. 3-5). Recientemente, investí· gadores descubrieron que los cilios pri marios sí cumplen una función: pueden actuar como sensores del medio externo aporta ndo información a la célula. Por ejemplo, los cilios primarios de los fotorreceptores del ojo ayuda n a detectar la luz, y los cilios primarios en el riñón miden el flujo de líquido. Ut ilizando técnicas moleculares, los científicos han descubierto que estos pequeños e insignifica ntes pelos cum plen roles muy im porta nte du rante el desarrollo embrionario. Las mutaciones de las proteínas ciliares ocasionan trastornos (ciliopatías) que van desde enfermedad del riñón poliqu ístico y pérdida de la visión hasta cáncer. El rol de los cilios primarios en estos trastornos, incl uyendo la obesidad, es actualmente un tema predomi nante en investigación.

células ci liadas, q ue pueden tener una superficie casi completamente cubierta de ci lios {Eig. 3-';a). Los movimientos ondu lato rios del lfage-

células ci liadas, q ue pueden tener una superficie casi completamente cubierta de ci lios {Eig. 3-';a). Los movimientos ondu lato rios del lfagelo emp ujan al espermatozoide a través del líquido, así como las con tracciones ondulantes de una serpiente le permiten moverse en su medio ambien te. Los flagelos se doblan y se mueven gracias al m ismo mecan ismo básico que los ci lios.

Movimiento del líquido

Flagelo Microtúbulos Movimiento del líquido Cil io Membrana celular Cilios (b) Los cilios y los flagelos tienen 9 pares (a) Cilios

de microtúbulos que rodean un par central.

• FIGURA 3-S Centrío/os, cilios y flagelos. Estas tres estructuras están formadas por microtúbulos.

(e) El movimiento de cilios y flagelos produce el movimiento del líquido.

El citoesqueleto es un andamiaje modificable El citoesq ueleto es un andamiaje tridimensional flexible y modificable hecho de microCilamentos de actina, filamentos intermedios y microtúbulos que se extienden por todo el citoplasma. Algunas fibras proteicas del ciroesqueleto son permanentes, pero la mayo ría son acopladas o desacopladas de acuerdo con las necesidades de la célula. Debido a la naturaleza modificable del citoesqueleto, sus detalles organizacionales son complejos y no serán analizados detalladamente. El ciwesqueleto cumple cinco funciones importantes. 1

2

3

4

5

Forma celular. El andamiaje proteico del citoesqueleto provee fuerza mecánica a la célula, y en algunas células cumple un rol importante en la determinación de la forma celular. La Figura 3-4b muestra cómo las fibras citoesqueléticas ayudan a sostener las microvellosidades ( micro• , pequeño, + villus, mechón de pelo ), extensiones parecidas a dedos de la membrana ce lular que aumentan el área superiicial para la absorción de sustancias. Organización interna. Las fibras citoesquelélicas estabilizan la posición de los orgánulos. La Figura 3-4b ilustra cómo los orgánulos son mantenidos en SLLS posiciones por el citoesqueleto. Nótese, sin embargo, que esta figura es so lo una fotografía de un momento en la vida de la célula. La disposición y la composición interior de una célula son dinámicas y cambian de min uto a mi nuto en respuesta a las necesidades de la célula, así como el in terior de la ciudad amurallada está en constante movimiento. Una desventaja de las ilustraciones estáticas de los libros de texto es que son incapaces de representar con exactitud el movimiento y la naturaleza dinám ica de muchos de los procesos fisiológicos. Transporte intracelular. El citoesqueleto ayuda a transportar sustancias hacia la célula y dentro del citoplasma, ya que actúa como una "vía de ferrocarril" para los orgánulos móvile,s. Esta función es particularmente importante en las células del sistema nervioso, en las cuales algunas sustancias deben ser transportadas por longitudes in tracel ul are,s de hasta un metro. Ensamble celular para formar tejidos. Las fibras proteicas del citoesqueleto se conectan con las fibras proteicas del espacio extracelular y unen las células entre sí y con el material a su al rededor. Además de proveer fuerza mednica al tej ido, estas un io nes permiten la transferencia de información de una célula a otra. Movimiento. El dtoesqueleto ayuda a las células a moverse. Por ejemplo, permite a los glóbulos blancos sanguineos comprim irse para poder salir de los vasos sanguíneos,)' a las células nerviosas en crecimiento, emitir largas prolongaciones a medida que se alargan. Los cilios y los llagelos de la membrana celular son capaces de moverse debido a su esqueleto de microtúbulos. Proteínas motoras especiales facilitan el movimiento )' el transporte intracelular utilizando energía del ATP para deslizarse a lo largo de las fib ras del citoesqueleto.

Estos tres grupos utilizan la energía almacenada en el ATP para propulsarse a lo htrgo de las iibras citoesqueléticas. Las miosinas se unen a fibras de actina y son mejor conocidas por su función en la contracción muscular ( véase en detalle en el Capítulo 12). Las cinesinas y las dineínas ayudan al mov imiento de vesículas a lo largo de los microtúbulos. Las clineínas también se asocian con los haces de microtúbulos de cil ios y flagelos para ayudar a generar su movim ien to ondulatorio. La maroría de las proteínas motoras están hechas de cadenas proteicas organizadas en tres partes: dos cabezas que se unen a la fibra citoesquelética, un cuello )' una cola que e,s capaz de unirse a su "carga"; por ejemplo, un orgánulo que necesita ser transportado a través del citoplasma l• Fig. 3-6). Las cabezas se unen alternadamente a la fibra citoesquelética, luego se sueltan y''dan un paso" hacia adelan te utilizando la energía almacenada en el ATP.

Revisión

S. Nombre los tres tipos de fibras proteicas citoplasmátim . 6. ¿Cómo afectaóa a un espermatozoide la ausencia de suflagelo?

7. ¿Cuál es la d~erencia entre citoplasma y citosol? 8, ¡Cuál es la diferencia entre un cilio y un flagelo?

9. ¿Cuál es la función de las proteinas motoras?

Los orgánulos forman compartimentos para funciones especializadas Los orgánulos son compartimentos subcelulares separados del citosol por una o más membranas fosfol ipídicas de estructura sim ilar a la

Orgánulo

Proteína motora ATP

Fibra citoesquelética

Las proteínas motoras generan movimiento

• FIGURA 3-6 Proteínas motoras. Las prote ínas motoras tienen

Las proteínas motoras son proteínas capaces de convertir la energía almacenada en movim iento dirigido. Tres grupos de proteínas motoras están asociados al citoesqueleto: miosinas, cinesinas y dineínas.

mú ltiples cadenas proteicas que forman dos cabezas, un cuello y una cola, la cua l puede unirse a orgánulos u otras cargas. Las cabezas "caminan• a lo largo de las fibras citoesqueléticas utilizando la e ne rgía del ATP.

Compartimentos intracelulares

membrana celular. Los compartimentos creados por los orgánulos permiten a la célula aislar sustancias y separar funciones; por ejemplo, un orgánulo podría contener sustancias potencialmente dañinas para la célula, como las enzimas digestivas. Las Figuras 3-4g, 3-4h y 3- 4i muestran los cuatro grupos principales de orgánulos: las mitocondrias, el aparato de Golgi, el retículo endoplasm¡hico y unas esferas unidas a la membrana llamadas vesículas ( vesicula, vejiga).

Mitocondrias Las mitocondrias (mitos, hilo,+ chondros, gránulo) son org¡\nulos singulares en muchos aspectos. Primeramente, tienen una doble pared que forma dos compartimenws separados dentro de la mitocondria (Fig. 3-4g). En el centro, dentro de la membrana interna, se encuentra el compartimento llamado matriz mitocondrial (matrix, útero). La matriz contiene enzimas, ribosomas, gránulos y, sorprendentemente, su propio ADN. Este ADN mitocondrial tiene una secuencia de nudeótidos diferente a la encontrada en el núcleo celular. Dado que las mitocondrias tienen su propio ADN, pueden fabricar algunas de sus propias proteínas. ¿Por qué las mitocondrias contienen ADN mie ntras que otros orgánulos no? Esta pregunta ha sido objeto de una profunda reílexión. Según la teorú1 del simbionte procari6tico, las mitocondrias son descendientes de bacterias q ue invadieron las células hace millones de años. Las bacterias desarrollaron una relación mutuamente beneficiosa con sus células hospederas )' rápidamente se convirtieron en una parte integral de ellas. la evidencia que apoya a esta teoría es el hecho de que el ADN, el ARN y las enzimas de nuestras mitocondrias son similares a los de las bacterias y diferentes a los del núcleo de nuestras propias células. El segundo compartimento dentro de una mitocondria es el espacio intermembrana, el cual se encuentra entre las membranas ;,Por qué las mitocondrias contienen ADN m ie ntras que otros orgán ulos no? Esta pregunta ha sido objeto de una profunda reílexión. Según la teorÜI del simbionte proetiri6tico, las mitocondrias son descendientes de bacterias que invadieron las células hace millones de años. Las bacterias desarrollaron una relación mutuamente beneficiosa con sus células hospederas y n\pidamente se convirtieron en una parte integral de ellas. La ev idencia que apoya a esta teoría es el hecho de que el ADN, el ARN y las enzimas de nuestras mitocondrias son similares a los de las bacterias y diferentes a los del núcleo de nuestras propias células. El segtmdo compartimento dentro de una mitocondria es el espacio intermembrana, el cual se encuentra en tre las membranas mitocondriales interna y externa. Este compartimento cump le una función importante en la producción mitocondrial de ATP, y el número de mitocondrias en una célula está directamente relacionado con las necesidades energéticas de la célula. Por ejemplo, las células de músculo esquelético, que utifüan mucha energía, tienen muchas m¡\s mitocondrias que las células menos activas, como los ad ipocitos (cé1u las de grasa). Otra característica inusual de las mitocondrias es su capacidad de repl icarse aun cuando la cél ula a la que pertenecen no se encuentra en división. Este proceso es ayudado por el ADN mitocond rial, que permite a los o rgánu los d irigir su propia duplicación. la replicaci(5n mitocondrial se lleva a cabo por bipanición, durante la cual las pequeñas mitocondrias hijas se separan de su "madre" más grande. Por ejemplo, las células musculares en ejercicjo que tienen requerimientos aumentados de energía en un período de tiempo pueden cubrir la demanda de más ATP incrementando el número de mitocondrias en su citoplasma. Retículo e11doplasnuitico El reúctdo endoplasmálico (RE) es una red interconectada de túbulos de membrana con tres funciones principales: síntesis, almacenamiento)' transpone de biomoléculas ( Fig. 3-4i). El nombre retículo proviene de la palabra que en latín significa red y hace referencia a la dispos ición de los túhulos, que se asemej,1 a la de una red. Las micrografías electrónicas revelan que hay dos tipos de retículo endoplasmático: el retículo endoplasmático rugoso (RER) y el reúculo endoplasmático liso ( REL) .

75

El retículo endoplasmático rugoso es el principal lugar de síntesis proteica. Las proteínas son ensamb ladas por los ribosomas adheridos a la superficie citoplasnu\lica del RER )', luego, son introducidas en s u luz, donde son sometidas a modificaciones quím icas. El retículo endoplas,m\tico liso carece de ribosomas adheridos y es el principal lugar para la síntesis de ácidos grasos, esteroides )' lípidos. Los fosfolípidos para la membrana cel ular son producidos aquí )' el colesterol es convertido en hormonas es teroideas, tales como las hormonas sexuales estrógeno y testosterona. El REL de células hepáticas y renales neutraliza o inactiva diversos f,lrmacos. En las células del músculo esquelético, un tipo modificado de REL almacena iones de calcio (Ca2· ) que son utilizados para la contracción muscular.

Aparato de Golgi El aparato de Golgi ( también llamado complejo de Golgi) fue descrito por primera vez por Camillo Golgi en 1898 ( Fig. 3-4h). Durante afies, algunos investigadores pensaron que este orgánulo era solo el resultado del proceso de fijación utilizado para preparar las muestras tisulares para su visualización al microscopio óptico. Sin embargo, gracias a los estudios con microscopía electrónica, hoy en día sabemos que el aparato de Golgi es, efectivamente, tm orgánulo que consiste en una serie de sacos curvos y huecos, llamados cisternas, apilados uno encima de otro y rodeados de vesículas. El aparaLO de Golgi recibe las proteínas sintetizadas en el RER, las modifica y las empaqueta dentro de vesículas. Vesículas citoplasmáticas Las vesículas citoplasmáticas unidas a membranas son de dos tipos: secretoras y de almacenam ien to. Las vesículas secretoras contienen proteínas que serán liberadas por la nulo era solo el resultado del proceso de lijación utilizado para prepantr las muestras tisulares para su visualización al microscopio óptico. Sin embargo, gracias a los estudios con microscopía electrónica, hoy en dia sabemos que el aparato de Golgi es, efectivamente, un orgánulo que consiste en una serie de sacos curvos y huecos, llamados cisternas, apilados uno encima de otro y rodeados de vesículas. El aparato de Golgi recibe las proteínas sintetizadas en el RER, las modifica y las empaqueta dentro de vesículas. Vesículas ciroplasmátiws Las vesículas dtoplasmáticas unidas a membranas son de dos tipos: secretoras y de almacenam iento. Las vesículas secretoras contienen proteínas que serán liberadas por la célula. Por otro lado, los contenidos de la mayoría de las vesículas de almacenamiento nunca abandonan el citoplasma. Los lisosomas (/ysis, disolución, + soma, cuerpo) son pequefias vesículas de almacenam iento que se ven como gn\nu los unidos a membranas en el c itoplasma ( Fig. 3-4d ). Los lisosomas actúan como el aparato digestivo de la célula y utilizan poderosas enzimas para descomponer bacterias u orgánulos viejos, como mitocondrias, en sus moléculas constitutivas. Aquellas moléculas que pueden ser reutilizadas son reabsorbidas hacia el citosol, mientras que las restantes son vertidas fuera de la célula. Se han identificado alrededor de 50 tipos de enzimas lisosomales en diferentes tipos ce lttlares. Debido a que las enzimas lisosomales son muy poderosas, los primeros investigadores se preguntaron por qué estas enzimas no destruyen la célula q ue las contiene. Los científicos descubrieron luego que las enzimas lisosomales solo se activan en condir.iones de acidez muy alta, LOO veces más ácidas que la acidez normal del citoplasma. Cuando los lisosomas sa len por primera vez del aparato de Golgi, su pH interior es aproximadamente el mismo que el del citosol, 7,0-7,3. Dichas enzimas son inactivas a este pH. Su inactividad actúa como un seguro: si el lisosoma se rompe o libera accidentalmente sus enzimas, estas no podrán dafiar la cél ula. Sin embargo, cuando el lisosoma se asienta en el citoplasma, acumula H + mediante un proceso que consume energía. Las concentraciones crecientes de H' disminuyen el pH dentro de la vesícula hasta 4,8-5,0, y las enzimas se activan. Una vez activas, las enzimas

lisosomales pueden degradar las b iomolécul as dentro de la vesícula. l a membrana lisosomal no resulta afectada por las enzimas. Las enzimas d igestivas de los lisosomas no siemp re se mantienen aisladas dentro del orgánulo. Ocasionalmente, los lisosomas liberan sus enzimas fuera de la célula para disolver el material enracelular de sostén, rnmo la porción dura del hueso formada po r carbonato de calcio. En otras instancias, las células permiten que sus enzimas lisosomale,s enlren en contacto con el citoplasma, lo que conduce a la aurodigestión de toda la célula o parle de ella. Cuando los músculos se atrofian (se encogen) debido a la falta de uso, o cuando el útero disminuye de tamaño tras el embarazo, la pérdida de masa celular se debe a la acción de los lisosomas. La liberación inaprop iada de enzimas lisosomales se ha relacionado con ciertas enfermedades, tales como la inílamación )' la destrucción del tej ido articula r en la artritis reumatoide. En los trastornos hereditarios conocidos como euferm.edades de depósito lisosomal, los lisosomas son inefect ivos deb ido a que carecen de sus enzimas específicas. Una de las enfermedades de depósito lisosomal mejor conocidas es el trastorno hereditario fatal llamado enfermedad de Tay-Sachs. Los niños con enfermedad de Tay-Sachs tienen lisosomas defectuosos incapaces de degradar los glucolípidos. La acumulación de glucolípidos en las cél ulas nerviosas ocasiona disfunción del sistema nervioso, incluyendo ceguera y pérd ida de la coordinación. La mayoría de los niños afectados po r la enfermedad de Tay-Sachs mueren durante los primeros años de su infancia. Los peroxisomas son vesículas de almacenamiento aun más pequeñas que los lisosomas ( Fig. 3-4c). Durante años se pensó que eran un tipo de lisosoma, pero ahora sabemos que co mienen un conjunto diferente de enzimas. Su principal función parece ser la degradación de ácidos grasos de cadena la rga y moléculas potencialmen re tóxicas. Los peroxisomas reciben su nombre del hecho de que las reacciones que ocurren en su inter ior producen peróxido de hidrógeno (H,0 2) , una molécula tóxica. l os peroxisomas conv ierten rápidamen te, utilizando la enzima cata/asa, este peróxido en oxígeno y agua. los trastornos de los perox isomas alteran el normal procesamiento de los lípidos y pueden aiectar severamen te la función neuronal al alterar la estructma de la membrana de las células nerviosas.

El núcleo es el centro de control de la célula El núcleo de la célula contiene ADN, el material genético que, en última instancia, conuola todos los procesos celulares. l a Figura 3-4j ilustra la estructura de un núcleo típico. Su con to rno, la envoltura nuclear, es una estructura de doble membrana que separa el núcleo del compartimento citoplasmálico. Ambas membranas de la envoltura están perforada, por orificios redondos o poros. La comunicación en tre el núcleo )' el ci tosol ocur re a través de los complejos del poro nuclear, grandes complejos proteicos con un canal central. Los iones y las mo léculas pequeñas atraviesan libremente este canal cuando está abierto, pero el transpo rte de grandes moléculas, tales como proteínas y ARN, es un proceso que req uiere energía. La especificidad del proceso de transporte perm ite a la cél ula restringir el ADN al núcleo y diversas enzimas al citoplasma o al núcleo. En micrografías electrónicas de células que no se encuentran en división, el núcleo se observa lleno de material granular diseminado aleatoriamen te, llamado cromatina, compuesto por ADN y proteínas asociadas. Habitualm,mte, el núcleo contiene entre uno y cuatro cuerpos más grandes que se tiñen de color oscuro, compuestos por ADN, ARN y proteínas, llamados nucléolos (11ucleo/us, pequeño núcleo). Los nucléolos con tienen los genes y las proteínas que controlan la síntes is del ARN de los ribosomas. El proceso de sintesis, modificación y empaquetam iento de pro teínas en diferentes partes de la célula es un excelente ejemplo de cómo la compartimentación permite la separación de funciones, como muestra la • Eigu ca 3-2 El ARN para la síntesis proteica es generado a partir de plantillas de ADN dentro del núcleo ©; luego, es transportado al citoplasma a través de los poros nucleares ~ - En el citoplasma, las proteínas son sin tetizadas por los ribosomas, que pueden ser inclusiones lib res @ o estar adheridos al retículo endoplasmático rugoso ©. La proteína recien temente creada es compartimentada en la luL del RER ®, donde es modificada an tes de ser empaquetada dentro de una vesícula ® . Las vesículas se fusionan con el aparato de Golgi, lo que permite modificaciones adicio nales a la proteína en la luz de este o rgánulo (J). Las prolelnas modificadas abandonan el aparato de Golgi empaquetadas en vesículas de almacenamiento ® o en vesículas secretoras, cuyos contenidos serán liberados hacia el líquido extracelular ®l. Los detalles moleculares de la síntesis proteica son analizados en otra parte ( véase el Ca p1tulo 4).

Revisión

10. ¿Qué es lo que diferencia los orgánulos de las indtJSiones?

Tejidos corporales

11. ¿Cuál es la diferencia anatómica entre el retírulo endoplasmático rugoso yel retículo endoplasmático liso? ¡Cuál es ladiferencia funcioMI?

A pesar de la asombrosa variedad de estructuras intracelulares, nin guna célula puede llevar a cabo por sí sola todos los procesos del cuerpo humano maduro. En lugar de eso, las células se agrupan para formar un idades más grandes, llamadas tejidos. Las células de los tej idos se mantienen un idas mediante conexiones especializadas, llamadas rmio11es celHlares, y por medio de otras estructuras de soporte. Los tejidos varían en complejidad desde tejidos s imples, que contienen un ün ico tipo celular, corno el epitelio que recubre los vasos sanguíneos, hasta tejidos complejos, q ue con tienen muchos tipos celulares y material extracelular abundante, como el tej ido conectivo. las células de la mayoría de los tejidos trabajan en conjLmlo para logra r un objetivo en común.

12. ¿Córro se diferencian los lisosomas de los peroxisomas? 13. Aplique el concepto fisiológico de lacompartimentación a los orgánulos engeneral ya las mitocondriasen particular. 14. la observación microscópi(a de una célula re"Rla unagrancantidad de mitocondrias. ¿Qué se puede inferir de esta observación acerca de los requerimientos energéticosae la célula? 15. Examinando un tejidode una nueva especie de peces, usted de;cubreque lascélulas de dicho tejido contienen grandes cantidades de retículoendoplasmático liso. ¿Cuál es una posible función deesas células?

Núcleo

ARNm

Mítocondria

El ARNm se transcribe a partir de genes en el ADN.

Poro nuclear

El ARNm abandona el núcleo y se adhiere a los ribosomas citoplasmáticos, iniciando la síntesis proteica.

Retículo en doplasmático

Vesícula de transporte

Algunas proteínas son liberadas por los ribosomas libres hacia el citosol o son dirigidas hacia orgánulos específicos. Los ribosomas adheridos al retículo endoplasmático rugoso dirigen las proteínas destinadas a empaquetamiento hacia la luz del RE rugoso.

Aparato de Golgí Transporte retrógrado Golgi-RE

Las proteínas son modificadas a medida que atraviesan la luz del RE rugoso.

4·• Las vesículas de transporte

trasladan las proteínas desde el RE hacia el aparato de Golgi.

Las cisternas del Golgi migran hacia la membrana celular. Vesícula secretora Lisosomao vesícula de almacenamiento

O.

-

"'l.sl..---::

- - - - - r - - - - - - - - - - -= C:i to : s:o~/ - - - - - - - ~ V J. Membrana celular

Líquido extracelular

• FIGURA 3-7 La síntesis proteica demuestra la importancia de la compartimentación subcelular.

Algunas vesículas se desprenden de las cisterhas y se desplazan en sentido inverso.

Algunas vesículas se desprenden para fom1ar lisosomas o vesículas de almacenamiento.

, Otras vesículas se convierten en vesículas secretoras que liberan sus contenidos fuera de la célula.

El estudio de la estructura y la función tisular se denomi na hi.stología thistos, tejido). l os histólogos describen los tej idos a partir de sus caracte rísticas íL~icas: ( l) la forma y el tamaño de las células, (2) la disposilión de estas en el tejido (en capas, dispersas, etc.), (3) la forma en q ue están unidas en LTe sí y (4) la cantidad de mate rial extracelular presente en el tej ido. Existen cuatro tipos de tej ido principales en el cuerpo: epitelial, conectivo, muscular y nervioso. Antes de considera r cada tipo tisular específicamente, anal izaremos cómo se vi nculan las cél ulas en tre sí para formar tej idos.

Principales moléculas de adhesión celular (CAM)

La matriz extracelular cumple muchas funciones La matriz ex tracelular (es habitual llamarla simplemen te matriz) es el mater ial extracelular s intetizado y secretado por las cél ulas de un tejido. Dw-an te años, los cienúficos creyeron que la matriz era una sustancia inerte Cu)'a ún ica función era mantener las células u nidas. Si n embargo, act ual mente existe eviden cia experimental que dem uestra que la mat riz extracelular cumple un rol fundamental en muchos procesos fisiológ icos, desde el crecimiento y el desarrollo celula r hasta su muerte. Muchos procesos patológicos están asociados a la sobreproducción o a la d isrupción de la matriz extracelular, incluyendo la insuficiencia cardíaca cró nica y la diseminación de células cancerosas por todo el cuer po ( metástasis). La co mposición de la matriz ext racel ular varía de un tej ido a otro, y las propiedades mecánicas de un tej ido, tales como elasticidad )' ílexib ilidad, depen den de la cantidad )' la consistencia de la matriz tisular. La matriz siempre tiene dos componentes básicos: los proteogluc.anos y las fibras pro teicas insolubles. Los pro teogluc.an os son glucoproteín as, es decir, proteínas unidas covalentemen te a cadenas de polisacáridos. Las fibras proteicas insolubles, como el colágeno, la f ibro11ecti11a y la /aminina, aportan fuerza mecánica y a ncla n las células a la matr iz. Las adherencias en tre la mat riz extracelula r y las proteínas de la membrana celular o el ci toesq ueleto son medios por los cuales las células se comun ican con su ambien te externo. La can tidad de matriz extracelular en un tejido es altamen te va riable. Los tejidos nervioso y muscular tienen muy poca matriz, mientras que los tej idos conectivos, como el cartílago, el hueso y la sangre, tienen una matriz abundan te que ocupa tanto volumen como sus cél ulas. L.a cons istencia de la matriz extracelLLia r puede variar desde acuosa (sangre y linfa) hasta rígida ( hueso}.

Nombre

Ejemplos

Cad he rinas

Uniones célu la-cél ula tales como union es adh e re ntes y desmosomas . De p endie ntes d e calcio.

lnteg rinas

Princip alme nte ha lladas e n un ion es célu la-ma triz. Tambié n cu mp le n funciones e n la señalización celu lar.

Superfamilia de las in mun oglobulinas

NCAM (mo léculas de adh esión de la célu la ne rviosa). Responsables d el creci mie nto ce lular d ura nte e l desarro llo d el sistema ne rvio so.

Selectinas

Adh esio nes tra nsito rias célula-célula.

darse hacia los tejidos in fectados, y permi te a los Lapones plaquelarios adhe rí rse a los vasos sanguíneos dañados. Ya que las ad hesiones cel ulares no son permanentes, la unió n entre las MAC y la matriz es débil. Las un iones cel ulares más fuertes pueden agruparse en tres amplias categorías de acuerdo con su función : un iones comunicantes, w1 iones ocl usivas (occludere, cerrar) y un iones de anclaje (• Fig 3-8}. En los animales, las uniones comunicantes ta mbién se llaman uniones en hendidura. Las un iones oclusivas de vertebrados son uniones estrechas que limitan el intercambio de sustancias entre cél ulas. Las cél ulas an imales tienen tres tipos principales de w1iones, descriptas más abajo.

Lasunionescelulares mantienen unidas las células para formar tejidos Durante el creci m ien to )' el desarrollo cel ular, las células for man adhesiones cé/11la -cé/11la, que pueden ser transitorias o convertirse en union es celula res permanentes. Las molécttlas d e adhesión celu.lar (MAC) son proteínas q ue atrav iesan la membrana celular, y son responsables ta nto de las unio nes celula res como de las adhesiones cel ulares transitorias Cuadro 3-3). Las adhes iones cél ula-célu la o célula- matriz med iad as po r MAC son fundamen tales para el crecimien to y el desarrollo normal. Po r ejemplo, las células nerviosas en creci miento se arrastran por la matriz ex tracel ular con la ayuda de moléculas de adhesión de la cé/11/<1 nerviosa (MACN). La adhesión cel ular ayuda a los glóbulos blancos a sali r de la ci rculació n y trasla-

<•

2

Las uniones en hen didura o uniones comunicantes son las un iones célula-célula más simples (Fi¡¡. 3-Sb). Perm iten una comunicación cli recta y rápida entre las células median te puen tes ci toplasmáticos en tre cél ulas ad)•acentes. Proteínas cilíndr icas, llamad as conexinas, se acoplan en tre sí y crean corredores huecos con canales estrechos en su interio r. Estos canales tienen la capacidad de abr irse y cerrarse, regulando así el tránsi to de pequeñas mo léculas y iones a través de ellos. l as un iones en hendidura permiten la níp ida transferencia de sefiales quím icas )' eléctricas de u na célula a la siguien te. An tes se pensaba que estas unio nes existían solo en cierto tipo de cél ulas musculares y ner viosas, pero ah ora sabern os que son importantes para la com un icación celular en muchos tejid os, incl uyendo el h ígado, el páncreas, los ovarios y la glándula tiroides. Las uniones estrechas son uniones oclusivas que restringen el intercambio de sustancias enLre las cél ulas que man tienen un idas ( Fi g. 3-Sc). En las un iones estrechas, las membranas cel ulares de células adyacen tes se fusionan pa rcialm en te con la ayuda de pro teínas llamadas claudim1s y oclruiina.s y, de este modo,

a FIGURA3-8

FUNDAMENTOS

• •

Uniones celulares (a) Las uniones celulares conectan a las células entre si (o con la matriz que las rodea) mediante proteínas que atraviesan la membrana celular llamadas moléculas de adhesión celular, MAC. Este diagrama muestra las muchas maneras en que las uniones celulares pueden ser categorizadas.

UNIONES CELULARES

Función

Comunicación

Localización

Oclusión

Anclaje

Uniones célula-célula

Uniones célula-matriz

1 Tipo

Unión en hendidura

Unión estrecha

Proteína de membrana

Conexina

Claudina, ocludina

l

Unión adherentE

Fibra citoesquelética

Desmosoma

1

-

1-

focal

Cadherína

Actina

1

Hemidesmosoma

lntegrina

Filamentos intermedios

Proteína de matriz

Las uniones celulares pueden agruparse en tres categorías: (b) uniones en hendidura, que permiten la comunicación directa célula a célula; (c) uniones estrechas, que obstruyen el flujo de sustancias entre las células, y (d) uniones de anclaje, que unen las células entre sf y con la matriz extracelular.

Adhesión

Actina

Queratina (filamentos intermedios

Fibronectina y otras proteínas

Larninína

Citosol - ' - Cadherina

Membrana celular

Espacio intercelular Membran = ª~ ----1...,...,,.,.,-:-1-~ celular Célula 1 (b) Las uniones en hendidura son uniones comunicantes.

8 músculo cardíaco tiene uniones en hendidura que permiten a las señales químicas y eléctricas pasar rápidamente de una célula a la siguiente. Cúmulos de _ uniones en hendidura

Célula

2

(c) Las uniones estrechas son uniones oclusivas.

Las uniones estrechas evitan el flujo de sustancias entre las células. Uniones adherentes

Micrografía por criofractura de una membrana celular

Glucoproteinas de placa

Filamento intermedio (d) Un desmosoma es una unión de anclaje célula-célula.

en esta micrografía de dos células intestinales adyacentes.

3

crean una barrera. Como en muchos procesos fisiológicos, las propiedades de barrera de las uniones eslrechas son ilinámicas y pueden modificarse de acuerdo con las necesidades del cuerpo. Las uniones estrechas pueden presenlar grados variables de "filtración''. Las uniones estrechas del Lracto digestivo y de los riflones evitan que la mayoría de las sustancias se desplacen lib remente enlre el medio interno)' el externo; de esta forma, permiten a las células regular lo que ingresa)' lo que sale del cuerpo. Las uniones estrechas también crean la barrera hematoencefálica, que evita que muchas sustancias de la sangre posiblemente daflinas lleguen al líquido extracelula.r del cerebro. Las uniones de anclaje ( Fig. 3-Sd) unen las células entre si ( uniones de anclaje célula-célula) o las células con la matriz extracelular (un iones de anclaje célula-malri2). En los vertebrados, las uniones de anclaje céhLla-célula esLán formadas por MAC llamadas cadherinas, que se conectan entre sí a través del espacio intercelular. Las uniones célula-malriz utilizan MAC llamadas inlegrinas. Las integrinas son proteínas de membrana que también pueden unirse a moléculas de seflalización que se encuentran en el medioambiente celular, transfiriendo así la información que transporta dicha molécula a través de la membrana celular hacia el ciLoplasma.

las uniones de anclaje contribuyen a la fuerza mecánica del tejido. Se las ha comparado con botones o cierres que unen las células y las mantienen en posición denLro del tejido. Nótese, en la Figura 3-8c, cómo las cadherinas que se acoplan ent re sí se asemejan al cierre de una cremallera. La conexión entre las proteínas de las uniones de anclaje es muy fuerte y permite a las láminas de tejido de la piel y de los revestimientos de las cavidades corporales resisLir el daflo por estiramiento y torsió n. Si usa zapatos que le rozan la piel, la agresión producida puede romper las proteínas que conectan las d iferentes capas de la piel; así, cuando se acumula líquido en los espacios resultantes y las capas se separan, se forma una ampolla. Los tejidos unidos por uniones de anclaje son como una valla o cerca de estacas en la que los espacios enlre estas perm ilen el paso de sustancias de un lado a otro de la cerca. El intercambio de sustancias entre las células constituye la vía paracelular. En contraste, los lejidos que se mantienen unidos mediante uniones eslrechas se asemejan más a un sólido muro de ladrillos: muy poco puede pasar entre los ladrillos de un lado al otro del muro. Las uniones de anclaje célula-célula pueden adoptar la forma de uniones adherentes o de desmosomas. Las uniones adherentes unen fibras de actina en células adyacentes entre sí, como se muestra en la micrografía en la Figura 3-Se. los desmosomas ( desmos, banda, + soma, cuerpo) se adhieren a filamentos intermedios del citoesqueleto. los desmosomas son las uniones célula-célula más fuertes. En las micrografías electrónicas se pueden reconocer por los densos cuerpos de glucoproteínas, o placas, que se encuentran inmediatamente dentro de las membranas celulares en la región donde las dos células se conectan ( Fig. 3-Se). Los desmosomas pueden ser pequefios puntos de contacto entre dos células (desmosoma punliforme o macula adherens) o bandas que circundan toda la célula (desmosoma en banda o zorw/a adherens).

Además, existen dos tipos de uniones de anclaje célula-matriz. Los hemidesmosomas (hemi-, mitad) son uniones fuerLes que andan fibras intermedias del citoesqueleto a proteínas fibrosas de la maLriz, como la laminina. Las adhesiones focales ligan las fibras intracelulares de actina a d iferenLes proleínas de la matriz, como la fibronectina. la pérdida de las uniones celulares normales cumple un rol importante en una variedad de enfermedades y en la metástasis. Las enfermedades en las que las uniones cehtlares se destruyen o no se forman pueden ocasionar síntomas deformantes y dolorosos, como en la piel ampollada. Una enfermedad de esLe tipo es el pénfigo, una condición en la cual el cuerpo atac.a algunas de sus propias proteínas de unión celular ( www.pemplzigus.org). La desaparición de las uniones de anclaje probablemente contribuya a la metásLasis de las células cancerosas por el cuerpo. Las células cancerosas pierden sus uniones de anclaje debido a que poseen meno r canLidad de moléculas de cadherina )' no se encuentran unidas tan estsechamente a las células vecinas. Cuando una célula cancerosa se libera de sus "amarras", secrela enzimas que digieren proteínas, conocidas e.orno proteasas. Estas enzimas, especialmente las llamadas metaloproteasos de lo marriz (MPM), disuelven la matriz extracelular, tras lo cual las células cancerosas se escapan y pueden invadir tejidos adyacentes o ingresar al torrenle sanguíneo. los cienlíficos esLán invesLigando formas de bloquear las MPM para intenlar impedir la metástasis. Ahora, que comprende cómo las células se unen entre sí den lro de los tejidos, estudiaremos los cuat ro tipos diferenLes de tejido del cuerpo: ( l) epitelial, (2) conectivo, (3) muscular y (4) nervioso.

Revisión 16. Nombre las !R; categorías funáonales de las uniones celulares. 17, ¿Qué tipo de unión celular.

(a) limita el transporte de sustancias entre lascélula;? {b) permite el Aujo diReto


una célula adyacente? (e) es la unión célula·célula más fuerte? (d) anda las fibras de actina de la célula a la matñz extracelular?

Los epitelios ofrecen protección y regulan el intercambio Los tejidos epiteliales, o epitelios (epi-, sobre,+ thele-, pezón), pro tegen el medio interno del cuerpo y regulan el intercambio de su, tancias enlre los medios interno y externo Fig. 3-9). Estos tejidos cubren las superficies expuestas, como la piel, y revisten las cavidades inlernas, como el traclo digestivo. Toda sustancia que ingrese o

<•

abamio11e el medio ambiente i111emo dl'i cuerpo debe atravesor epitelio.

w1

Algunos epitelios, como el de la piel )' el de las membra nas mucosas de la boca, actúan como una bar rera que mantiene el agua

a

FIGURA3-9 FUNDAMENTOS

Tejido epitelial (a} Cinco categorías funcionales de epitelios Ciliado

Protector

Secretor

Una

Una

Muchas

Una a muchas

Plana

Cilíndrica o cúbica

Cilíndrica o cúbica

Plana en las capas superficiales; poligonal Cilíndrica o poligonal en las capas más profundas

Los poros entre las células permiten el intercambio sencillo de moléculas

Las uniones estrechas evitan el movimiento de sustancias entre las células; el área superficial se encuentra aumentada por el plegamiento de la membrana celular, que forma microvellosidades en forma de dedo

Un lado cubierto con cilios para mover el líquido sobre la superficie

Células conectadas estrechamente por muchos desmosomas

Células secretoras de proteínas llenas de gránulos secretores unidos a membrana y RER abundante; células secretoras de esteroides que contienen gotas de lípidos y REL abundante

Intestino, riñones. algunas glándulas exocrinas

Nariz, tráquea y vías aéreas superiores; tracto reproductor femenino

Piel y revestimiento interno de cavidades que se abren hacia el exterior (como la boca)

Glándulas exocrinas, incluyendo el páncreas, las glándulas sudoríparas y las glándulas sal ivales; glándulas endocrinas como la tiroides y las gónadas

De intercambio NÚMERO DE CAPAS DE CÉLULAS FORMA CELULAR

CARAC· TERÍSTICAS ESPECIALES

DÓNDE SE ENCUENTRA

LEYENDA

Una

Pulmones, revestimiento de vasos sanguíneos

epitelio de intercambio

De transoorte

epitelio de transporte

epitelio ciliado

epitelio protector

e

epitelio secretor

o (b} Este diagrama muestra la distribución de los cinco tipos de epitelios del cuerpo destacados en el cuadro superior.

~

circulatori

4)

PREGUNTAS

• ¿Dónde se liberan las secreciones de las glándulas endocrinas? • ¿Dónde se liberan las secreciones de las glándulas exocrinas?

Células)

~

Las células epiteliales se adhieren a la lámina basal por medio de moléculas de adhesión celular.

~0 Aparato musculoesquelético

Aparato reproductor )

LEYENDA -

Secreción

-

Intercambio

..-= --

La lámina basal (membrana basal) es una capa de matriz acelular secretada por las células epiteliales.

Tejido subyacente

(c) La mayoría de los epitelios se adhieren a una capa de matriz subyacente llamada lámina basal o membrana basal.

dent ro del cuerpo y ev ita el ingreso de bacterias. Otros ep itelios, como el del riñón )' el del tracto digestivo, controlan la transferencia de sustancias entre el medio externo )' el líquido extracelular del cuerpo. Los nutrientes, gases y desechos deben atravesar habitual mente muchos ep itelios diferentes en su trayecto entre las células y el mundo exterior. O tro Lipa de epitelio se especializa en fabricar sustancias químicas y secretarlas a la sangre o al medio exterior. El sudor y la saliva son ejemplos de sustancias secretadas por epitelios al medio exterior. Las hormonas son secretadas a la sangre.

Estructura de fos epitelios Los epitelios consisten típicamente en una o más capas de células conectadas entre s[, con una fina capa de matriz extracelular entre las células epiteliales y sus tejidos sub)'acen tes (Fig. 3-9c). Esta capa de matriz, llamada lámina basal (lamina, placa fina; bassus, bajo) o membrana basal está compuesta por una red de filamentos de colágeno y laminina con proteoglucanos incrustados. Los filamentos proteicos unen las células epitel iales a las capas de células subyacentes, así como las uniones cel ulares unen las células individuales del epitelio en tre sí. Las uniones cel ulares de los epitelios son variables. Los fisiólogos clasifican los epitelios como "pern1e-<1bles" o "impermeables" dependiendo de cuán fácilmente las sustancias pueden atravesar la capa epi telial de un lado a otro. En un epitelio permeable, las uniones de anclaje permiten a las moléculas traspasar el epitelio a través de la luz existente entre dos células adyacentes. Un epitel io permeable típ ico es la pared de. los capilares (los vasos sanguíneos más pequeños), donde todas las moléculas disueltas en el plasma, con excepción de las proteínas grandes, pueden pasar desde la sangre hacia el líquido intersticial a través de los espacios entre células epiteliales ad)•acentes. En un epitelio impermeable, como el de los riñones, las células adyacentes entre sí se encuentran unidas mediante uniones estrechas que forman una bar rera, evitando así el pasaje de sustancias entre las células. Para traspasar un epi telio irnperme,1ble, la mayoría de las sustancias deben ingresar a las células epiteliales)' pasar a tmvés de ellas. La impermeabilidad de un epitelio está directamente relacionada con cuán selectivo es re.~pecto de las moléculas que pueden atravesarlo. Algunos epitelios, como el del intestino, Lienen la capacidad de modificar la permeabilidad de sus un iones de acuerdo con las necesidades corporales.

Existen cinco tipos funcionales de epitelios: de intercambio, de transporte, ci liado, protector y secretor t• Fig. 3- 1O). Los epitelios de inlercambio permiten el intercambio rápido de sustancias, especialmente gases. Los epitelios de transporte son selectivos con respecto a qué sustancias pueden atravesa rlos )' se encuentran principalmente en el tracto intestinal y en los rifiones. Los epitelios ciliados se localizan principalrnen te en las vías aéreas del aparato respiratorio y en el tracto reproductor femenino. Los epitelios protectores se encuentran sobre la superficie corpora l y en el revestim iento de las cavidades corporales. Los epitelios secretores sintetizan y Liberan productos de secreción hacia el med io externo o dentro del torrente sanguíneo. La Figura -'·9b muestra la d istrib ución de estos epitelios en los sistemas y aparatos corpora les. Nótese q ue la mayoría de los epitel ios enfrentan por uno de sus lados el medio externo y, por el otro, el líquido extracelular. La única excepción son las glándulas endocrinas.

Epitelios de intercambio Los epitelios de intercambio están com puestos por células planas y muy delgadas q ue permi ten el pasaje rápido de gases {CO2 y O,) a través del epitelio. Este tipo de epitelio recubre los vasos sanguineos de los pulmones, los dos sitios principales donde ocurre el intercambio gaseoso del cuerpo. En los capilares, h1ces o poros en el epitelio también perm iten a las moléculas 1m\s pequeñas que las proteínas pasar entre dos células epiteliales adyacentes, lo que hace que sean un epitelio permeable ( Fig. 3- lOal. Los histólogos denominan el tejido de intercambio delgado epitelio esrnmoso simple debido a que está formado por una única capa de célu las planas delgadas. El ep itelio escamoso simple que reviste el inter ior del corazón y de los vasos sanguínffis también se llama endotelio.

Epitelios de transporte Los epitelios de transporte regulan activa y selectivamente el intercambio de sustancias no gaseosas, como iones y nutrientes, entre los medios interno )'externo.Estos epitelios revisten el interior de los conductos huecos del aparato digestivo y del tracto urina rio, donde las luces están en contacto con el medio exterior. El paso de sustancias desde el medio externo hacia el interno a través del epitel io se llama absorción. El paso en el sentido opuesto, desde el medio interno hacia el externo, se llama secreción. Los epitelios de transporte p ueden identifica rse mediante las siguientes características (Fig. 3- 10eJ:

Tipos de epitelios Los tejidos epiteliales pueden dividirse estructuralmente en dos grandes grupos: ( l ) láminas de tejido que yacen sobre la superficie corpora l o que recubren el interior de conductos y órga nos huecos y (2) epitelios secretores que sintetizan y liberan sustancias hacia el espacio extracelular. Los histólogos clasifican los epitelios por el número de capas celulares en el tej ido )' por la forma de las células de la capa superücial. Esta clasificación reconoce dos tipos de estratificación: simple (de una célula de espesor) y estratificada (stmlllm, capa,+ [acere, hacer) (múltiples capas de células) y tres formas celulares: escamosa (squama, aplanada, placa o escarna), cúbica y cilíndrica. Sin embargo, los fisiólogos estamos más in teresados en las funciones de estos tejidos, por lo que, en lugar de utilizar las descripciones histológicas, dividi remos los epitelios en cinco grupos de acuerdo con su función.

2

Forma celular. Las células de los epitelios de transporte son mucho más gruesas que las de los epitelios de intercambio y fun cionan al mismo tiempo como barrera )' como puerta de entrada. La capa celular es de una sola célula de espesor {epitelio simple), pero las células son cúbicas o cilíndricas. Modificaciones de la membrana. La membrana apical, la superficie de las células ep iteliales que se enfrenta a la luz, cuenta con diminutas proyecciones sim ila res a dedos, llamadas microvel/osidades, que aumentan el área superficial dispon ible para el transporte. Una célula con microvellosidades tiene al menos 20 veces más área supe rficial que una célula s in ellas. Además, la membrana basolateraJ, el lado de la célula epitelial que se enfrenta a l líquido extracelular, también puede tener p liegues que aumenten el ,írea superfic ial celular.

Tipos de epitelios

(a) Epitelio de intercambio

Epitelio capilar

Las células planas y delgadas del epitelio de intercambio permiten el paso a través d e las células y ent re ellas.

\

~~

Sangre

.~ .

. re:====.~ .::::::::= . ===·Je . Poro

Liquido extracelular.

(b) Epitelio protector

(c) Epitelio ciliado

Los epitelios protectores tienen muc has capas apiladas de células que son constantemente reemplazadas. Esta figura muestra las capas de la piel (véase La piel). Células

Los cilios en movimiento generan corrientes de líquido q ue barren la s uperficie epitelial.

1

• •

Cilios

Microvellosidades

o o o

Sección de piel q ue muestra las capas celulares.

ª•

Imagen por microscopia electrónica de barrido de la superficie epitelial de una vía aérea

~

Aparato de Golgi "11'1" 1Q.('\1ma9en p or m 1croscop1a ete c trónica de barrido de la superficie epitelial de una vía aérea

.,¡,!L-...L_

Sección de piel q ue muestra las capas celulares.

Aparato de Golgi

-=!---+-

Núcleo

- -'--

Mitocondria

....,...,......,__,..____,L/__ Lámina basal (d) Epitelio secretor

(e) Epitelio de transporte

Las células epiteliales secretoras sintetizan un producto y lo liberan. Las secreciones exocrinas, como el moco q ue aquí se muestra. son secretadas fuera del cuerpo. Las secreciones de las células endocrinas (hormonas) son liberadas dentro del torrente sanguíneo.

Los epitelios de transporte trasladan sustancias selectivamente entre la luz y el LEC.

\

"

Aparato .l----de Golgi

~~11

. ~~ ___.l.~l ~

Núcleo

Luz del inteSotino o de un túbulo renal Membrana apical [ \ • .

Microvellosidades

Imagen por micros copía electró nica d e barrido d e una c élula cal icial

Las uniones estrechas de un epitelio de transporte impiden el paso entre células adyacentes. En su lugar, las sustancias deben pasar a través de la célula epit elial, traspasando dos membranas celulares fastolipídicas en su recorrido.

1fú1J l/VU1J( 1

¡

.

Célula de un epitelio de transporte

b •

Membrana basolateral 1 7·-L~íq-~~ i do extr; celular Las células caliciales secretan moco en la luz de los órganos huecos, como el intestino.

3

4

Uniones celulares. Las células de los epitelios de transporte están adheridas a las células adyacentes mediante un iones moderadamente fuertes a muy fue rtes. Esto sign iíic.a que, para atravesar el epitelio, el ma ter ial deben ingresar en la célula epitelial por un lado del tej ido y sali r de la célula por el otro lado. Org,\nulos celulares. La mayoría de las células que transportan materiales tienen numerosas m itocondrias que aportan energía para los procesos de transporte (discutidos en más detalle en el Capí11!10 5) las propiedades de transporte de los epitelios difieren dependiendo del lugar del cuerpo en el que esté localizado el epitelio. Por ejemplo, la glucosa puede atravesar el epitelio del intestino delgado e ingresar al líquido extracelular, pero no puede atravesar el epitelio del intestino grueso.

Las propiedades de transporte de un epitelio pueden ser reguladas y modificadas como respuesta frente a diversos estímulos. Las hormonas, por ejemplo, afectan el transporte de iones en el epitelio renal. Usted aprenderá más acere.a de los epitelios de transporte al estudiar los riñones)' el aparato digestivo.

Epitelios ciliados Los epitelios ciliados son tejidos no transportadores que revisten el aparato respiratorio y partes del tracto reproducto r femenino. La superficie del tejido que se enfrenta a la luz está cubierrn de ci lios, los cuales se sacuden de manera rítm ica y coordinada )' mueven líquido)' partículas sobre la superficie del tejido /Fjg. ~- !Oc). Si se da11an los cil ios o sus células epiteliales puede detenerse el movimiento ciliar. Por ejemplo, el hábito de fumar paraliza el revestimiento epitelial ciliado del tracto respiratorio. La pérdida de la función ci liar contribuye a la mayor incidencia de infecciones respirato1;as en fumadores, l'ª q ue el moco que atrapa las bacterias ya no puede ser ba rrido por los cilios fuera de los pulmones.

Epitelios protectores Los epitelios protectores evitan el intercambio en tre los medios externo e interno y protegen las áreas sometidas a daño mecánico o q uímico. Estos epitelios son tejidos estratificados, compueslos por muchas capas apiladas de células (Fig. 3- I0b). Los epitelios protectores se fortalecen mediante la secreción de queratina. (keras, cuerno), la misma proteína insoluble q ue abunda en cabellos y uñas. la epidermis ( epi, sobre,+ derma, piel) y las mucosas de la boca, de la faringe, del e$ófago, de la uretra y de la vagina son epitelios protectores. Deb ido a que los epitelios protectores están sometidos asustancias químicas irritantes, bacterias )' otras fuerzas destructivas, sus célula~ tienen vidas cortas. En las capas más profundas, célu las nuevas se producen continuamente, desplazando las células más viejas hacia la superficie. Cada vez que nos lavamos la cara se desprenden células muertas de la capa superficial. A medida q ue la piel envejece, la velocidad de recambio celular dism inu)'e. La tretinoína ( Retin-AO.O) , un fármaco derivado de la vitamina A, acelera la división celular y la descamación superficial para que la piel tratada adquiera una apariencia más juvenil.

Epitelios secretores Los epitelios secretores están compuestos por células que sintetizan una sustancia y, luego, la secretan al espacio extracelular. Las células secretoras pueden estar distribuidas entre

Muchos tipos de cáncer se desarrollan a partir de células epitelia les sometida.s a da ño o lesión. El cue llo del útero o cérvix consiste en dos tipos de epitelios. El epite lio secretor, con glándulas prod uctoras de moco, recubre el interior del cérvix, mie ntras que un epitelio protector cubre su exterior. Ambos tipos de epitelios se unen en la entrada del cérvix. En muchos casos, las infecciones causadas por el virus del papiloma humano (VPH) hacen que las cél ulas cervicales desarrollen cambios displásicos. l a doctora Baird realizó un estudio para detectar VPH en el primer papanicolaou de Jan y este resultó positivo. Hoy, la doctora repetirá la prueba para ver si la displasia y la in fección por VPH de Jan persisten. P3: ¿A qué otros tipos de daño o lesión están sometidas normalmente las cé lulas epitel iales cervica les? ¿Cuál de los dos tipos de epitelios cervicales es e l probablemente más afee· tado por traumatismo físico? P4:

Los resultados del primer papanicolaou de Jan mostraron células escamosas atípicas de sign ificado incierto (ASCUS). Estas células, ¿provienen más probablemente del epitelio secretor del cérvix o de su epitelio protect or?

63

65

72 . 90

92

otras células epiteliales o estar agrupadas y, así, formar una glánd ula multicelular. Existen dos tipos de glándulas secretoras: exocrinas )' endocrinas. Las glándulas exocrinas liberan sus secreciones hacia el medio externo (e.xo-, afuera,+ krineín, secretar). Estas secreciones pueden depositarse sobre la superficie de la p iel o sobre tm epitelio que ret'llbre el interior de una de las vías internas, como las vías aéreas pulmonares o la luz intestinal (Fjg \- 1Od). De este modo, las secreciones exocrinas salen del cuerpo. Esto explica cómo algunas secreciones exocrinas, como los jugos g,\stricos, pueden tener un pH que es incompatible con la vida ( Fig. 2-9). La mayoría de las glándulas exocrinas liberan sus productos a través de túbulos abiertos denominados conductos. Las glándulas sudoríparas, las glándulas mamarias, las glándulas salivales, el hígado y el páncreas son glándulas exocrinas. Las células de las glándulas exocrinas producen dos tipos de secreciones. las secre.c ion es serosas son soluciones acuosas y muchas de ellas contienen enzimas. Las lágrimas, el sudor y las soluciones con enzimas digesti vas son secreciones exocrinas serosas. las secreciones mucosas ( también llamadas moco) son soluciones pegajosas que contienen glucoproteínas )' proteoglucanos. Las células caliciformes, mostradas en la Pigura 3- 10d, son células indiv iduales exocrinas que producen moco. El moco actúa como lubricante para que la comida pueda ser tragada, como trampa para las pa rtículas y los microorganismos inhalados o ingeridos y como una barrera protectora entre el epitelio )' el ambiente.

Algunas glándulas exocrinas contienen más de un tipo de células secretoras y producen tanto secreciones serosas como mucosas; por ejemplo, las glándulas sal ivales liberan secreciones mixtas. A d iferenc ia de las glándulas exocrinas, las glándulas endocrin as carecen d e conductos y li beran sus secreciones, llamadas h o rm o nas, en el compartimento extracelular del cue rpo ( Fi g. 3-9d). Las hormonas se in corporan al torren te sanguíneo para ser distribu idas hacia otras pa rtes del cuerpo, donde regulan o coord ina n las actividades de di versos tej idos, órganos, s istemas y aparatos. Algunas de las glándulas endocrinas m,\s conocidas son el páncreas, la glándula ti ro ides, las gónadas y la glándula p itui taria ( hipófis is). D urante a ños se creyó que todas las h ormonas era n prod ucidas po r cél ulas agrupadas en las glánd ulas end oc rinas; ahora sabernos q ue ex isten células endocrinas aisladas distr ibuidas en los revestimientos ep iteli ales del tracto d igestivo, de los túbulos renales y de las cavidades cardíacas. La • Figm a 3-1 l muestra el o rigen epitelial de las glándulas end ocrinas y exoc rinas. Durante el desarro ll o, las células ep iteliales se di vide n hacia el inter ior del tej ido conectivo de sostén s ubyacen-

Durante el desarrollo. la • • • • t t t • t 14WI - - Epitelio región del epitelio desti- - -Tejido conectivo nada a convertirse en ejido glandular se divide hacia el interior del tejido conectivo s ubyacente.

•••

Exocrina

•• •

•• •

••••••••••

Conducto Las células de conexión - - - - -;. desaparecen '!%- - - - -Células secretoras

• • • •

Endocrina

exocrinas

Células ~----'r'!'..:,\ i~ secretoras endocrinas Vaso En las glándulas exoc rinas se orma un interior hueco, o luz, que crea un c ond uc to q ue facilita una vía para que las sec re ciones puedan salir hacia 1-a supe rficie del epitelio.

sanguíneo

1

Las glándulas endocrinas pierd en los puentes c elulares d e c onexión q ue las unen a su epi telio d e orig en. Sus secrec io-nes se vuelcan directamente d entro d el torrent e sanguíneo.

• FIGURA 3-1 1 Desarrollo de las glándulas endocrinas y exocrinas a partir del epitelio.

le. las glándulas exocrinas permanecen conectadas a su ep itelio de origen a través de un conducto q ue transpo rta la secrec ión hacia s u desti no (el med io externo). l as glándulas endocrinas pierden esas célul as de co nexión y secretan sus hormonas dentro del to rrente sanguíneo.

Revisión

18. Crte los cinco tipos de epitelios. 19. Delina secreción. 20. Nombredos propiedades quedistingan alas glándulas endocrinas de lasexocrinas. 21. la lámina basaldel epiteliocootiene la fibra proleica laminina. lascélulas queestán por encima, ¡e;tánadheridas mediante adhesiones focaleso mediantehemidesmosornas? 22. Usted examina un tejido al micrOS(opioy obse,va un epitelio escamososimple. ¿Puede ser una muestra de la su¡:,2rficie de la piel? Explique. 23. Una céluladel epitelio intestinal secreta una sustancia haci,; el líquidoextracelular, donde es recogida por la sangrey transportada hasta el páncreas. la céluladel epitelio intestina~ ¿es unacélula endocrina o exocrina?

Los tejidos conectivos actúan como sostén y barrera Los tejidos conectivos, el segundo tipo p rincipal de tej ido, actúan corno soporte estr uctural y, a veces, como una barrera física q ue, junto ron cél ulas especializadas, ª>'uda a defender el cuerpo de invasores como las bacterias. La característica distintiva de los tejidos conectivos es la presencia de abundante matriz extracelular que contiene cél ulas dispersas q ue prod ucen y modifican la matriz (a Fig. 3- 12). Los tejidos conectivos inclu)'en la sangre, los tejidos de sostén de la piel y los órganos internos, el cartílago y el hueso. Estructura del t:ejido conectivo La matri'z. extracelular del tejido conectivo es una s ustancia f undamental formada po r proteoglucanos y agua en la cual se distribuyen fibras proteicas, co mo si fueran Lrozos de fruta suspendidos en gelatina. La cons istencia de la sustancia fundamental e,; altamente variable, dependiendo del Lipo de tej ido conectivo ffig. 3-1 ?a). En un exlremo se encuentra la matriz acuosa de la sangre, y en el otro, la maLriz endurec ida del hueso. En el medio están las soluciones de proteoglucanos, q ue varían en consistenc ia desde viscosa hasta gelat inosa. Los términos sustancia fimdame11tal a veces se intercambian por ,muriz. Las cél ulas de los tej idos co nectivos se encuentran ind túdas en la ma triz extracelular. Estas células se describen como fijas si permanecen en un lugar y como móviles si pueden desplazarse de un lugar a otro. Las células fijas son las responsables de man tener el med io local, reparar el tejido )' almacenar energía. Las células móviles son responsables princi palmente de la d efensa. La dist inci ón ent re células fijas)' móviles no es absoluta, ya que al menos un tipo de cél ula se encuentra ta nto en forma fija como en forma móvil. Aunque la matriz extracel ular no es Lllla sustancia viva, las células del tej ido conectivo la modifican constantemente al añadir, eliminar o redistribu ir sus moléculas. El sufijo -b/asto (blastos, b ro te) en el nombre de una cél ula d e tej ido conectivo se refiere habitualmen te a

Tejido conectivo (a) Mapa conceptual de los componentes del tejido conectivo

[ iEJIDO CONECTIVO ]

1

~ - - - - está compuesto por - - - - ~

Células

Móviles

Rjas

Células sanguíneas

Glóbulos rojos

Glóbulos blancos

Macrófagos

1Adi7itos i Fibroblastos Almacenan energía en la grasa

Transporte Luchan de 02 y de C02 contra los invasores

sintefizan

'----- -- -- • Matriz

T

~ - - - - - - - - - puede dividirse e n - - - - - ~ Sustancia fundamental

Fibras proteicas

¡

¡

¡

Fibrilina

IEla¡ina 1

1Colá¡eno 1

Forma

Se estira y

Fibrilina

IEla¡ina 1

Forma filamentos y láminas

Se estira y

J Mineralizada

Gelatinosa

Fibronectina

Conecta las Fibronectina

Hueso

1: Tejido conectivo laxo

t Tejido conectivo denso

Plasma sanguíneo

1: Cartílago 1: Tejido adiposo

Conecta las células con la matriz

vuelve asu forma original

Rígido

1Colá¡eno 1 Rígido pero flexible

(b) Tipos de tejido conectivo ,---

Nombre del tejido

Sustancia fundamental

,---

Tipo de fibra y su disposición

Tipo celular principal

Dónde se encuentra

-

Tejido conectivo laxo

Gel; mayor cantidad de sustancia fundamental que de fibras o células

Colágeno, elástica, reticular; al azar

Fibroblastos

Piel. alrededor de vasos sanguíneos y órganos, debajo de los epitelios

Tejido conectivo denso irregular

Mayor cantidad de fibras que de sustancia fundamental

Mayoritariamente colágeno; al azar

Fibroblastos

Vainas musculares y nerviosas

Tejido conectivo denso regular

Mayor cantidad de fibras que de sustancia fundamental

Colágeno; en paralelo

Fibroblastos

Tendones y ligamentos

Tejido adiposo

Muy poca sustancia fundamental

Ninguna

Grasa parda y grasa blanca

Depende de la edad y del sexo

Sangre

Acuosa

Ninguna

Células sanguíneas

Sangre y vasos linfáticos

Cartílago

Firme pero flexible; ácido hialurónico

Colágeno

Condroblastos

Superficies articulares, columna vertebral, orejas, naríz, laringe

Hueso

Rígida debido a sales de calcio

Colágeno

Osteoblastos y osteocitos

Huesos

Tejidos corporales

una célula en crecimien to o a una célula q_ue secreta activamente matriz extracelular. Los fibroblastos, por ejemplo, son células de teji do coneclivo que secretan una matr iz rica en col,1geno. Las células que degradan activamen te la matriz se identifican con el su.fijo -cl11sto (k/11s10s, roto). Las células que no están en crec-imiento, ni secretan componen tes de la matriz ni la degradan pueden llevar el sufijo -cito, que significa "célula''. Estos sufijos lo ayudarán a recordar las diferencias funcionales entre células con nombres similares, como osteoblastos, osteocitos )' osteoclastos, tres tipos de células de los huesos. Además de secretar la sustancia fundamental hecha de proteoglucanos, Jas células del tejido conectivo producen fibrns de la matr iz. Cuatro tipos de proteínas fibrosas se encuentran en la matriz, un idas entre sí pa ra formar fibras insolubles. El colágeno (kolla, pegamento, + -genes, producir) es la proteína más abundante en el cuerpo h umano: cas i un tercio del peso seco del cuerpo. El colágeno es también la proteína más diversa de los cuatro Lipes, con al menos 12 variantes. Está presente en casi todos los sitios donde se encuentra el tejido conectivo, desde la piel hasta los músculos y los huesos. Las moléculas indiv iduales de colágeno se empaquetan para formar fibras de colágeno, que son fibras llexibles, pero no elásticas, cuya fuerza por unidad de peso supera la del acero. l a cantidad y la distribución de las fibras de colágeno ayudan a determina r las propiedades mecánicas de los d iferentes tipos de tejidos conecli\•os. Los otros tres tipos de fibras proteicas del tejido coneclivo so n la elastina, la fibril ina y la fib ronectina. La elaslina es una proteína espiralada y ondulada q ue recupera su longitud original tras se r estirada. Esta propiedad se conoce como elastancia.. La elastina se combina con las muy delgadas y rectas fibras de fibrilina para formar filamentos y láminas de fibras elásticas. Estas dos fibras son importantes pa ra los tejidos elásticos como los pulmones, los vasos sanguíneos y la piel. Como se mencionó previamente, la fibronectina conecta las células I d,') JIIU)' UC l ~


y

IC. l.. \.cl.:> lll.JJcl .',

uc

UU1."-"J'1 pttH.l JUI llHlt lU cl ll lCl llU~)

láminas de fibras elásticas. Estas dos fibras son importantes pa ra los tejidos elásticos como los pulmones, los vasos sanguíneos y la piel. Como se mencionó previamente, la fibronectina conecta las células con la ma triz extracelular mediante adhesiones focales. Las fibronectinas también cumplen un rol importan te en la curación de las heridas y en la coagulación de la sangre.

Tipos de tejido conect.ivo La Figura 3- l2b compara las propiedades de diferentes tipos de tej ido conectivo. Los tipos rnás com unes son los tejidos conectivos laxo y denso, el tejido adiposo, la sangre, el cartílago y el hueso. Se estima que los tejidos conectivos son los tipos de tejido más abundantes, ya que forman pa rte de la mayoría de los órganos. Los tejidos conectivos laxos (a Fig. 3- 13a) son los tejidos elásticos que subyacen a la piel y proveen soporte para las glándulas pequeñas. Los tejidos conectivos densos aportan fuerza y llexibilidad. Ejemplos de estos tejidos son los tendones, los ligamentos )' las vainas que recubren los músculos y los nervios. En estos tejidos den sos, las fibras de colágeno son el tipo dominante. Los tendones ( Fig. 3- 13c) fijan los músculos a los huesos. Los ligamentos conectan los huesos en tre sí. Debido a que los ligamentos contienen fibras elásticas además de fibras de coláge.no, poseen una capacidad limi tada para est irarse. Los tendones carecen de fibras elásticas, por lo que no pueden estirarse. El cartílago y el h ueso se consideran tejidos de sostén. Estos tejidos tienen una sustancia fundamental densa que contiene fibras empaquetadas estrechamente. El cartílago se encuentra en estructuras como la nariz, las orejas, las rodillas y la tníqueR. Es só lido, Oexi-

87

Cultive su propio cartílago ¿Se ha lesionado el cartílago de la rodilla jugando baloncesto o practicando algú n otro deporte? Qu izá no necesite cirug ía reparadora. El reemplazo del cartílago pe rdido o dañado está cruzando el campo de la ciencia ficción hacia el terreno de la realidad . Investigadores han desarrollado un proceso e n el cual toman una muestra de cartílago de un paciente y lo colocan en un medio de cultivo tisu lar para su reproducción. Una vez que el tejido ha desarrollado suficientes condrocitos (las células que sintetizan la matriz extracelular del cartílago), la mezcla se devuelve al ci rujano, q uie n implanta quirúrgicamente las células en la rod illa del paciente en el lugar del cartílago dañado. Una vez devueltos al cuerpo, los cond rocitos secretan matriz y ayudan a repa rar el cartílago dañado. Como son cu ltivadas y reimplantadas las propias cél ulas del paciente, no se produce rechazo del tejido. Un método diferente para repara r el cartílago, utilizado fuera de los Estados Un idos, es el tratamiento con cél ulas madre provenientes de la médula ósea. Ambos t ratamientos han demostrado ser efec· tivos en problema s específicos del cartílago.

ble y se destaca por su falta de irrigación sanguínea. Sin este apone de sangre, los nutr ientes y el oxígeno deben alcanzar las células del cartílago por d ifusión. Éste es un p roceso lento, lo que significa que el cartílago daüado se cura lentamente. U IC )

:,e uc:,ul L.a pul ~u Ldlld uc H l lC)d\.lUU ~ dt11=,UJUC

LC d f:'Ul LC uc

sangre, los nutr ientes y el oxígeno deben alcanzar las células del cartílago por d ifusión. Éste es un p roceso lento, lo que significa que el cartílago daüado se cura lentamente. Se dice que la matriz extracel ular del hueso está calcificada, ya que contiene depósitos minerales, principalmente sales de calcio, tales como el fosfato de calcio ( Fig. 3- l3b ). Estos minerales brindan fuerza )' rigidez al hueso. La estructura y la formación de hueso se examinan junto con el metabolismo del calcio más adelan te (Capítulo 23 ). El tejido adiposo está formado por adipocitos, o células de grasa. Un adipocito de grasa blanca típicamente contiene una única gota lipídica que ocupa la mayor parte del volumen de la célula ( Fig. 3- l3e). Éste es el tej ido adiposo m,15 común en los adultos. La grasa parda está compuesta po r células adiposas que contienen múltiples go tas lipídicas en lugar de u na ún ica gota grande. Se sabe desde hace mucho tiempo que este tipo de grasa cumple un rol importante en la regulación de la tempen1ttm1 en los niños pequeños. Hasta hace poco se creía que estaba ausente en los adultos. Sin embargo, las técnicas de imagen modernas como CT y PET combinadas han revelado que los adultos sí tienen grasa parda (este tema se analiza en mayor detal le en el Capítulo 2?). La sangre es tul tejido conectivo particular que se caracteriza por su matriz extracelular acuosa llamada plasma. El plasma consiste en una solución diluida de iones )' moléculas orgán icas disueltas, incl uyendo una gran variedad de p ro teinas solubles. Las células sanguíneas y los fragmentos celulares están suspendidos en el plasma ( Fig. 3- l3d), pero las fibras proteicas inso lubles, típicas de otros tej idos conectivos, están ausentes. ( Estudiaremos la sangre en el Capítulo 16.)

a

FIGURA3-13 FUNDAMENTOS

• •

Tipos de tejido conectivo

(a) Tipo conectivo laxo

El tejido conectivo laxo es muy flexible, con múltiples tipos de células y de fibras.

Los fibroblastos son cél ulas que secretan ---+- - - -•, las proteínas de la matriz.

Fibras elásticas

La sustancia fundamental es la matriz del tejido conectivo laxo.

Imagen por microscopía óptica del tejido conectivo

Macrófago libre

(b) Hueso y cartílago

(c) Tejido conectivo denso regular

Los huesos duros se forman cuando los osteoblastos depositan cristales de fosfato de calcio en la matriz. El cartílago posee una matriz firme pero flexible, secretada por células llamadas condrocitos.

Las fibras de colágeno del tendón están densamente empaquetadas en haces paralelos.

Fibras de colágeno --11-si. Matriz

Imagen por mic roscopía óptica del hueso

\

l

\

Condrocitos

Matriz

Imagen por microscopía óptica del tendón

Imagen por microscopia óptica del cartílago hialino

(d) Sangre

(e) Tejido adiposo

La sangre consiste en una matriz liquida (plasma) más glóbulos rojos y blancos y fragmentos celulares llamados plaquetas.

En la grasa blanca. el citoplasma celular está ocupado casi en su totalidad por gotas lipídicas.

,,,

Glóbulo rojo Plaqueta Linfocito Glóbulos blancos

-,{

~

Núcleo

Neutrófilo Eosinófilo

Imagen por microscopía óptica de una muestra d e sangre

\

Gotas lipídicas

Imagen por microscopía óptica del tejido adiposo

,) 1

Remodel ación tisular

Revisión 24. ¡Cuáles sonlas características distintivas de los tejidos conectiY05?

25. Nombrecuatro tipos de proteínas encontrados en la matriz de!tejido conectivo y mencíone lascaracterísticasde cada uno. 26. Nombre seis tiposde tejidos conectivos.

27. la sangre es un tejido conectivo con dos componentes: el plasma y las células. ¿Cuál de ellos es la matrizoe es!€ tejido conectivo? 28. ¿Por qué el carb1ago roto secura más lentamente que un corte en la piel?

Los tejidos muscular y nervioso son excitables Los tej idos muscular y nervioso se denominan colectivamente tejidos excitables debido a su capacidad para generar y propagar señales eléctricas llamadas potenciales de 11cci611. Ambos tipos de tejidos tienen una matriz extracelular mínima, habitualmente limitada a una capa de sostén llamada lámi11a externa. Algunos tipos de células musc-ulares y nerviosas también se destacan por sus uniones en hendidura, las cuales les permiten la conducción d irecta y rápida de las señales eléctricas de una céhila a la olra. El tejido muscular tiene la capacidad de con traerse y de generar fuerza y movimiento. El cuerpo tiene tres Lipos de tej ido muscular:

músculo cardíaco, músculo liso -se encuentra en la mayoría de los órganos in ternos-)' músculo esquelético. La ma)'O ría de los músculos esqueléticos se adhieren a los huesos y son los responsables de los movimientos del cuerpo. ( Estud iaremos el tej ido muscular con mayor detalle en el Capítulo 12.) El tejido nervioso tiene dos tipos de células. Las neuronas o células nerviosas transportan información en fo rma de señales q uím icas )' eléctricas de una parte del cuerpo a o tra. Se concentran en el encéfa lo y en la médula espinal, pero también incluyen una red de células q ue se extiende vi rtualmente hacia todas pa n es dentro del cuerpo. Las células de la glla, o neuroglía, son las células de sopo rte de las neuronas. (Estudiaremos la anatomía del tejido nerv ioso en el Capítulo 8.) En el • Cuadro 3-4 se encuent ra un resumen de las características de los cuatro tipos de tejido.

Remodelación tisular la ma)'Oría de las personas asocian el crecimiento con el período que va desde el nacimiento hasta la adultez. Sin embargo, el nacim iento, el c rec imien to y la muerte celular continúan a lo largo de toda la vida de una persona. Los tejidos del cuerpo están en constante remode lación a medida q ue las células mueren y son reemplazadas.

Características de los cuatro tipos de tejido Epitelial

89

• Conectivo

res)' nerviosas tambíén se destacan por sus uniones en hendidura, las cuales les permiten la conducción d irecta y ráp ida de las seña les eléctricas de una célula a la o tra. El tejido muscular tiene la capacidad de contraerse y de generar fuerza y movimiento. El cuerpo Liene tres tipos de tejido muscular:

Muscular Nervioso que va desde el nacimiento hasta la adullez. Sin embargo, el nacim iento, el crec imien to y la mue rte celula r conlinúan a lo largo de toda la vida de una persona. Los tejidos del cuerpo están en constante remodelación a medida q ue las células mueren y son reemplazadas.

Características de los cuatro tipos de tejido

Epitelial

Conectivo

Muscular

Nervioso

Cantidad de matriz

Mínima

Abundante

Mín ima

Mín ima

Tipo de matriz

Lámina basal

Variado (fibras proteicas en la sustancia fundamental, que varía desde líquida hasta firme o calcificada)

Lámina externa

Lá mina externa

Características particu lares

Sin aporte directo de sangre

El cartílago no posee irrigación sanguínea

Capaz de generar señales e léctricas, fuerza y movimien to

Capaz de generar señales e léctricas

Características superficiales de las células

Microvellosidades, cilios

N/ D

N/ D

N/D

Sostiene la piel y otros órganos; cartílago, hueso y sangre

Da forma a los músculos esque léticos, los ó rganos huecos y los tubos

Por todo e l cuerpo; se concentra en e l encéfalo y en la médula espinal

Las células no forman capas; habitualmente, disem inadas d e manera aleatoria en la matriz; forma celular de irreguiar a redonda

Células un idas en láminas o haces alargados; células alargadas con forma de cilindros delgados; las células musculares del corazón pueden ser ramificadas

Células aisladas o en red; apéndices celulares muy ramificados o alargados

Ubicación Cubre las superficies corporales; reviste las cavida des, los ó rganos huecos y los tubos; g lándulas secretoras Disposición y formas de las células

Número variable de capas, desde una hasta muchas; células planas, cúbicas o ci líndricas

La apoptosis es una forma ordenada de muerte celular la muerte celular ocurre de dos maneras, una desordenada y otra ordenada. En la n ecrosis, las células mueren debido a un trauma fisico, a toxinas o a falta de oxígeno cuando el suministro de sangre se interrumpe. Las células necróticas se hinchan, sus orgánulos se deterioran y, finalmente, las células se rompen. Los contenidos celulares así liberados incluyen enzimas d igestivas, que dañan las células adyacentes y desencademu1 una respuesta inílamatoria. Un ejemplo de necrosis se encuenlra en la zona enrojecida de la piel alrededor de una costra. Por el contrario, las células sometidas a una muerte celular programada, o apoptosis (apo-, a partir de,+ ptosi.s, caída ), no afectan a sus vecinas cuando mueren. La apopLOsis, también Llamada suicidio celular, es un proceso complejo regulado por múltiples señales quími cas. Algu nas señales evitan que suceda la apoptosis, mientras que otras le o rdenan a la célula que se autodestruya. Cuando predominan las señales de suicidio, la cromatina del núcleo se condensa, la célula se aleja de sus vecinas, se encoge y, finalmente, se rompe en muchos fragmentos, fo rmando burbujas rodeadas por membrana que son engullidas por las cél ulas vecinas o por células pasajeras del sistema inmune. La apoptosis es un acontecim iento no rmal en la vida del organismo. Durante el desarrollo (eta], la apoptosis elim ina las células innecesarias; por ejemplo, la mitad de las células del cerebro en desarrollo y las membranas en tre los dedos de los pies y las manos. En los adultos, las células deterioradas por estar expuestas al medio externo pueden vivir solo uno o dos días antes de someterse al proceso de apoptosis. Po r ejemplo, se estima que el epitelio intestinal se reemplaza por completo con células nuevas cada dos a cinco días.

Revisión

29. ¿Cuáles son algunasoe las caracte1ísticas de la apoptosis que la distinguen de fa necrosis?

El día sig uiente a la visita de Jan, el sistema de análisis citológico compu tarizado analiza rápidamente las células de la muestra de tejido cervical de Jan buscando anomalías en e l tamaño o la forma celular. La computadora está programada para encontrar diferentes planos para q ue el citólogo los examine. l os resu ltados de dos pruebas de Papanicolaou de Jan se muestran en la • Fiau ra 3-14. PS:

l a displasia de Jan, ¿mejoró o empeoró? ¿Con qué eviden cia cuenta para respaldar su respuesta?

P6: Utilice su respuesta a la preg unta 5 para aseverar si la infec-

ción por VPH ha persistido o ha sido elimin ada por el sistema inmun e de Jan .

63

65

72

84 . 92

Las células madre pueden crear células especializadas nuevas Si las células del cuerpo ad ulto mueren constan te mente, ¿de dónde provienen las células que las reemplazan? Todavía se buscan respuestas a esta pregunta, y éste es uno de los temas más im portantes de la invesLigación en biología hoy en día. Los siguientes párrafos describen Jo que sabemos actua lmente. Todas las células del cuerpo provienen de una única célula formada en el momento de la concepción. Esa célula y las que se generan después se reproducen por división celular, un proceso que se conoce como mitosis ( véase el Apéndice C). Las primeras células en la vida de un ser humano son llamadas tolipotenciales (totus, entero) por-

.... • FIGURA 3-14 Citología de células cervicales. l as estructuras t eñidas de color oscuro dentro de las células son los núcleos, rodeados por el citoplasma, te ñido de color más claro.

La piel las capas de la piel

Los folículos pilosos secretan la queratina - ~ del pelo.

Cuando los músculos piloerectores se contraen , tiran de los foliculos pilosos hacia una posición más vertical, generando la ''carne de gallina".

Las son glándulas exocrinas que secretan una mezcla de lípidos.

Las glándulas sudoríparas secretan un líquido salado diluido para enfriar - - - - - ~ el cuerpo. Los receptores sensoriales registran las condiciones externas. La epidermis consiste en múltiples { capas de células que forman una barrera protectora.

La dermis es un tejido conectivo laxo que contiene glándulas exocrinas, vasos sanguíneos, músculos y terminales nerviosas.

La hipodermis cont iene tejido adiposos para aislamiento.

Epidermis La superficie de la piel es una capa de fibras de queratina unidas q ue perduran luego de que las células epiteliales viejas

qui:! cunul:!111:! yIa11uu1as l:!xocnr Ias. vasos sanguíneos, músculos y terminales nerviosas.

La hipodennis contiene tejido adiposos para aislamiento.

Nervio sensorial Las glándulas apocrinas en los genitales. el ano. las axilas y los párpados liberan secreciones cerosas o viscosas como respuesta al miedo o a la excitación sexual.

Epidermis La superficie de la piel es ,Arteria Vena 1 una capa de fibras de Los vasos sl nguíneos se queratina unidas que perduran extienden hacia afuera dentro luego de q ue las células de la dermis. epiteliales viejas La matriz fosfolipídica es , se mueren. el principal agente imper- '\. meabilizante de la piel. '\. --'""' Los queratinocitos superficiales producen las fibras de queratina. Los desmosomas anclan las células epiteliales entre si. Célula epidérmica

El melanoma ocurre cuando los melanocitos se transforman en células malignas, frecuentemente tras exposiciones repetidas a la luz ultravioleta. Un estudio determinó que las personas que utilizaban aparatos de bronceado o camas solares tenían un 24% más de probabilidades de desarrollar melanoma.

Los melanocitos contienen el pigmento melanina. Lámina basal -

-t=~;;.,,,,::

Conexión entre la dermis y la epidermis Los hemidesmosomas unen las células epidérmicas con las fibras de la lámina basal. La lámina basal o membrana basal es una capa acelular ubicada entre la epidermis y la dermis.

92

Capítu lo 3 Compartimentación: células y tejidos

que tienen la capacidad de convertirse en todo tipo de células especializadas. Cualquier célula totipotencial puede generar un organismo funcional completo. Hacia el cuarto día de desarrollo, las células lotipotenciales del embrión comienzan a especializarse o a diferenciarse. Al hacer esto, dismi nuyen su potencial y se vuelven pluripotenciales (plr,res, muchos). Las células pluripo tenciales pueden converti rse en muchos tipos celulares pero no en todos ellos. Una célula pluripotencial aislada no p uede generar un organ ismo entero. A medida que la diferenciación conti n úa, las células pluripotenciales generan los distintos tejidos del cuerpo. Al madurar y especializa rse, la mayoría de las célu las p ierden la capacidad de llevar a cabo la rnüosis para reproducirse. Sin embargo, pueden ser reemplazadas por nuevas cél ulas generadas a partir de las células madre, q ue son células menos especializadas que ma ntienen la capacidad de dividirse. Las células madre indiferenciadas de un tejido que mantienen la capacidad de dividirse y convertirse en los tipos celu lares de ese tejido se llaman multipotenciales ( mu/ti, muchos). Algunas de. las células madre adultas multipo te nciale.s más estudiadas se encuentran en la médula ósea y son las que dan origen a las cél ulas sangu íneas. Sin embargo, las células madre del cuerpo existen en cantidades muy pequeñas. Son difíciles de aislar y no se desarrollan en el laboratorio. Los biólogos creían que las células ner viosas y musculares, que son altamente especializadas en sus formas maduras, no podían ser reemplazadas tras su muerte. Actualmente, las invest igac iones indican que sí existen células madre en estos tej idos. Sin embargo, las células madre muscula res y nerviosas que se halJan naturalmente en el cuerpo son tan escasas que no pueden reemplazar grandes cantidades de tejido muerto o moribundo como consecue ncia de enfe rmedades como el infarto de miocardio. Consecuentemente, uno de los objetivos de las investigaciones sobre células madre es encontrar una fuen te de pu son Lan escasas yue no pueuen reemptazar granues cauuuaues ue tejido muerto o moribundo como consecue ncia de enfe rmedades como el infarto de miocardio. Consecuentemente, uno de los objetivos de las investigaciones sobre células madre es encontrar una fuen te de cél ulas madre mulli o pl uripotenciales que p uedan desarrollarse en el labora to rio. Si estas cél ulas pudiesen ser cultivadas en grandes cantidades, podrían ser implantadas para tratar los tejidos dañados y las enfermedades degenerativas, en las cuales las células se degeneran y mueren. Un ejemplo de una enfermedad degenerativa es la enfermedad de Parkinson, que provoca la muerte de cier tos tipos de células nerviosas del cerebro. Los tej idos de emb riones y fetos son una íuente muy rica de células madre, pero la utilización de células madre embrionar ias resulta controvertido y suscita muchas cuestiones legales y éticas. Algunos investigadores esperan que las células madre adultas demuestren plasticidad, la capacidad de especializarse en un tipo cel ular diferente al que estaban desti nadas a convertirse. Existen aún muchos desafíos que superar antes de que la terapia con células madre sea un tratamiento médico de rutina. Uno de ellos

es encontrar una buena fuen te de células madre. Otro desafío muy importante es determinar las señales químic<1s q ue le ind ican a la célula cuándo diferenci


Los órganos Grupos de tejidos que llevan a cabo funciones similares pueden formar estructuras llamadas órganos. Los órganos del cuerpo contienen los cuatro tipos de tejido en diferentes proporciones. La piel es un excelente ejemplo de un órgano que incorpora los cuatro tipos de teji do en un lodo integrado. Pensamos que la piel es solo una delgada capa que recubre las superíicies externas del cuerpo, pero en realidad es el órgano individual m,\s pesado: ¡representa aproximadamente el 16% del peso corporal total de un adulto! Si fuese extendida completamen te, cubriría una superficie de en tre 1,2 y 2,3 metros cuadrados, aproximadamente el tamaño comb inado de un par de mesas. Su tamaño y peso conv ier ten a la piel en uno de los ó rganos más importantes del cuerpo. Las funciones de la piel no pueden enmarca rse en un único capítulo de este lib ro, y esto ta mb ién ocurre con o tros órga nos. Destacaremos las características de muchos de estos órganos en diverutntes Ut'l cuerpo.

Las funciones de la piel no pueden enmarca rse en un único capítulo de este lib ro, y esto ta mb ién ocurre con o tros órga nos. Destacaremos las características de muchos de estos órganos en diversos recuadros a lo largo del libro en los cuales anal iza remos la estructura y las funciones de estos ó rganos versátil es para que usted pueda apreciar la manera en que los diferentes tejidos se comb inan para log rar un objetivo en comú n. El primero de estos recuadros, La piel, se presenta en la página 91. Al analizar los sistemas y aparatos del cue rpo en los sigu ientes capítulos, usted aprenderá cómo las diversas células, los tejidos y los órganos lleva n a cabo los procesos del cuerpo humano. Aunque las cél ulas del cuerpo tienen distintas estructuras y diferen tes funciones, todas tienen una misma necesidad: un sumin istro continuo de energía. Sin energía, las células no pueden sobreviv ir n i, mucho menos, llevar a cabo todos los procesos de la vida cotidiana. En el próximo capítulo estud iaremos la energía en los o rgan ismos vivos y cómo las células capturan y utilizan la energía liberada por las reacciones químicas.

El papanicolaou, el cáncer cervical yel VPH En este tema relacionado, usted aprend ió que la prueba de Papanicolaou puede detectar cambios celulares tempranos que preceden el cáncer cervica l. El diagnóstico no siempre es fácil debido a que los cambios en la citología, que varía de normal a cancerosa, son continuos y pueden estar sujetos a la interpreta-

ción individual. Además, no todos los cambios celulares son cancerosos. El virus del papiloma humano (VPH), una infección común t ransmitida sexualmente, también puede ocasio nar displasia cervical. En la mayoría de los casos, el sistema inmune de la mujer elimina el virus dentro de los dos años siguientes al contagio y las

células cervicales vuelven a la normalidad. Sin embargo, un pequeño número de mujeres con infecciones por VPH persistentes tienen un mayor riesgo de desarrollar cáncer cervical. Los estu dios muestran que e l 98% de los cánceres cervicales se asocia con la infección por VPH. Para conocer más sobre esta asociación entre VPH y cáncer cervical, diríjase a la página del Instituto Nacional de

Cáncer de los Estados Unidos (NCI, por sus siglas en inglés) (www.cancer.gov) y busque información sobre el VPH. Esta página web también contiene información sobre cá ncer cervical. Para verificar lo aprendido en este tema relacionado, compare sus respuestas con el siguiente cuadro de revisión.

Pregunta

Hechos

Integración y análisis

1 . ¿Por qué el tratamiento contra el cáncer se concentra en eliminar las células cancerosas?

Las células cancerosas se dividen de manera incontrolable y no pueden coordinarse con las cél ulas normales. Las células cancerosas no se diferencian en células especializadas.

Si no son eliminadas, las células cancerosas desplazan a las células normales. Esto puede ocasionar la destrucción de los tejidos normales. Además, debido a que las células cancerosas no se especializan, no pueden llevar a cabo las mismas funciones que las cél ulas especializadas a las que desplazan.

2. ¿Qué clases de páginas web debería buscar Jimmy en su lista de resultados y cómo podría reconocerlas?

Las células cancerosas se dividen de manera incontrolable. Las células en división duplican su ADN antes de dividirse, y esta duplicación tiene lugar en el núcleo, lo que deriva en el gran tamaño de este orgánulo (Apéndice C).

Las células que se están reproduciendo tienen más cantidad de A0N en sus nú cleos, ya que se preparan para dividirse, por lo que sus núcleos serán más grandes. Cada división celular reparte el citoplasma entre las dos células hijas. Si la división ocurre rápidamente, las células hijas pueden no tener tiempo para sintetizar citoplasma nuevo, por lo que la cantidad de citoplasma es menor qu e la de una célula normal.

3 . En el artículo de The Doctor's Medica/

El cuello del útero o cérvix es el conducto entre el útero y la vagina.

El cérvix está sometido a trauma o daño, corno el que ocurre durante la actividad sexual o durante el parto.

4. ¿Cómo puede Jimmy averiguar más acerca de quien creó la página web y cuáles son sus credenciales?

El cérvix consiste en un epitelio con glándulas secretoras de moco que revisten el interior y en un epitelio protector que recubre el exterior.

El epitelio protector está compuesto por múltiples capas de células y está diseñado para proteger el tejido del daño químico y mecánico (p. 84). Por lo tanto, el epitelio secretor, formado por una capa del espesor de una sola célula, se daña más fácilmente.

S. Compare la cantidad de resultados de la búsqueda en PubMed con la cantidad de resultados obtenidos en las búsquedas en Google.

Las células secretoras son cilíndricas. El epitelio protector está formado por capas de múltiples células.

El epitelio protector que cuenta con capas de múltiples células tiene células planas (epitelio escamoso estratificado). La denominación ASC hace referencia a estas células epiteliales protectoras.

6. ¿Qué dijo Jimmy a su madre acerca

El prim er papanicolaou de Jan mostró la presencia de células anormales con núcleos grandes y citoplasma escaso. Estas células anormales no se detectaron en la seg unda muestra.

La desaparición de las células anormales indica que la displasia de Jan se ha solucionado. Ella volverá en seis meses para repetir el papanicolaou; si este no muestra cambios displásicos, sus células cervicales habrán vuelto a la normalidad.

Las células en el seg undo papanicolaou se ven normales.

Una vez que el cuerpo de Jan elimine la infección por VPH, sus células cervicales deberían volve r a la normalidad. Su segunda prueba de VPH no mostró ninguna evidencia de ADN de VPH.

Library titulado ' Fiber", ¿qué dice el doctor Kennedy, su autor, acerca de la dieta elevada en fibra y la diabetes?

de su necesidad de recibir insulína para su diabetes tipo 2?

7. ¿Mencionan los artículos publicados por e l National Center for Complementary and Alternative Medicine (NCCAM) la fibra dietaría como tratamiento alternativo para la diabetes?

63

65

72

84

Resumen del capítulo La biología celular y la histología ilustran uno de los temas principales de la fisiología: la compartimeutació11. En este capitulo usted aprendió cómo se subdivide una célula en dos compartimentos p rincipales, el núcleo y el citoplasma. También aprendió cómo las células forman tejidos que crean compartimentos más grandes dentro del cuerpo. Otro tema importante

de este capítulo son las interacciones moleculares que dan lugar a las propiedades mwí11icas de células y tejidos. Las fibras proteicas del citoesqueleto y las uniones celulares, junto con las moléculas que componen la matriz extracelular, forman el "pegamento" que mantiene unidos los tejidos.

Compartimentos funcionales del cuerpo Líquidos y e lectrolitos: introducción a los fluidos corporales 15.

1. La célula es la unidad funcional de los organismos vivos. (p. 63) 2. Las principales cavidades del cuerpo humano son la cavidad craneana (cráneo), la cavidad torácica (tórax) y la cavidad abdominopelviana. (p. 64 ; Fig. 3- 1a ) 3. Las luces de algunos órgru10s huecos fonnan parte del medio externo. {p.63) 4. Los compartimentos líquidos del cuerpo son el líquido extracelular ( LEC) que se encuentra fuera de las células y el líquido intracelular ( LIC) dentro de ellas. El LEC se subdivide en el líqtúdo intersticial que baúa a las células y el plasma, la parte líquida de la sangre. (p. 64; Fig. 3-l b)

16.

17. 18. 19.

Membranas biológicas 5. La palabra memb rana se ulili1,a tanto para las membrru1as celulares

como para las membranas tisulares que revisten una cavidad o que separan dos compartimentos. (p. 64; Fig. 3-1 c ) 6. La membrana celular actúa como una barrera entre los líquidos intracelular y extracelular, provee sostén estructural y regula el intercambio y la comunicación entre la célula y su ambiente. (p. 65) 7. El modelo del mosai co fltúdo de una membrana biológica la representa como una bicapa fosfolipídica con proteínas insertas en la bicapa. (p. 66: fig. 3-2b) 8. Los lípidos de membrana incluyen fosfolípidos, esfingolípidos y colesterol. Las proteínas aJ1cladas a lipidos se adhieren a los lípidos de membrana. ( p. 68) 9. Las proteínas transmembr ruia son proteínas integrales de membrana unidas estrechamente a la bicapa fosfolipídica. las proteínas perí.féricas se unen menos estrechamente a cualquiera de los dos lados de la membrana. (p. 67; Fig. 3-1b, e) 1O. Los hidratos de carbono se adhieren a la superficie eKtracelular de las membranas celulares. (p. 67)

20.

2 l. 22.

23.

dones sobre la superficie celular, y los flagelos, que impulsa11 los espermatornides por los líquidos corporales, están formados por microtúbulos. (p. 70; Figs. 3-4e, 3-5) El citoesqueleto modificable aporta fuerza, sostén y organización interna; ayuda en el transporte de sustancias dena·o de la célula; une las células entre si, y permite la movilidad de algunas células. (p. 70; Fig. 3 -4b) Las proteúias motoras como las miosinas, las cinesinas )' las dineínas se asocian con las fibras del citoesqueleto para generar movimiento. (p. 74; Fig. 3-6) Las membranas alrededor de los orgánulos crean compartimentos que separan las funciones. (p. 74 ) las mitocondrias producen la mayor parte del ATP celular. (p. 71; Fi~. 3-4~) El retículo endoplasm ático liso es el principal lugar de síntesis de lipidos. 1:.1 retículo end oplasmático rugoso es el principal lugar de síntesis proteica. (p. 71; Fi~. 3-4il El aparato d e Golgi empaqueta las proteínas dentro de vesículas. Las vesículas secretoras liberan sus contenidos en el líquido eKtracelular. (p. 71 ; Fjg ~-4h l Los lisosomas )' los peroxisomas son pequeñas vesículas de almacenamien to que contienen enzimas digestivas. (p. 70; Figs. 3 -4c y d ) El n úcleo contiene el ADN, el material genético que en última instan cia controla rodos los procesos celulares, en fom1a de cromatina. La envoltura nuclear es una doble membrana que envuelve el núcleo y contiene complejos del poro nuclear que permiten una comw1icación química controlada entre el núcleo y el citosol. Los nucléolos son regiones nucleares que controlan la síntesis del ARN de los ribosomas. (p. 71; Fig. 3-4j) La sin tesis proteica es un ejemplo de cómo la célula separa las funciones aislándolas en compartimentos separados en su interior. (p. 77; Fig. 3-7)

Tejidos corporales Muscular: Revisión de la anatomía - Tejido de músculo esquelético

Compartimentos intracelulares 11 . El citoplasma consiste en un citosol semigelatinoso con nutrientes, iones )' productos de desecho disueltos en su interior. Suspendidos en el citosol se encuentran los orros componentes del citoplasma: las fibras y las inclusiones insolubles, las cuales no cuentan con una membrana que las recubra, y los orgánulos, que son cuerpos rodeados por membrana que llevan a cabo funciones específicas. (p. 70; fig. 3-4a) 12. Los rib osomas son inclusiones que partícipru1 en la sín tesis proteica. 13. Las fibras proteicas insolubles se presentan en tres tamaf10s: las fibras d e actina (también llamadas microfilamentos), los filamentos intermedios y los microtúb ulos. (p. 70; Cuadra 'l-2) 14. Los centríolos, que asisten en el movimiento de los cromosomas durante la división celular; los cilios, que barren el líquido y las secre-

24. Hay cuatro tipos de tejid os prin1arios en el cuerpo humano: epitelial, conectivo, muscular y nervioso. (p. 78) 25. La matriz extracelular secretada por las células provee sostén y un medio para la comunicación célula-célula. Está compuesta por proteogluc.anos y por fibras proteicas insolubles. (p. 78) 26. Las uniones de las células animales se clasifican en t res categorías. Las mi.iones en hendidura penniten el pasaje directo de señales quím icas )' eléctricas de una célula a otra. Las uniones estrechas l imitan el traspaso de sustancias entre las células. Las uniones de anclaje unen a las células entre sí o a la matriz extracelular. (p. 79; fjg 1-8) 27. Las proteínas de membrana llamadas moléculas de adhesión celular (MAC) son esenciales para la adhesion celular y para las uniones de anclaje. (p. 78; Cuadro 3-3)

Preguntas 28. los desmosomas r las uniones adherentes anclan las células entre sí.

29.

30.

3 1.

32. 33.

Las adhesiones focales y los hemidesmosomas anclan las células a la matriz. (p. 79; Fig. 3-8 ) Los tejidos ep iteliales protegen el medio interno, regulan el intercambio de sustancias o fabrican y secretan productos químicos. En el cuerpo se encuenh·an cinco tipos funcionales de epitelio: el de intercambio, el de transporte, el ciliado, el protector y el secretor. (p. 81; Fig. 3-9) Los epitelios de intercambio permiten el intercambio rápido de sustancias, principalmente gases. Los epitelios de transporte regulan activamente el intercambio selectivo de sustancias no gaseosas entre los medios interno y externo. Los epitelios ciliados barren líquidos y partJCulas situadas sobre las superficies tisulares. Los epitelios protectores ayudan a evitar el intercambio enh·e los medios interno y externo. Los epitelios secretores líberan productos hacia el medio externo o dentro de la sangre. (p. 83; Fig. 3-10 ) Las glándulas exocrinas liberan sus secreciones hacia el medio externo a través de conductos. Las glándulas endocrinas carecen de conductos para liberar sus secreciones, llamas hormonas, directamente en el líquido extracelular. (p. 81; Fig. 3-9b) Los tejidos conectivos tienen abundante matriz extracelular que provee sostén estructural y fonna una barrera física. (p. 86; Fig. 3-12) Los tejidos conectivos laxos son tejidos elásticos que subyacen a la piel. Los tejidos conectivos densos, incluyendo los tendones y los ligamentos, tienen fuerza o tlexibilidad debido a que están hechos de colágeno. El tejido adip oso almacena grasa. El tejido conectivo llama-

9S

do sangre se caracteriza por una matTiz acuosa. El cartílago es sólido y flexible y no tiene suministro de sangre. La matl'Íz fibrosa del hueso es dura debido a los depósitos de sales de calcio. (p. 88; Fig. 3-13) 34. Los tejidos muscular y nervioso se denominan tejidos excitables debido a su capacidad de generar y propagar seüales eléctricas llamadas potenciales de acción. El tejido muscular tiene la capacidad de contraerse y generar fuer1,a y movimiento. Existen tres tipos de musculo: el cardíaco, el liso y el esquelético. (p. 89) 35. El tejido nervioso incluye las neuronas, las cuales utili1~~n seüales eléctricas y químicas para transmitir información desde tma parte del cuerpo hacia otra, y las células de sostén llamadas células de la glia (neuroglia). (p. 89)

Remodelación tisular 36. La muerte celular ocurre por necrosis, la cual afecta negativamente

las células vecinas, y por apop tosis, la muerte celular programada que no afecta al 1·esto del tejido. (p. 90) 37. Las células madre son células capaces de re.producirse y diferenciarse en células especializadas. las células madre son más abundantes en los embriones, pero también se encuentran el cuerpo adulto. (p. 92 )

Los órganos 38. Los órganos están formados por grupos de tejidos que llevan a cabo funciones relacionadas. Los órganos del cuerpo contienen los cuatro tipos de tejidos en diferentes proporciones; por ejemplo, la piel está formada ampliamente por tejido conectivo. (p. 92 )

Preguntas

Véanse las respuestas en el apéndice A

Nivel 1: revisión de hechos y términos

8.

Una cada orgánulo con su función:

8.

Una cada orgánulo con su función:

1irte !as entro fwaciones aeueraler de la membrana ceJ::bs Nivel 1: revisión de hechos y términos 1.

2.

3. 4.

5. 6.

Liste las cuatro funciones generales de la membrana celular. En 1972, Singer y Nicolson propusieron el modelo del mosaico fluido de la membrana celular. De acuerdo con este modelo, la membrana está compuesta por una bicapa de - - - - - - )' una variedad de - - -incrustadas, con - - - -sobre la superficie <.>:\tracelular. ¿Cuáles son los dos tipos principales de biomoléculas encontTadas en la membrana celular? Defina y distinga entre inclusiones y orgánulos. Dé un ejemplo de cada uno. Defina citoesqueleto. Liste cinco funciones del citoesqueleto. Una cada término con la descripción más adecuada:

(al retículo endoplasmático (b) aparato de Golgi (c) lisosoma (d ) mitocondria (e) peroxisoma

l. orgánulo donde se produce la mayor

parte del ATP celular 2. degrada los ácidos grasos de cadena

larga y moléculas tóxicas 3. red de túbulos membranosos que sin-

tetizan biomoléculas 4. aparato digestivo de la célula, que degrada y recicla sus mmponentes 5. modifica y empaqueta las proteínas en vesículas

9. ¿Qué proceso activa las enzimas dentro de los lisosomas? 10. Las glándulas - - -liberan hormonas, las cuales ingresan a la san-

gre y regulan las actividades de órganos, sistemas y aparatos. (a) cilios (b) centríolo (c) Elagelo (d ) centrosoma

7.

1. en las células humanas, se ve como una cola única, larga, con forma de látigo 2. estructuras cortas con forma de cabello que se mueven para producir corrientes en los líquidos 3. haz de microtúbulos que ayuda en la mitosis 4. el centro organizador de los microtúbulos

Las glándulas exocrinas producen secreciones acuosas (como las lágrimas o el sudor) llamadas - - - o soluciones más viscosas llamadas - - -

11. Cite los cuatro tipos principales de tejido. llé un ejemplo de cada uno

)' mencione su ubicación. 12. El órgano más grande y pesado del cuerpo es - - 13. Una cada proteína con su función . Las funciones de la lista pueden ser utilizadas más de una vez. (al cadherina (b) MAC (c) colágeno (d ) conexína (e) elastina (f) fibrilina (g) fibronectina (h) integrina (i) ocludina

l. proteína de membrana utilizada en la for-

mación de uniones celulares 2. glucoproteína de matriz uti lizada para anclar células 3. proteína hallada en las uniones en hendidura 4. proteína de matriz hallada en el tejido conectivo

Capít ulo 3 Compartimentación: células y tejidos

96

14. ¿Qué tipos de glándulas se pueden encontrar en la piel? Nombre la secreción de cada tipo. 15. El término matriz puede ser utilizado en referencia a un orgánulo o a los tejidos. Compare los significados de dicho término en estos dos contextos.

23. 24.

Nivel 2: revisión de conceptos 25. 16. Enumere, compare y contraste los tres tipos de uniones celulares y sus

17.

18. 19.

20.

subtipos. Dé un ejemplo de dónde puede encontrarse cada tipo dentro del cuerpo y describa su función en esa ubicación. ¡Cuáles de estas células tendrán más cantidad de retículo endoplasmático, las pancreáticas que fabrican la hormona proteica insulina o las de la corteza suprarrenal que sintetizan la hormona esteroidea cortisol? Ciertos orgánulos pueden considerarse vesículas. Defina vesícula y describa al menos tres ejemplos. Explique por qué un epitelio estratificado ofrece mayor protección que un epitelio simple. Ejercicio de elaboración de m apas: trnnsforme esta lista de términos en un mapa conceprnal sobre la estructura celular. Agregue las funciones donde corresponda.

• actina

• • • • • • • • •

membrana celular centríolo cilios citoplasma citoesqueleto citosol matriz extracelu.lar flagelos aparato de Golgí

• fihnnento intPrn1Prlin

• • • • • • • •

microfilamento microtúbulo mitocondrias orgánulo no membranoso núcleo orgánulo peroxisoma ribosoma

• RER • vesícula secretora •

actina membrana celular centríolo cilios citoplasma citoesqueleto citosol matriz extracelular flagelos aparato de Golgí filamento intermedio queratina lisosoma

• • • • • • • •

27.

(a) uniones celulares (b ) membrana celular (c) citoesqueleto (d ) orgánulos (e) cilios

1. comunicación

2. 3. 4. 5.

interacciones moleculares compartimentacion propiedades mecánicas utilización de energia biologica

28. En algunos casos, la matriz extracelular puede ser bastante rígida. ¿De qué manera hacen frente a esa matriz rígida los tejidos en desarrollo y expansión para hacerse sitio'

Nivel 3: resolución de problemas

RFl.

en un mapa conceptual sobre la est1·uctura celular. Agregue las funciones donde corresponda. • • • • • • • • • • • • •

26.

del intestino: líquido intersticial, plasma, líquido intracelular. ¿Cuál/es de estos compartimentos líquidos es/son considerado/s líquido/s extracelular/es? Explique cómo la inserción de colesterol en la bicapa fosfolipídica de la membrana celular reduce su permeabilidad. C..ompare y contraste la estructura, las ubicaciones y las funciones del hueso y del cartílago. Mencione las diferencias ent:re los términos de cada ítem: (a) luz)' pared (b) citoplasma y citosol (e) miosina y queratina Cuando un renacuajo se convierte en una rana, su cola se encoge y es reabsorbida. ¿Éste es un ejemplo de apoptosis o de necrosis? Argumente su respuesta. Relacione las estructuras esrndiadas en cada capítulo con la función fisiológica básica de la columna de la derecha y dé un ejemplo o una explicación de cada pa reja. Una estructura puede unfrse a más de una función.

microfilamento microtúbulo mitocondrias orgánulo no membranoso núcleo orgánulo peroxisoma ribosoma

• RER • veskuJa secretora

• REL • vesícula de almacenamiento • tubulina

21. Dibuje un grupo de células epiteliales cilíndricas. Indique los ümites apical y basolateral de las células. Explique brevemente los diferentes tipos de uniones halladas en estas células. 22. Organice los siguientes compartimentos en el orden en el que los encuentrnn las moléculas de glucosa que ingresan al cuerpo a través

(a) uniones celulares (b) membrana celular (c) citoesqueleto (d ) orgánulos (e) cilios

l. comunicaci6n

2. 3. 4. 5.

interacciones moleculares compartimentación propiedades mecánicas utilización de energía biológica

28. En algunos casos, la matriz extracelular puede ser bastante rígida. ¿De qué manera hacen frente a esa matriz rígida los tejidos en desarrollo y expansión para hacerse sitio?

Nivel 3: resolución de problemas 29. Una consecuencia de fumar es la parálisis de los cilios que recubren las vías respiratorias. ¿Qué función cumplen estos cilios? Basándose en lo que ha aprendido en este capíntlo, ¡por qué resulta dañino que los cilios dejen de moverse? ¿Qué problemas de salud espera que surjan? ¡Cómo explica esto la tos seca comun en los fumadores? 30. El cáncer surge de una división celular incontrolada. ¿Qué propiedad de los epitelios podría hacerlos más propensos ( y de hecho lo hace) a desarrollar cáncer? 3 1. ¿Que podna sucederle a la función fisiológica normal si las metaloproteasas de matriz fuesen inhibidas por fármacos?

Respuestas

1

Respuestas a las preguntas de revisión

Página 69 1. Los lípidos de membrana son: fosfolípidos, esfingolípidos y colesterol.

2. Las proteínas integrales de membrana están estrechamente unidas a la membrana. Las proteínas periféricas están unidas laxamente a los componentes de la membrana. Las proteínas pueden ser transmembrana, ancladas a lípidos o estar adheridas laxamente a otras proteínas. 3. Una capa simple pondría las colas de fosfolipidos, que son hidrofóbicas, en contacto directo con los líquidos corporales, que son acuosos.

4. Una sustancia debe atravesar una bicapa fosfolipídica parn ingresar a la célula. Página 74

5. Las fibras citopJasmáticas son: las fibras de actina ( microfilamentos), los filamentos intermedios y los microtúbulos. 6. Sin su flagelo, un espermatozoide sena incapaz de nadar para encontrar el óvulo a fertilizar. 7. El citoplasma está formado por todo el interior celular, exceptuando al núcleo. El citosol es la sustancia semigelatinosa en la cual se encuenh·an suspendidos los orgánulos)' las inclusiones.

8. Los cilios son cortos, habimalmente muy numerosos en una célula y mueven el líquido y las sustancias por la superficie celular. Los flagelos son mas largos, por lo general son únicos eo una célula, en el humano solo existen en el espermatozoide y son utilizados para propulsar a la célula por el líquido. 9. Las proteínas motoras utilizan energía para generar movimiento. Página 76

1O. Una membrana separa los orgánulos del citosol; las inclusiones están suspendidas en el citosol. 11. El RER tiene ribosomas adheridos en su lado citoplasmatico; el REL carece de ribosomas. El RER sintetiza proteínas; el REL sintetiza lípidos. J 2. Los lisosomas contienen enzimas que degradan bacterias y orgánulos envejecidos. Los peroxisomas contienen enzimas que degradan ácidos grasos y moléculas ajenas a la célula. 13. Las membranas de los orgánulos crean compartimentos que aíslan físicamente sus luces del citosol. la doble membrana de las mitocondrias genera dos compartimentos diferentes dentro del orgánulo. J4. Una gran cantidad de mitocondrias sugiere que la célula tiene un alto requerimiento energético, ya que las mitocondrias son el sitio de mayor producción de energía en la célula. l 5. Grandes cantidades de retículo endoplasmático liso sugieren que el tejido sintetiza grandes cantidades de ltpidos, ácidos grasos o esteroides o que neutraliza moléculas e:>.1:rañas. Página 80

16. Las uniones celulares pueden ser: en hendidura (o comunicantes), estrechas ( u oclusivas) y de anclaje. 17. (a) la unión estrecha, (b ) la unión en hendidura, (c) la unión de anclaje (específicamente, el desmosoma), (d) la unión de anclaje (específicamente, la adhesión focal ).

20. Las glandulas endocrinas no poseen conductos y liberan su secreción en la sangre. Las glándulas exocrinas tienen conductos y secretan hacia el medio externo. 21. Los hemidesmosomas se adhieren a la laminina (véasP la tig 3-R). 22. No, ya que la piel tiene muchas capas de células a fin de proteger el medio interno. Un epitelio escamoso simple (de una célula de espesor con células pbnns) no es un epitelio protector. 23. Ésta es una célula endocrina, ya que secreta su producto en el espacio extracelular para su distribución en la sangre. Página 89

24. Los tejidos conectivos poseen una matriz extracelular abundante. 25. El colágeno provee fuerza y flexibilidad, la elastina y Ja fibrilina aportan elastancia, la fibronectina ayuda a anclar las células a la matriz. 26. Los tejidos conectivos incluyen: el hueso, el cartílago, la sangre, los tejidos conectivos densos (ligamentos y tendones), el tejido conectivo laxo y el tejido adiposo. 27. El plasma, la porción líquida de la sangre, rodea las células sanglúneas; por lo tanto, es la matriz extracelular. 28. El cartflago carece de un aporte sanguíneo directo, por lo que el oxígeno y los nuh·ientes necesarios para la reparación deben alcanzar las células por difusión, que es un proceso lento. Página 90

29. La apoptosis es una forma ordenada de muerte celular que elimina las células sin alterar a sus vecinas. Por el contrario, la necrosis libera enzimas digestivas que dañan las células vecinas.

4)

Respuestas a las preguntas de las figuras

Página 81 Página 85

l 8. Los cinco tipos funcionales de epitelios son: el protector, el secretor, el de transporte, el ciliado y el de intercambio. l 9. La secreción es el proceso por el cual la célula libera una sustancia hacia el medio.

Figura 3-9: Las glándulas endocrinas, que no poseen conductos, secretan sus hormonas a la sangre. Las glándulas exocrinas, que sí poseen conductos, secretan sus productos fuera del cuerpo, en Ja superficie de la piel o en la luz de algún órgano que se comunica con el medio externo.

Energía y metabolismo celular La energía en los sistemas biológicos

100 101 101 102

La energía se utiliza para realizar trabajo La energíase presenta en dos formas:cinética ypotencial La energía puede convertirse de una forma en otra La termodinámicaes el estudio de la utilización de la energía

Reacciones químicas 102 La energía se transfiere entrelas moléculas durante las reacciones

103 103 104

La energía de activación pone en marcha lasreacciones La energía se capta o se libera durantelas reacciones El cambio neto de energía libredetermina lareversibilidad de lareacción

Enzimas

105 106 106 107 107

Las enzimas son proteínas Lasvelocidades de reacción son variables Las enzimas pueden ser activadas, inactivadas omoduladas Las enzimas disminuyen la energía de activación de las reacciones Las reacciones enzimáticas pueden ser clasificadas

Metabolismo

11O 111 111 116

Las células regulan sus rutas metabólicas El ATPtransfiereenergíaentre reacciones Las rutas catabólicasproducen ATP Una molécula de glucosa puede generar 30-32 moléculas de ATP Ef metabolismo anaerobio genera 2 moléculas de ATP Las:proteínas son fundamentales para la función celular ADN guía lasíntesis deARN corteyempalme alterhativo crea múltiples proteí~a secuencia ele ADN La traducción del AANm produce una La distribución proteica dirige las pr Las proteínas sufren m

8 a 123

a doctora Ch ristine Schmidt y sus estudiantes de posgrado siembran cél ulas endoteliales aisladas en un medio de cultivo especialmente diseñado y observan su crecim iento. Ellos saben que, si su trabajo tiene éxi to, el tejido obtenido podría algún día reemplazar un vaso sanguíneo del cuerpo. Así como un niño fabr ica una casa con ladrillos de juguete, la bio ingeniera )' sus estudiantes crean tej idos a pa rtir de células. En ambos casos, alguien familiariza do con los componen tes básicos, ladrillos de juguete o células, puede predeci r cuál sen\ el producto final: los ladrillos forman casas; las cél ulas forman tejidos. ¿Por qué, entonces, los biólogos, quienes conocen las características de ácidos n L1cleicos, proteínas, lípidos e hidratos de ca rbo no, no pueden expl icar cómo las combinaciones de esas biomolécu las adquieren los extraordinarios atrib utos de una célula viva? i.Cómo pueden las cél ulas vivas lleva r a cabo procesos que exceden por mucho las p redicciones que podemos rea lizar a parlir del conocimiento de sus componentes individuales? La resp uesta se encuentra en las propiedades emergeutes, esas características d islintivas que no pueden p redeci rse a partir de la s imple suma de las partes constitutivas. Por ejemplo, si se encuentra con un conjunto de pie-,rns y tornillos provenientes de un motor desarmado, i.Se ría usted capaz de predecir (sin conoti miento prev io) q ue, dispuestas correctamente y dada una fuente energética, estas piezas podrían desarrollar suficiente potencia como pa ra desplazar m iles de kilogramos? Las propiedades emergentes de los sistemas b iológ icos son de eno rm e interés pa.ra los científicos que intentan explica r de qué manera un s imple compartimento, como un liposoma fosfol ipidico, pudo haber evol ucionado para dar o rigen a la primera célula viva. Deténgase por un momento y vea si puede hacer una lista con las pro-

L

Enfermedad de Tay-Sachs: una herencia fatal En muchas com un idades judías ultraortodoxas de Estados Unidos (en las cuales los matrimonios acordados son la norma), al rabino se le encomienda una tarea muy importa nte que salva vidas. Lleva un registro confidencial de los individuos que portan el gen de la enfermedad de Tay·Sachs, un trastorno hereditario y mortal que afecta a 1 de cada 3 600 estadounid enses descendientes de judíos de Europa del Este. Los bebés que nace n con esta e nfermedad ra ramente superan los 4 años de edad, y no existe cu ra para ella. Basándose e n los árboles genealógicos que diseña, el rabino puede evitar la boda de dos individuos que portan el gen mortal. Sarah y David, quienes se conocieron trabajando en el periódico universitario, son judíos no ortodoxos. Sin embargo, ambos son conscientes de que su ascendencia judía podría poner en riesgo de pad ecer la enfermedad de Tay-Sachs a sus futuros hijos. Seis meses antes de su boda, deciden consultar a un genetista para determinar si son portadores del gen de la enfermedad de Tay· Sachs.

104

107

110

118

124

Propiedades de los organismos vivos

1. Tienen una estructura compleja cuya unidad básica de organización es la célula

2. Obtienen, transforman, a lmacenan y utilizan energía 3. Detectan y responden a sus medios interno y externo 4 . Mantienen la homeostasis a través de sistemas de control internos con retroali mentación S. Almacenan, utilizan y transmiten información 6. Se reproducen, se desarrollan, crecen y mueren 7. Tienen propiedades e me rgentes que no pueden predecirse a partir de la simple suma de sus partes 8. Los individuos se adaptan y las especies evolucionan

piedades q ue caracterizan a todos los seres vivos. Si usted fuera un científico y observara íotograftas y muestras proven ien les de Marte, ¿qué buscaría para determinar si hay vida en ese planeta? Ahora compare su lista con la del • Cuadro 4- l. Los organismos vivos son entidades altamente organizadas y complejas. 1nduso una bacteria unicel ula r, a pesar de parecer simple bajo el microscopio, posee una complejidad sorp renden te en el n ivel q uím ico de organización. Utiliza reacciones bioquímicas in trincadamente interconectadas para obtener, transformar, almacenar y utilizar energía e info rmación. Detecta los cambios en sus medios interno)' externo y responde para conservar la horneostasis. Se reproduce, se desarrolla, crece y muere; con el tiempo, su especie evol uciona. La energía es esencial para estos procesos que asociamos con los se res vivos. Sin energía para crecer, para repara rse y para mantener el med io interno, Lula célula e,s como un pueblo fantasma lleno de edificios que se desmoronan len tamente hasta convertirse en ruinas. Las células necesitan energía para impor tar materias primas, producir nuevas moléculas )' reparar o reciclar las partes que envejecen. La capacidad de las células pa ra extrae r energía del med io externo y utilizarla para mantenerse como unidades o rgan izadas y funcionales es una de sus características más destacadas. En este capítulo estudiaremos los procesos celulares mediante los cuales el cuerpo humano obtiene energía y mantiene sus sistemas o rdenados. Usted aprenderá cómo las in teracciones p roteicas in tervienen en la actividad enzimática y cómo los compartimentos subcelulares separan diversos pasos del metabolismo energélico.

La energía en los sistemas biológicos El movimiento tid ico de energía en tre el medio ambiente y los organ ismos vivos es uno de los conceptos fundamentales en biología . Todas las células utiliza n energía de su medio ambiente para crecer, generar nuevas partes )' reproducirse. Las p lan tas captan la energía

99

LEYENDA Transferenda de energia radiante o de energía térmica

E¡¡ergíá 1ermica

Transferencia de energía en enlaces químicos

P erdida de enen,¡ia had a el medio amb1-ente

Energía radiante

Ener9fa pata el trabajo

co2

_.

la fotosíntesis se lleva a cabo en las células de las plantas y genera:

Energía almacenada en biomoléculas

La respiración se lleva a cabo en las células humanas y genera:

+ Energ~a almacenada

en bfomotéculas

• FIGURA 4·1 Transferencia de energía en el medio ambiente. Las plantas captan la energía radiante d el sol y la almacenan en los en laces químicos de las biomoléculas. Los animales comen las plantas y ut ilizan su energía o la al macenan.

radiante del sol y la almacenan como energía de enlaces químicos a través del proceso de fotosíntesis t• Fig. 4- 1). Extraen carbono y oxígeno del dióxido de carbo no, n itrógeno del suelo e hidrógeno y oxígeno del agua para producir biomoléculas como glucosa y aminoácidos. Por otro lado, los an imales no pueden e.aptar la energía del sol ni utilizar el ca rbono del a ire o el nitrógeno del suelo para si ntet izar sus biomoléculas. Ellos deben impo rtar la energía de en laces químicos ingi riendo las biomoléculas de plantas u otros an imales. En última instancia, sin embargo, es la energía captada por la fotosíntesis la que actúa como fuente energética para todos los an imales, incluyendo los seres humanos. Los an imales extraen la energía de las biomoléculas a través de la respiración, la cual consume oxígeno y produce d ióxido de carbono y agua. Si los an imales ingieren m,\s energía que la necesaria para su uso inmediato, el exceso de energía es almacenado en forma de en laces quím icos, al igua l q ue en las plantas. Las moléculas de glucógeno ( un polímero de glucosa) )' de lípidos son las principales reservas de energía en los an imales. Estas moléculas de almacenamien to están dispon ibles para su utilización en los momen Los en que las necesidades energéticas del animal exceden lo apo rtado por la ingesta de alimen tos. (

Revisión

( _ : ;QuébiomoléaJlas siempre inclu~n nitrógeno en su estructura química?

La energía se utiliza para realizar trabajo Todos los seres vivos obtienen, a.lmacenan y utilizan energía para impulsar sus actividades. Energía puede defi n irse como la capacidad para generar Lrabajo, pero ¿qué es traba:io? Utilizamos la palabra trabajo en la vida cotid iana para referimos a diversas s ituacio nes, desde martilla r un clavo hasta sentamos en un escriLorio a escrib ir un artículo. Sin embargo, en los s istemas biológicos, la pa labra trabajo significa una de tres cosas específicas: trabajo q uím ico, trabajo de transporte o trabajo mecánico. El trabajo q uímjco se refiere a la formación y ruptura de enlaces químicos. Esto perm ite a las cél ulas y a los o rgan ismos crecer, mantener un medio interno adecuado y almacenar la info rmación necesa ria pa ra la reproducción y otras activ idades. La formac ión de los en laces químicos de una proteína es un ejemplo de trabajo q ttím ico. El trabajo de transporte permite a las cél ulas trasladar iones, moléculas y panículas más gra ndes a través de la membrana celular)' a través de las membranas de los orgán ulos dentro de la cél ula. El trabajo de tra nsporte es particularmente útil para la generación de gradientes de concentración, que son distribuciones de moléculas en las que la concentración es ma)'O r en un lado de la membrana que en el oLro. Po r ejemplo, ciertos tipos de retículo endoplasmático utilizan energía para importar iones calcio desde el citoso l. Este transporte iónico genera una alta concen Lración de calcio den lro del o rgánulo y

una baja concentración en el citosol. Si luego el calcio se libera de vuelta hacia el citosol, se genera una "señal de calcio" q L1e hace que la cél ula realice alguna acción, como la contracción muscular. En los an imales, el trabajo mecán ico se utiliza para el movimiento. A n ivel celular, el movimiento inclu)'e el desplazam iento de orgánulos dentro de la célula, los cambios de la forma celular y el movimiento de cilios y llagelos. A n ivel macroscópico, en los anima les, el movimiento consiste habitualmente en la contracción muscular. La mayor parte del trabajo mecánico es mediado por proteínas motoras que conforman íibras y illamentos intracelulan~s del citoesqueleLo.

La energía se presenta en dos formas: cinética y potencial La energía se puede clasificar de varias maneras. Free u en temen Le pensamos en la energía en los términos que empleamos diariamente: energía térmica, energía eléctrica, energía mecánica. En este caso, nos referimos a la energía almacenada en los enlaces químicos. Cada tipo de energía tiene sus propias características. Sin embargo, todos los Lipos de energía rnmparten la capacidad de presentarse en dos formas: como energía cinética o como energía potencial. La energía cinética es la energía del movim iento ( kinetikos, movimiento ). Una bola q ue rueda cuesta abajo por una colina, las moléculas de perfume que se dispersan por el aire, la corriente eléctrica que se desplaza por las líneas eléctricas, el calor que cal ienta una sartén)' las moléculas que se desplazan a través de las membranas biológicas son ejemplos de cuerpos que poseen energía cinélica. La energía potencial es energía almacenada. Una bola ubicada en la cumbre de w1a colina posee energía potencial porque tiene el potencial para iniciar el movimiento cuesta abajo por la colina. Una molécula que se encuen tra en el lado de alta concentración de un gradiente de concentración almacena energía potencial porque tiene el potencial para moverse en favor del gradiente. En los enlaces químicos, la energía potencial está almacenada en la posición de los electrones que forman el enlace. (Para aprender más sobre energía cinét ica y energía potencial, véase el Apéndice B. J

(a) El trabajo es utilizado para subir la pelota por la rampa. La energía cinética de este movimiento se almacena como energía potencial

Una característica clave de todos los tipos de energía es la capacidad de la energía potencial para convertirse en energía cinética )' viceversa.

La energía puede convertirse de una forma en otra Recuerde que una definición general de energía es la capacidad de generar trabajo. El trabajo siempre implica movimiento y, por lo tanto, se asocia con la energía cinética. La energía potencial también puede ser utilizada para generar trabajo, pero primero debe ser convertida en energía cinélica. La conversión de energía potencial en energía cinética n unca es 100% eíiciente y cierta cantidad de energía se pierde hacia el entorno, habitualmente en forma de calor. la cantidad de energía que se pierde en la transformación depende de la efi.cie11cia del proceso. Muchos procesos fisiológicos del cuerpo humano no son eficientes. Por ejemplo, el 70% de la energía util izada durante el ejercicio físico se pierde en forma de calor en lugar de ser transformada en trabajo muscular de contracción. La • Figura 4-2 resume la relación entre energía cinética y energía potencial:

2

3

La energía cinética de la pelota en movimiento se Lnu1sforma en energía potencial a medida que el trabajo se utiliza para subir la pelota po r la rampa (Fig. 4-2a ). La energía potencial se almacena en la pelota en reposo en la parle superior de la rampa / Fjg 4-?h ). No se está desarrollando trabajo, pero la capacidad para hacerlo está almacenada en la posición de la pelota. La energía potencial de la pelota se convierte en energía cinética cuando la pelota rueda cues ta abajo por la rampa (Fig. 4-2c). Parle de la energía cinética se pierde hacia el enlomo en fo rm a de calor debido a la fricción entre la pelota, el aire y la rampa.

En los sistemas biológicos, la energía potencial se almacena en los gradientes de concentración y en los enlaces químicos, y se transforma en energía cinética cuando es necesario realizar Lrabajo quím ico, mecánico o de transpone.

(b) La pelota situada en la parte superior de la rampa tiene energía potencial, es decir, el potencial para generar trabajo.

c1P. lri nn!\ic:ión c1P. l::i nP.lnt::i. • FIGURA 4-2 Relación entre energía cinética y energía potencial

(e) La pelota que rueda cuesta abajo por la rampa convierte la energía potencial en energía cinética. Sin embargo, la conversión no es totalmente eficiente. y algo de la energía SP. oiP.rc1P. P.n fnrm::i c1P. r.::ilnr c1P.hic1n ;,i l;,i frir.c:ión

La termodinámica es el estudio de la utilización de la energía

la energía se transfiere entre las moléculas durante las reacciones

Dos reglas básicas rigen la transferencia de euergía en los sistemas biológicos y en el universo en su toLalidad. La primera ley de la termodinámica, también conocida como ley de conservación de la e11ergír1, esLablece que la cantidad Lota! de energía en el universo es consLante. El universo es considerado un sistema cen-ado: nada enLra y nada sale. la energía se puede convertir de un tipo a otro, pero en un sisLema cerrado nunca cambia la cantidad total de energía. Sin embargo, el cuerpo humano no es un sisLema cerrado. Es un .sistema abierto, que intercambia sustancias y energía con su entorno. Debido a que nuestros cuerpos no pueden crear energía, la "importan" desde el exterior a Lravés de los al imenLos. De la misma manera, nuestros cuerpos pierden energía hacia el medio ambiente, especialmente en forma de calor. La energía que permanece en el cuerpo puede transformarse de un tipo a oLro o ser utilizada para generar trabajo. la segunda ley de la termodinámica establece q ue los procesos naLurales esponLáneos fluyen desde un estado de orden ( no aleaLoriedad) hacia un estado de desorden o aleaLoriedad, también conocido como entropía. La generación y el mantenimiento del orden en un sistema abierto como el cuerpo humano requieren un apo rte de energía. El desorden ocurre cuando los sistemas abierLos pierden energía hacia su enlomo sin recuperarla. Cuando e.sLo sucede, se dice que la enLropía del sistema abierto ha aumentado. La analogía del pueblo fantasma mencionado anteriormente ilustra la segunda ley. Cuando la gente invierte su energía en actividades realizadas lejos del pueblo, este se deteriora JenLamente )' se vuelve menos organizado (su entropía aumenta). De un modo similar, sin un aporte continuo de energía, una célula es incapaz de mantener el orden de su medio inLerno. A medida que la célula pierde su o rganiLación, desaparece su capacidad para llevar a cabo las funciones normales y muere. En lo que resta de este capítulo, usted aprenderá cómo las células obtienen la energía contenida en los enlaces químicos de las biomoléculas y la almacenan en ellos. Utilizando las reacciones químicas, las células transforman la energía potencial de los enlaces qttímicos en energía cinética para crecer, mantenerse, reproducirse y moverse.

En una reacció n qtúmica, una sustancia se convierte en oLra habitualmente mediante la ruptura o la formación de enlaces covalenLes. Una reacción comienza con una o más moléculas llamadas reactivos y fi. naliza con una o más moléculas llamadas productos (a Cuadro 4-2). En el análisis que sigue, consideraremos una reacción que comienza con dos reactivos y finaliza con dos productos:

Revisión

A+l3~C+D La velocidad a la cual se desarrolla la reacción ( velocidad de reacció n) es la velocidad de desaparición de los reactivos (A y 13) o la

velocidad de formación de los productos (C )' D ). La velocidad de reacción se mide como el cambio en la concentración en un período de tiempo determinado y frecuentemenLe se expresa como moles por segundo (Mis). El objetivo de las reacciones químicas celulares puede ser la transferencia de energía de una molécula a otra o la utilización de la energí,1 almacenada en las moléculas reactivos para desarrollar Lrabajo. la energía potencial almacenada en los enlaces q uímicos de una molécula se conoce como energía libre de dicha molécula. Generalmente, las moléculas complejas tienen más enlaces químicos y, por lo tanto, más energía libre. Por ejemplo, una gran molécula de glucógeno tiene más energía libre que una sencilla molécula de glucosa, la cual, a su vez, tiene m¡\s energía libre que las moléculas de dióxido de carbono y agua a partir de las cuales fue sintetizada. La gran cantidad de energía libre de las moléculas complejas, como el gl ucógeno, es la razón por la cual estas moléculas son utilizadas por las células para almacenar energía. Para comprender cómo las reacciones quím icas Lransfieren energía enLre las moléculas, debemos responder dos pregunLas. Primero, ¿cómo se ponen en marcha las reacciones? La energía requerida para iniciar una reacción se conoce como energía de activación. Segundo, ¿qué sucede con la energía libre de los productos y los reactivos durante una reacción? La diferencia de energía libre entre reactivos y productos es el cambio neto de energla libre de la reacción.

Reacciones químicas

2. Mencionedos formas que tienenlos animales para almacenar e~rgía ensus cue;pos. 3. ¿Cuál es la diferencia entre energía cinética yenergía potencial?

4. ¿Qué es laentropía?

J

Reacciones químicas Los organismos vivos se caracterizan por su capacidad para obtener energía de su entorno y ulilizarla para sosLener los procesos v iLales. El estudio del íl ujo de energía a través de los s isLemas biológicos se conoce como bioenergética (bios, vida,+ en-, en,+ ergo11, trabajo). En un sistema b iológico, las reacciones químicas son un medio crucial para la transferencia de energía desde una parte del sistema hacia otnt.

Tipo de reacción

Reactivos (sustratos)

Productos

Combinación

A + 8

e

Descomposición

e

A + 8

Desplazamiento simple*

L + MX

LX+ M

Desplazamiento doble*

LX + MY

LY + MX

• X e Y representan átomos, iones o grupos químicos.

La energía de activación pone en marcha las reacciones

1------

l

Activación de

La energía de actjvación es el aporte inicial de energía necesario para

si tuar los reactivos en una posición que les penn ita reaccionar ent re sí. Este "empuje" necesario para iniciar la reacción se muestra en la a Figura 4-3a como la pequeña colina po r la cual debe subirse la pelota ante, de que pueda rodar cuesta abajo por sí misma. Una reacción con baja energía de activación sucede espontáneamen te cuando los reacLivos se juntan. Se puede observar una re,1cci611 espo11t1111ea al verter un poco de vinagre sob re bicarbonato de sodio, tras lo cual los dos reactivos fo rman dióxido de c¡u·bono. Las reacciones con energías de activación elevadas no ocurren de manera espontánea o suceden demasiado lentamente como para ser útiles. Por ejemplo, si se v ierte vi nagre sobre una porción de mantequilla ocurre una reacción que no puede observarse.

La energía se capta ose libera durante las reacciones Una propiedad característica de cualquier reacción química es el cambio de energía libre que ocurre a medida que se desarro lla la reacción. Los productos de una reacción tienen más o menos energía libre que los reaclivos. Un cambio en el nivel de energía libre sign ifica que la reacción ha liberado o ha captado energía. Si la energía libre de los productos es menor que la de los reaclivos, como en la Figura 4-3b, la reacción libera energía y se llama reacción exergón ica (ex-, fuera,+ ergon, trabajo). La energía liberada por una reacción exergón ica, o productora de energía, puede ser ulilizada por otras moléculas para realizar trabajo o ser emi tida como calor. En algunos casos, la energía liberada por una reacción exergónica es almacenada como energía potencial en un gradiente de concentración. Un importante ejemplo b iológico de reacción exergónica es la combinac ión de ATP y agua para formar ADP, fosfato inorgán ico ( P1) y H-. Durante esta reacción se libera energía cuando se rompe el enlace fosfaLO de alla energía de la molécula de ATP:

energía /

_ F ) - Reactivos

~ libre Nivel de energía inicial

=o~

~O

'o Nivel de energía Libre final

i

-

_g

o

E

.!!1

Reactivos

_

Activación de la reacción _ _ Avance de la

.!ll :,

i

A+B

Cambio neto de energía libre

Q)

u i!:

~ ,!!!

reacción - - Productos

e> Q)

e UJ

C+O

- - - - - - - T iempo- - - - -- . (b) las reacciones exergónicas liberan energia, ya que

sus productos tienen menos energía que los reactivos.

t

- +---

G+H

gfa dé ac


-

'..... -

-

ADP + P; + H + energía 0

Ahora compare la reacción exergón ica de la Figura 4-3b con la reacción representada en la Figura 4-Jc. En esta, los producLOs retienen parte de la energla de activación añadida y hacen que su energía libre sea mayor que la de sus reactivos. Estas reacciones que requieren un apo rte neto de energía se denominan reacciones endergórucas (end[oj, dentro,+ ergon, trabajo) o 11tili:wdoras de energfa. Parte de la energía añadida a una reacción endergónica permanece atrapada en los en laces químicos de los productos. Estas reacciones consumidoras de energía son frecuentemente reacciones de síntesis, en las que se crean moléculas complejas a partir de moléculas más pequeñas. Por ejemp lo, una reacción endergónica ensambla muchas moléculas de glucosa para formar glucógeno (un polímero de glucosa). la compleja molécula de glucógeno tiene más energía libre que las moléculas de glucosa individuales util izadas en su formación.

- - - - ~º~º·

LEYENDA

E+F

~

--......_ tr: •o

(a) La energía de activación es el "empuje" necesario para iniciar la reacción.

1- --'--

ATP + H2O

Productos

Cambio neto deenergia

_ _ _ _ _ _ _Tiempo _ _ _ _ __. (e) Las reacciones endergónicas capturan parte de la energía de activación dentro de los productos, los cuales tienen, entonces,

......~ ... ,.....,,.,.,,,..:,. ta-....... ..., ,,... ,,,.. ................t;.,...,..

• FIGURA 4-3 Energía de activación y reacciones exergónicas y endergónicas

Si una reacción capta energía a medida que sucede en una d irección (A + 13 ~ C + D ), liberará energía a medida que ocurre en la dirección opuesta (C + D ~A+ 13) (la denominación de las direcciones de la reacción es arbitraria). Por ejemplo, la energía au·apada en los enlaces del glucógeno durante su sín tesis es liberada cuando se degrada nuevamente en glucosa.

Acoplamiento de las reacciones e11derg6nicas y exergónicas ¿De dónde proviene la energía de activación para las reacciones metabólicas? La manera m¡ís sencilla q ue Liene una célula para obtener energía de activación es acoplando una reacción exergónica con una endergón ica. Algunas de las reacciones acopladas más conocidas son aquellas que utilizan la energía liberada por la rupLura del enlace de alta energía del ATP para iniciar una reacción endergón ica:

ATP

ADP+ P;

E+F - - "----_::::,,..,.=~::::_----'l• ~ G+H

En este tipo de reacciones acopladas, ambas reacciones se producen simultáneamente y en el mismo lugar, de modo que la energía del ATP puede ser utilizada inmediaLamente para impulsa r la reacáón endergónica entre los reacLivos E y F. Sin embargo, no siempre resulta práctico que las reacciones se encuenLren acopladas de este modo. Como consecuencia, las células vivas han desarrollado formas de capt11r la energía liberada por las reacciones e,xergónicas y de gua rdarla para su utilización posterior. El método más común es atrapar le energía en forma de electrones de alta energía transportados por nucleótidos. Las moléculas de los nucleótidos NADH, FADH 2 y NADPH almacenan energía en los electrones de sus áLomos de hidrógeno (• Fig, 4-4). El NADH y el FADH 2 habitualmente transfieren la mayor pa rle de su energía al ATP, el cual luego puede se r utilizado pa ra impulsar reacciones endergónicas.

El cambio neto de energía libre determina la reversibilidad de la reacción El cambio neto de energía libre de una reacc1on cumple un papel impo rtante en la determinación de la reversibilidad de dicha reacción, ya q ue el cambio neto de energía libre de la reacción directa contribuye a la energía de activación de la reacción inversa. Una reacción q uímica que puede ocurrir en ambos sentidos se denomina reacción reversible. En una reacción reversible, la reacción directa A+ 13 ~ C + D tiene la misma p robabil idad de ocurrir que la reacción en el sentido inverso C + D ~ A + 13. Si una reacción ocurre en un sentido pero no en el o lro, es una reacción irreversible.

rLas reacciones exergónicas ~

~

liberan energía

Energía calóñca

~ ENERGÍA ~ + liberada

la enfermedad de Tay-Sachs es un trastorno devastador. Normalmente, los lisosomas celulares contie nen enzimas q ue digieren partes viejas y desgastadas de la cél ula. En la enfe rmedad de Tay-Sachs y las enfermedades de almacenam iento lisosomal similares ocurren mutaciones genéticas de las enzi mas lisosomales, las cuales o no existen o se vuelven ineficaces. l as personas q ue padece n la enfermedad de Tay-Sachs ca recen de la enzima hexosaminidasa A, la cual digiere los glucolípidos llamados gangliósidos. Como resultado, los ga ngliósidos se acumulan en las neuronas cerebra les, lo que hace que se hinchen y funcionen anormalmente. l os niños con la enfermedad de Tay-Sachs pierden lentamente el control muscu lar y la función cerebral. Actualmente no existe tratamiento ni cura para esta enfermedad, y los niños afectados mueren habitualmente antes de cumplir los 4 años de edad. P1:

La hexosaminidasa A también es necesaria para eliminar los gangliósidos en las células fotosensibles del ojo. Teniendo en cuenta esta información, ¿q ué otro síntoma, además de la pérdida del control muscular y de la función cerebral, es esperable encontrar en la enfermedad de Tay-Sachs?

99

107

11O

118

124

Por ejemplo, observe la energla de activación de la reacción C + D ~ A + B en la • Figura 4-5. Esta reacción es la inversa de la reacción de la Figura 4-3b. Debido a que se libera una gran cant idad de energía en la reacción A + 13 ~ C + D, la energía de activación de h1 reacción inversa es considerable ( Fig. 4-5). Usted recordaní que cuanto mayor sea la energía de aclivación, menor será la probabilidad de que esa reacción ocurra espontáneamente. En teoría, todas las reaccicrnes pueden ser revertidas con un aporte s uficiente de energía, pero algunas reacciones liberan tal cantidad de energía que son esencialmente irreversibles. Mientms estud ia fisiología, usted se encontrará algunas reacciones irreversibles. Sin embargo, la ma)'Oría de las reacciones biológicas son reversibles: si la reacción A + 13 ~ C + Des posible, entonces también será posible la reacción C + D ~ A + B. las reacciones reversibles se muestran con llechas en ambos sentidos: A + 13 ~ C + D. Una de las

Los nucleótidos capturan y transfieren energía y electrones.

NADPH Bectrones de alta energía

NADH

ENERGÍA Útilizada

+

~

e;

§

Las reacciones endergónicas no ocurren sin un aporte de energía.

• FIGURA 4·4 Transferencia y almacenamiento de energía en las reacciones biológicas. La ener-

gía liberada por las reacciones exergónícas puede ser captada por los electrones de alta e nergía del NADH, FADH 2 o NADPH. La energía que no se capta es emitida en forma de calor.

1

¡ --~

-~

g

LEYENDA Reactivos Activación de la reacción Avance de la reacción

1

Energía de activación

A+B

~ Q)

Productos

Cambio neto de energía libre

-o ~

~

-e>~ -- -- -- -- -- -- -- -Ji i---~ C+D - - - - - - T i emp o - - --

G

PREGUNTA ¿Esta reacción es endergónica o exergónica?

• FIGURA 4·5 Algunas reacciones tienen energías de activación

e leva das

principales rnzones por las cuales las reacciones biológicas son reversi· b les es que reciben a)'uda de proLeínas especializadas llamadas enzimas. Revisión S. ¡Cuál es ladiferencia entre reacciones endergónicas y exergónicas?

las enzimas son proteínas La mayo r1a de las enzimas son p rote!nas grandes con formas tridimensionales complejas, aunque recientemente se ha decub ierto q tte el ARN también puede actuar a veces como un catalizado r. Como o tras proteínas que se unen a susLraLos, las enzimas proLeicas p resentan especi l1 cidad, competición y satttración. Algunas enzimas se presentan como una variedad de formas relacionadas ( isoformas) y se conocen como isoenzimas t iso-, igual). Las isoenzirnas son enzi mas que catalizan la misma reacción, pero bajo diferenLes condiciones o en diferentes tej idos. Las estructuras de las isoen:limas relacionadas son ligeramen te diferentes, lo que genera la variabilidad en su actividad. Muchas isoenzimas tienen esLructuras complejas formadas por múltiples cadenas proteicas. Por ejemplo, la enzima lactato desliidrogenasa (LDH) tiene dos tipos de subunidades, llamadas H y M, que se ensamb lan formando tetrámeros (grupos de cuatro). Las isoenzimas de la LDH incluyen la H,, la H, M, y la M, . Las diferentes isoenzimas de la LDH son específicas de tejido e incluyen una detectada pr incipalmente en el corazón )' otra, en el músculo esq uelético y el hígado. Las isoenzimas cumplen un papel importan te en el d iagnóstico de determ inados trastornos médicos. Por ejemplo, en las horas siguientes a un infarto de miocardio, las células cardíacas da11adas liberan enzimas al torrente sanguíneo. Una manera de determinar si el dolor de pecho de una persona se debe efectivamente a un infarto cardíaco es buscar niveles elevados de isoenzimas cardíacas en la san gre. En el • Cuadro 4. 3 se listan algunas enzimas de importancia diagnóstica y las enfermedades que indican.

6. Si se mezcla bicarbonato desodio yvinagre enun recipiente, la mezcla reacciona yproduce

espuma, liberando dióxido áe carbono gaseoso. Nombre e!Aos reaclivo/s yelAos produc· to/s de esta reacción. 7. ¡Piensa que la rea1:ción de la pregunta 6es endergónica oexergónica? ¡Es una reacción reveisible?Respalde sus respuesta~

Enzimas

Enzimas de importancia diagnóstica

Niveles e n sa ng re e levados d e estas e nzimas sug ie re n las patolo g ías de la li sta.

Las en1.imas son proLeínas que aceleran las reacciones químicas. Durante estas reacciones, las moléculas enzimáLicas no se modifican de n inguna manera, lo que signi fica que act(mn como catalizadores biológicos. Sin las enzimas, la mayoría de las reacciones quím icas celulares ocurrirían tan len Lamente que la célula no sería capaz de sobreviv ir. Debido a que una enzima no se modifica de fo rma permanenLe ni se consume en la reacción que cataliza, podríamos incorporarla en la ecuación de una reacción de la siguien Le manera: A + B +enzi ma~ C + D + enzima Esta forma de escribir la reacción expresa cómo la enzima interactúa con los react ivos A y B pero permanece sin cambios al final de la reacción. Una forma abreviada -más común- de escribir las reacciones enzimáticas es colocando el nomb re de la enzima sobre la llecha de la reacción de esta manera:

Enzima

Enfermedades reladonadas

Fosfa tasa á cid a*

Cánce r d e p róstata

Fosfa tasa alcalina

Enfe rmeda d ó sea o h epática

Am ilasa

Enfe rmeda d pa ncreática

Creatincin asa (CK)

Infarto d e miocardio, e nfe rmeda d mu scu lar

Gluta mato desh idro genasa (GDH)

Enfe rmedad he pática

Lactato desh idroge nasa (LDH)

Da1'io tisu lar ca rd íaco, hepá tico, e n mú scu lo e squ elé tico; destrucció n de g lóbulos rojos

A+ l3 e11zima._ C + D

En las reacciones catalizadas por enzimas, los reactivos reciben el nombre de sustratos.

• Una nueva prueba diagnóstica para la detección de una molécula llamada antígeno prostático específico (PSA) ha reemplazado la prueba para la detecáón de fosfatasa ácida en el diagnóstico del cáncer de próstata.

ción [Cl[D ]/ [Al[13]. De acuerdo con la ley de acción de masas, la p ro porc ión de [CJ )' [D] con respecto a [AJ y [13) es siemp re la misma en el equilibrio.

Estudiandolas isoenzimas Una forma de determinar qué isoenzimas están presentes en una muestra tisu lar es la utilización de una técn ica conocida como electrofores is. En esta técnica, una sol ución proveniente de una muestra tisu lar se coloca en un extremo de un contenedor ll eno con un gel de polímero de poliacrila mida. Luego se hace pasar una corriente eléctrica a través del gel, lo cual hace que las proteínas cargadas negativamente se desplacen hacia el extremo positivo del gel. La velocidad a la que se desplazan las proteínas depende de su tamaño, su forma y la ca rga eléctrica de sus aminoácidos. A medida que las proteínas se desplazan por e l gel a diferentes velocidades, se separan unas de otras y aparecen como bandas individuales coloreadas cuando se las tiñe con una tinción llamada azul de Coomassie o con plata. La electroforesis puede separa r mezclas de macromoléculas cargadas como proteínas yADN.

Las velocidades de reacción son variables l a velocidad de una reacción enzimática se mide determ ina ndo lo rápidamente que se sin tetizan los productos o se consumen los sustratos. La velocidad de reacción puede ser modificada por varios factores, incluyendo cambios en la temperatura, la cantidad de enzima presente y las concentraciones del sustrato. En los mamíferos, se con sidera que la temperatura es esencialmente constante, lo que nos deja con la cantidad de enzima y con la concentración de sustrato corno las dos variables principales que afectan la velocidad de una reacción. En las interacciones de un ión a las proteínas, si la cantidad de proteína (en este caso, una enzima) es constante, la velocidad de reacción es proporcional a la concentración del sustrato. Una estrategia que utilizan las células para controlar las velocidades de reacción es regula r la cantidad de enzima. Ante la ausencia de la enzima adecuada, muchas reacciones biológicas ocurren muy lentamen te o, d irectamente, no suceden. Si la enzima está presente, la velocidad de la reacción es p roporcional a la can tidad de enzima y a la cantidad de sustrato, a menos que haya suficiente sustrato para llegar a saturar todos los lugares de unión de la enzima, la cual se encontraría trnbajando ya al máximo de su capacidad. Esto parece simple hasta que consideramos las reacciones reversibles que pueden ocurrir en ambas direcciones. En ese caso, ¿qué es Jo que determ ina el sentido en que ocurre la reacción? La respuesta es que las reacciones reversibles tienden hacia un estado de equilibrio, donde la velocidad de reacción en la dirección direct,1 (A + B ~ C + D) es igual a la velocidad de la reacción inversa (C + D ~ A + B). En el equilibrio no hay cambio neto en la can tidad de sustrato o de producto, y la proporción [Cl[ DJ / [Al[13] es igual a la constante de eqtÚ!ibr io de la reacción K,q" Si se agregan o se eliminan sust ratos o productos a través de otras reacciones de una rula enzimática, la veloc idad de reacción aumenta en la direcció n que corresponda para restablecer la propo r-

Las enzimas pueden ser activadas, inactivadas o moduladas La activ idad enzimática, así como la actividad de otras proteínas solubles, puede verse modificada por varios factores. Alg unas enzimas son sintetizadas corno moléculas inactivas (proe11zim11s o zim6ge11os) y son activadas dependiendo de la necesidad mediante activación proteol.ítica. Otras requieren la unión de cofactores inorgán icos, como Ca'· o Mg'·, para pode r activarse. Los cofactores orgán icos de las enzimas se denominan coenz.imas. Las coenzimas no modifican el lugar de un ión de la enzima, corno sí lo hacen los cofactores ino rgánicos. Por su parte, las coenz imas actúan como receptores y transportadores de átomos o grupos funcionales que son eliminados de los sustratos durante la reacción. A pesar de que las coenzimas son necesarias para que puedan ocurrir determ inadas reacciones metaból icas, no se necesitan en grandes cantidades. Muchas de las sustancias que llamamos vitaminas son precursores de coenz imas. Las vitaminas hidrosolubles, corno las vitam inas del complejo 13, la vi tam ina C, el ácido iólico, la biolina y el ácido pantoténico, se convierten en coenzimas necesarias para diversas reacciones metabólicas; por ejemplo, la vitamina C es necesaria para la síntesis adecuada de colágeno. Las enzimas p ueden inactiva rse por la acción de inh ibidores o al desnatu ralizarse. La actividad enzimática puede modularse media nte factores químicos o po r camb ios en la temperatura y el pH. La • Eigurn 4-6 muestra cómo p uede var iar la actividad enzimática en un rango de valo res de pH. Una célula p uede regular el flujo de biomoléculas a través de diferentes rutas sin téticas y productoras de

l

rJ

~ E

¡¡¡

e ·¡¡ o

-o

~

., "v "·¡¡"'o 22

~ 1

5

6

7 pH

8

9

La mayoría de las enzimas en el ser humano tiene una actividad óptima alrededor del pH del interior del cuerpo. que es de 7.4.

@

PREGUNTA

Si el pH disminuye de 8 a 7,4, ¿qué sucede con la actividad de la enzima?

• FIGURA 4-6 Efecto del pH en la actividad enzimática

energía mediante la aclivación y la inhibición de las reacciones o a umentando y disminuyendo la veloc idad de dichas reacciones.

Las reacciones enzimáticas pueden ser clasificadas La mayoría de las reacciones catalizadas por enzimas pueden ser cla-

Revisión

8. ¿Cuál es una de las ventajas biológicasde la mstencia de múltiples isoenzimas para una

dete1minada reacción en lugar de una sola forma de la enzima? 9. ¿De qué nivel de estrtJctura proteica son un ejemplo las cuatro cadenas proteicas de una isoenzima de LDH, (a) priman.;, (b) secundaria, (c) terciaria o {d) cuaternariél

Las enzimas disminuyen la energía de activación de las reacciones ¿Cómo hace una enzima para aumentar la velocidad de una reacción? En térm inos de termodinámica, disminuye la energía de activación y hace más probable que la reacción comience (• Fi g. 4-7). Las enzimas logran esto un iéndose a sus sustratos y coloc,\ndolos en la mejor posición para que reaccionen en tre sí. Sin las enzimas, la reacción depen dería de q ue se produjesen las colisiones aleatorias adecuadas entre las moléculas de sustrato para lograr alinearlas. La velocidad de una reacción catalizada por una enzima es mucho mayor que la velocidad de la misma reacción sin la enzima. Por ejemplo, consideremos la anhidrnsa carb6nica, la cual facilita la conversión de Cü, yagua en ácido carbónico. Esta enzima cumple un papel importante en el transporte del CO1 de desecho desde las células hacia los pu lmones. A cada molécula de anhidrasa carbónica le lleva un segundo cataliza r la conversión de l millón de moléculas de C(\ y agua en ácido carbónico. En ausencia de la enzima, se necesita más de un minuto para que una molécula de CO, y agua se conviertan en ácido carbónico. Si n la anh.idrasa carbónica y otras enz imas del cuerpo, las reacciones b iológicas ocurrirían tan len tamente que las cél ulas no podrían viv ir.

Energía de activación sin la enzima

l (ü

:i

-ál

o

-

¡..._ _ _....,, /

A+B

activaciónen

-

, presencia de la enzima -

Reacciones de oxidorred11cci6n Las reacciones de oxidorreducción son las más impo rtantes para la extracción y transferencia de energía en las células. Estas reacciones transfieren electrones de una molécula a olra. Cuando una molécula gana electrones se d ice q ue se reduce. Una manera de in terpretar esto es recordando que al agregar electrones con carga negativa se reduce la carga eléclrica de. la molécula. Por el contrario, cuando las moléculas ceden electrones se d ice que se oxidan.

Reacciones de hidr6lisis-de.shitlrat.aci6n Las reacciones de hidról isisdeshidratación son importantes para la degradación y síntesis de grandes biomoléculas. En las reacciones de deshidrntación (de-,

LEYENDA Menor energía de

- ,- , - ... ,,

/

sificadas en cualro categorías: reacciones de oxidorreducción, de h idrólisis-deshidratación, de intercambio-adición-sustracción y de ligadura. El • Cuadro 4-4 resume eslas categorías y da ejemplos de enzimas comunes con sus diferentes tipos de reacciones. El nombre de una enzima puede aportar pistas importantes sobre el tipo de reacción q ue cataliza. La mayoría de las enzimas se reconocen instantáneamente por el sufijo -asa. La primera parte del nombre de la enzima ( Lodo lo que precede al sufijo) se refiere habitualmente al Lipa de reacción, al sustrato sobre el cual actúa o a ambos. Por ejemplo, el sustrato de la g/11coci11asa es la glucosa y, debido a su acción cinasa, le añadirá un grupo fosfato. La adición de un grupo fosfato se denomina fosforilación. Algunas enzimas tienen dos nombres. Estas enzimas fueron des cubiertas antes de 1972, cuando se adoptaron los est,\ndares actuales para la nomenclatura de las enzimas. Como resul tado, estas enzimas tienen un nombre nuevo y uno viejo, que es el comúnmente utilizado. Pepsina )' tripsina, dos enzimas digestivas, son ejemplos de nombres antiguos de enzimas.

Activación dela

p -_-_-_

reacción

_-\-

Avance de la reacción -

E 21

Reactivos

Productos

(l)

"g~ "'~ (l)

e

LLI

C+D

l a enfermedad de Tay-Sachs es un t rastorno genético recesivo causad o por un defecto en el gen q ue dirige la síntesis de la hexosaminidasa A. Recesivo significa que, para que un bebé nazca con la enfermedad de Tay-Sachs, este debe heredar dos genes defectuosos, uno de cada progenitor. Las personas con un gen de Tay-Sachs y un gen normal se llaman portadores de la enferme· dad . Los portadores no desarro llan la enfermedad, pero puede n transmitir los genes defectuosos a sus hijos. Las personas que tienen dos ge nes no rmales tienen ca ntidades normales de hexosaminidasa A en su sangre. Los portadores tienen niveles enzimáticos por debajo de lo normal, pero esta cantidad es suficie nte para evitar la acumulació n excesiva de gangliósidos en las células. P2 : ¿Cómo podría usted evaluar si Sarah y David son portadores

del gen de Tay-Sachs? Tiempo------• FIGURA 4-7 Las enzimas disminuyen ta energía de activación de

tas reacciones. En ausencia de la enzima, la reacción (línea entrecortada) tendría una energía de activación mucho mayor.

99

104 •

110

118

124

108

Capitulo 4 Energía y metabolismo celular

Clasificación de las reacciones enzimáticas

Tipo de reacción

Qué sucede

Enzimas representativas

1. Oxidorreducción (a) Oxidación

Adición o sustracción de electron es Transferencia de electrones de un donante al oxígeno Elimi nación de electrones y H· Ganancia de e lectrones

Clase:• oxidorreductasa

Adición de una molécula de agua Sustracción de una molécula de agua Ruptura de grandes moléculas por el agregado agua Eliminación de agua para formar una molécula mayor a partir d e moléculas más pequeñas

Clase:• hidrolasa

Intercambio de grupos entre moléculas Adición o sustracción de grupos Fosfato Grupo amino Fosfato Grupo amino Fosfato Grupo amino

Clase:* transferasas Clase:* liasas

Un ión de dos sustratos mediante e l uso de energ ía delATP

Clase:* ligasas

(b) Reducción 2. Hidrólisis-deshidratación (a) Hidrólisis (b ) Deshidra tación

3. Transferencia de g rupos químicos (a) Reacción de intercamb io (b) Adición (c) Sustracción

4. Ligadura

(c) Sustracción

4. Ligadura

Oxidasa Deshidrogenasa Reductasa

Peptidasas, sacaridasas, lipasas Pesh idratasas

Cinasa Transaminasa Fosfo rilasa Aminasa Fosfatasa Desaminasa

Sintetasa

'UIU!JV 0 111 11 1V

f"'\1 1111 10.lO

Fosfato Grupo amino

Fosfatasa Desaminasa

Unión d e dos sustratos mediante e l uso de energ ía delATP

Clase:* ligasas

Sintetasa

• Clases enzimáticas definidas de acuerdo con el Comité de Nomenclatura de la Unión Internacional de Bioquímica y Biología Molecular (www.chem.qmul.ac.uk/iubmb/enzyme)

Cuera, + hydro-, agua), uno de los productos es una molécula de agua. En muchas reacciones de deshidnllación se combinan dos moléculas en una, con la pérdida de agua en el proceso. Por ejemplo, los monosacáridos glucosa y fructosa se unen para formar una molécula de sacarosa. En el proceso, uno de los sustratos p ierde un grupo hid roxilo (-OH) y el o Lro sustrato pie rde un hidrógeno, formándose así una molécula de agua ( H,O). Cuando una reacció n de deshidratación resulta en la síntesis de un a nueva molécula, el proceso se llama síntesis por deshidratación. En una reacción de hidrólisis (hydro-, agua,+ lysis, disolver), un sustrato se convierte en uno o m,\s p roductos mediante h1 adición de agua. En estas reacciones, los en laces covalentes de la molécula de agua se rompen (se "lisan") de tal manera que el agua reacciona como un grupo hidroxilo (-OH ) )' un hidrógeno (-H) . Por ejemplo, se puede eliminar un aminoácido de un extremo de un péptido median te una reacción de hidró lisis. Cuando el nombre de una enzima consta del nombre del sustraLO más el sufijo -asa, la enzima lleva a cabo reacciones de hidrólisis. Un ejemplo es la lipasa, una enzima que degrada grandes lípidos en lípidos más pequeños med iante h idrólisis. Una peptirlas,i es una enzima que elimina un aminoácido de un péptido.

Reacciones de adición-s11stmcció11-i11tercambio Una reacción de adición añade un grupo funcional a uno o más sustratos. Una reacción de sustracción elimina un grupo funcional de uno o más susLratos. l os grupos funcionales son intercambiados en tre sustratos d urante las reacciones de intercambio. Po r ejemplo, los grupos fosfato pueden ser transferidos de una molécula a otra medianLe reacciones de adición, sustracción o intercambio. La Lransferencia de grupos fosfato es una form a importante de modulació n covalente, en la cual se acLivan o inactiva n reacciones o se aumenta o dism in uye su velocidad. Much os tipos de enzimas catalizan reacciones que transiíeren grupos fosfaLo. Las cinasas transfieren un grupo fosfato de un susLrato a una molécula de ADP para formar ATP, o de una molécula de ATP a un suslrato. Por ejemplo, la creatincinasa transfiere Lm grupo fosfato de la fosfocreatina al ADP, formando AT!' y creatina lib re. La adición, la sustracción y el inLercambio de grupos amino también son importan tes en la u til ización de am inmlcidos del cuerpo. La el iminación de un grupo am ino de u n aminoácido o de un péptido es una reacción de desaminación. La adición de un grupo amino se llama amioación y la tra nsferencia de una grupo aniino de una molécula a oLra es una transaminación.

Revisión

10. Nombre los wstratos de e;tas enzimas: lactasa, peptidasa, lipasay saarasa. 11. Una el tipo dereacción ola enzima de lacolumna izquieida con el grupo oel elemento correspondiente. (a) cinasa 1. grupo amino (b) oxidación 2. electrones (c) hidrólisis 3. grupo fosfato (d) transaminasa 4. agua

Reacciones de ligadura Las reacciones de ligadura unen dos moléculas uli lizando enzimas llamadas sintetasas y energía del ATP. Un ejemp lo de una reacción de ligadura es la síntesis de acetil coenzima A (acetil CoA) a pa rtir de ácidos grasos y coenzima A. El acetil CoA es una molécula irnponan le del cuerpo, como se verá en la siguiente sección.

te en kilocalorías ( kcal). Una kilocaloría es la cantidad de energía necesaria para elevar 1 grado centígrado la temperaltlra de 1 litro de agua. Una kilocaloría es igual a una Caloría, con C: mayúscula, utilizada para cuantificar el contenido energético de los alimentos. Una ki lo caloria también es equivalente a 1 000 calorías (con c minúscula). La mayo r parte de la energía liberada por el catabolismo es alm acenada en los enlaces fosfato de alta energía del ATP o en los eleclrones de alta energía de NADH, FADH1 o NADPH. Las reacciones anabólicas transfieren luego la energía de estos transpor tadores tran sitorios a los enlaces covalentes de las biomoléculas. El metabol ismo es una red de reacciones químicas allamente coordinadas en las que las actividades que se están llevando a cabo en w1a célula en un momento determinado, se corresponden con las necesidades de dicha célula. Cada paso de una ruta meLaból ica es una reacción enzimática diferente, y las reacciones en una ruta ocurren en forma secuencial. El sustralo A se convierte en el producto 13, el cua l luego si rve de sustrato para la siguiente reacción en la ruta; 13 se con viene en C, y así sucesivamente:

Metabolismo El término metabolismo hace referencia a todas las reacciones químicas que tienen lugar en un organismo. EsLas reacciones ( 1) extraen energía de las biomoléculas de los nutrientes ( como proteínas, hidratos de carbono y lípidos) y ( 2) sintetizan o degradan moléculas. El metabolismo se puede dividir en catabolismo (reacciones que liberan energía al degradar grandes b iomoléculas) y anabolismo ( reacciones q ue utilizan energía para la sín tesis de grandes biomoléculas). Las reacciones catabólicas y anabólicas ocurren simultáneamente. en las cél ulas de todo el cuerpo, por lo que en todo momento algunas biomoléculas se sintetizan mientras otras se degradan. La energía liberada de los en laces químicos de las biomoléculas o almacenada en ellos durante el metabolismo se mide habitualmen-

A las moléculas en una rula metabólica se las denomina intermediarios, )'ª que los productos de una reacción son los sustratos de la reacción siguien te. A veces escuchará nombrar las rutas metabólicas corno met11bo/is1110 i11termedio. Ciertos intermediarios, llamados i11ter111ediarios clnve, parlicipan en más de una rula y actúan como puntos de ramificación para conducir el sustrato en una u otra d irección. La glucosa, por ejemplo, es un intermediario clave en muchas rutas metabólicas. Un grupo de rulas metabólicas es, en muchos aspectos, similar a un mapa de carreteras detallado (• Eig 4-8). Del mismo modo que un mapa muestra una red de carreteras que com unican va rias ciudades y

Glucógeno

Glucosa-6-fosfato

Glucosa

Fructosa-6fosfato Fructosa

Fructosa-1-fosfato

Fructosa-1,6bifosfato

Ribosa-5fosfato

Glicerol DHAP

Glucosa-3-fosfato

DHAP = dihidroxíacetona fosfato (a) Parte de un mapa de carreteras

(b) Rutas metabólicas dibujadas como un mapa de carreteras

• FIGURA 4-8 Un grupo de rutas metabólicas se asemeja a un mapa de carreteras. Las ciudades en el mapa

equivalen a los intermediarios en el metabolismo. En el metabolismo puede haber más de una ruta para ir de un intermediario a otro, al igual que en un mapa puede haber muchos carreteras para ir de una ciudad a otra.

Sin embargo, si una reacción reve rsible requiere dos enzimas diferen tes, una para la reacció n di recta y otra para la reacción inversa, la célula puede regular la reacción más eficientemen te ( Fjg 4- IQh) . Si la célula no cuenta con una enzi ma que catalice la reacción inversa, en to nces dicha reacció n se rá irreversible (Fig. 4- L0c}. Compartimentaci611 de enzimas en la célula Much as enzimas del metabolismo se encuentran aisladas den tro de compartimen tos subcelula res específicos. Algunas, como las enzimas del metabo lismo de los hidratos de carbono, están d isueltas en el citosol, mientras que otras se encuentran aisladas dent ro de orgánulos especí ficos. Las mi tocondr ias, el retículo endoplasmático, el aparato de Golgi y los lisosomas contienen enzimas que no se encuentran en el citosol. Esta separación de enzimas impl ica que las rutas con troladas po r ellas también están separadas, lo que perm ite a la célula controlar el metabol ismo median te la regulació n del fl ujo de sustratos desde un compRrtimen to cel ular hacia o tro. Este aislamiento de enzimas den tro de la cél ula es un ejemplo importan te de compartimen tación estructural y funcional. Proporción entre ATP y ADP El estado energético de la célula es un mecan ismo final que p uede inlluir sobre las rutas metabólicas. Mediante un a regulación com pleja, la proporción en tre ATP y ADP den tro de la célula determina si las rutas que tienen e.orno objetivo la síntesis de ATP se ponen en ma rcha o se apaga n. Cuando los niveles de ATP son altos, su producció n d ism inuye. Cuando los niveles de ATP son bajos, la célula envía sustratos a través de rutas que res ul tan en mayor síntesis de ATP. En la siguien te sección, estudia remos en más detalle el papel del ATP en el metabo lismo cel ular.

El ATP transfiere energía entre reacciones La ulilidad de las rutas metabólicas como proveedoras de energía se rnide frecuentemen le en términos de la can Lidad neta de ATP que p ueden producir. El ATP es un nudeótido q ue con tiene tres grupos fosfato. Uno de ellos se une al ADP median te un en lace covalente como resultado de una reacción q ue requ iere energía. La en ergía se almacena en este enlace fosfato de alta energía y, luego, se libera cuando el enlace se rompe durante la separación del grupo fosfato. Esta relació n se muestra en la siguiente reacción: ADP + P; +energía~ ADP - P (=ATP) El símbolo - indica el enlace de alta energía, y P, es la abreviatura para el grupo fosfato inorgánico. Se est ima que la cantidad de energía libre liberada cuando se rompe un en lace fosfato de alta energía varía en tre 7 y l2 kca l po r mol de ATI'. El ATP es más impo rtante como molécuh1 transportadora de energía que como molécula de almacenamiento de energía. Entre o tras cosas, las células pueden contener una can tidad lim itada de AT P. Un ad ulto humano en reposo necesita 40 kg (88 libras) de ATP para apo rtar la energía requerida para sostener la actividad metabólica de un d1a, mucho más que lo que nuestras células p ued en almacenar. En su luga r, el cuerpo obtiene la mayor can tidad de su requerim ien to energético diario a pa rtir de los enlaces quún icos de las biomoléculas complejas. Las reacciones metaból icas transfieren esa energía de en lace químico a los enlaces de alta energía del ATP o, en algunos casos, a los enlaces de alta energía del nucleó Lido gur1110>'ít1 trifosfato, GTP.

Las rutas metabólicas que producen la mayor cantidad de moléculas d e ATP son las q ue req uieren oxígeno (hs rutas aerobias u oxidativas). Las rutas anaerobias (an-, s in, + aer, aire), que son las que pueden suceder sin oxígeno, también producen moléculas de ATI~ pero en cantidades mucho meno res. El menor rendimiento de ATP que tienen las rutas anaerob ias significa q ue la mayo ría de los animales (incluyendo el ser humano ) son incapaces de sobrev ivir por la rgos períodos u Lilizando solamen te el metabol ismo anaerobio. En la siguiente sección estudiaremos cómo se metabolizan las b iomoléculas para transferir energía al ATP.

Revisión

12, Nombre ánco manera; en que la célula regula e! ílujo de sustratos a través de las rutas

metabólim. 13. ¿Enqué parte de una moléculadeATP se eapta yalmacena laenergía?¿Enqué partede

una moléculade t'IADHse almacena la energía? 14. ¡Cuál es la diferencia entre la; ruta; aerobias y la; anaerobias?

Las rutas catabólicas producen ATP La • Figura 4- 1J resume las rulas catabólicas q ue extraen energía de las bio moléculas y la tra nsfieren al ATP. La producción aerobia de ATP a partir de glucosa común mente sigue dos rutas: la glucólisis (glyco-, dulce + lysis, d isolver) y el ciclo del ácido círrico (también conocido como el ciclo de los ácidos tr icarboxílicos). El ciclo d el ,leido cítrico íue descrito por primera vez por Hans A. Krebs, por lo q ue a veces se lo llama ciclo de Krebs. Debido a que el Dr. Krebs describ ió otros ciclos metabólicos, ev itaremos genera r con fusión uLilizando el térm ino ciclo del ácido cítrico. Los h idratos de carbono se incorporan a la glucólisis en fo rma de glucosa (parte supe rior de la Fig. 4- 1 l). Los lípidos se descomponen en glice rol y ácidos grasos, los cuales ingresan a la ruta en d iferentes puntos: el gl icerol al imenta la gl ucólisis y los kidos grasos se metabolizan en acetil CoA. Las protefnas se degradan en aminoácid os, que también se incorporan en d iversos puntos. Los carbonos de la gl ucólisis y otros nu trien les ingresan en el ciclo del ácido cítrico, lo que lo convierte en un ciclo perpetuo. En cada vuelta, el ciclo añade carbonos y produce ATP, electro nes de alta energía y d ióxido de carbono. Tanto la glucólisis como el ciclo del ácido cítrico producen peque nas can tidades de ATP d irectamente, pero su con trib ució n más importante para la síntesis de ATP es la captación de energía en electrones q ue son transportados por NADH y FADH2 hacia el sis tema transportador de electrones (STE) en las m itocondrias. Deb ido a que la glucosa es la única molécula que transita ambas rutas en su to talidad, en este capítulo estudiaremos so lo el catabolismo de la glucosa. • La • Figu ra 4- 12, en la página J 13, resume los pasos principales de la glucólisis, la co nvers ió n de glucosa en piruvato. • La • FigtLra 4- 13, en la pági na l 14, muestra có mo se convierte el piruvato en acetil CoA y cómo los carbo nos del acetil CoA pasan a través del ciclo del ácido cítrico. • La • Figura 4- 14, en la página l l 5, ilustra la ruta de transferencia de energía del sistema transportador de electrones.

Producción de ATP En esta figura se resumen las rutas catabólicas que extraen energía de las biomoléculas y la transfieren al ATP. La produccíón aerobia de ATP a partir de glucosa sigue habitualmente dos rutas: la glucólisis y el ciclo del ácido cítrico. Cada una de estas rutas produce pequeñas cantidades de ATP directamente, pero sus contribuciones más importantes a la síntesis de ATP son los electrones de alta energía transportados por NADH y FADH2 hacia el sistema transportador de electrones dentro de las mitocondrias. La producción de energía a partir de una molécula de glucosa puede resumirse en las dos ecuaciones siguientes.

Glucosa

1

G

L

u

Glicerol - --+

~e

(J)

ADP ATP

1

Aminoácidos - - -

~

'8 3 (!)

f

ASISTENTE

s

1

s

Aminoácidos -

-

Citosol

Piruvato

c¡:i Piruvato y

Ácidos grasos -

C02 + H20 + ATP

J

Acetíl CoA Ciclo del ácido citrico

Mitocondria

T

Metabolismo aerobio de la glucosa

Gluc osa + 02 + ADP + P¡ -

[ Acetil CoA

Glo=

Amia,-/------------.

.....___,., Electrones de alta energía

~~~

_ _,,__""""] sTE

ADP ATP

30-32 ADP + Pi C5H120e

30-32 ATP

~ 6 C02 + 6 H20

Este ícono representa los diferentes pasos de la figura de resumen metabólico. Búsquelo en las figuras Acétil°CoA

.y

+ Ácidos grasos -

C02 + H20 + ATP

C5H120e

Ciclo del ácido citrico

Mitocondria

Amia,-/------------. ácidos

30-32 ADP + Pi

J

T

Metabolismo aerobio de la glucosa

Gluc osa + 02 + ADP + P¡ -

[ Acetil CoA

30-32 ATP

~ 6 C02 + 6 H20

CICLO DEL ÁCIDO

"r-

.....___,., Electrones de alta energía _,,__""""] STE

~~~

ADP

_

ATP Este ícono representa los diferentes pasos de la figura de resumen metabólico. Búsquelo en las figuras siguientes para facilitar su recorrido a través del metabolismo.

C02

Electrones de alta energía y H+

ADP SISTEMA TRANSPORTADOR DE ELECTRONES

Examinaremos el catabolismo de proteínas y lípidos )' las rulas sinlélicas de lípidos y glucosa cuando esludiemos el deslino de los nulr ie ntes que ingerimos (Capítulo 22). Las rulas aerobias para la prod ucción de ATP son un buen ejemplo de compartimenlación dentro de las células. Las enzimas de la glucólisis se localizm1 en el ciLOsol, mientras q ue las enzimas del ciclo del ácido cítrico están dentro de las mitocondrias, donde la concenlración de f-I+ en el compartimento intermembrana almacena la energía necesa ria para generar los en laces de alta energía del AT P.

ATP

Revisión

15, Una czda componente de la ilquierdacon la/s molérula/sde la/sque forma parte: {a) aminoácidos 1. hidratos de caibono (b) ácidos grasos 2. lipidos {c) glicerol 3. polisacáridos (d) glucosa 4. proteínas

5. triglicéridos 16, las reacciones endergónicas, ¿liberan energíao laalmacenan en los productos?

• FIGURA4-12 FUNDAMENTOS

• •

Glucólisis Durante la glucólisis, una molécula de glucosa se convierte en dos moléculas de piruvato mediante una serie de reacciones catalizadas enzimáticamente, produciéndose una liberación neta de energía.

I

I

'

GLUCOSA

I I

I I I

'

~ ATP

I

I 1

I I 1

I 1

ADP

'

I I

I

l t] º K H L

'

I I 1 I I

I

'

I

Fructosa-6-fosfato

1

,I

b

Glucosa-6-fosfato

'

1

e

ATP

I 1

ADP

I I

Fructosa-1 ,6 -fosfato

Glucosa

o

Dihidroxiacetona fosfato

l

Piruvato 1

\

'

\ \

2 Gliceraldheído-3-fosfato

\

\

La glucosa se fosforita para formar glucosa-6-fosfato. (B "6" de la glucosa-6-fosfato indica que el grupo fosfato se ha adherido al carbono 6 de la molécula de glucosa.)

Características clave de la glucólisis

t En la glucólisis, una molécula de glucosa de 6 carbonos se convierte en dos moléculas de piruvato de 3 carbonos. t Dos pasos de la glucólisis requieren un aporte de energía proveniente del ATP. Otros pasos almacenan energia en el ATP y en los electrones de alta energía de NADH. t La glucólisis no requiere oxígeno. Es la ruta común para el catabolismo aerobio y anaerobio de la glucosa.

®

¡,__

2

1

NAO·

\ \

'

\

[

[

T

\

NADH

\

l

1

W

\

]

''

2 1,3-bifosfoglicerato

\ \

2

\

'' '

Los pasos 5-9 ocurren dos veces por cada glucosa que pasa por la ruta.

ADP \

G

\ \

''

ATP

\ \

1

\ \

LEYEN DA

• =Carbono o = Oxígeno ® = Grupo fosfato (los grupos laterales no se muestran)

\\

\

l

,

~

\

¿J, glocóllsls

~

o

2 2-fosfoglicerato

' \\

~-•:,:-.=

2


2 3-fosfoglicerato

\

2 Fosfoenol

,~ ru
o exergónica? 2. ¿Qué pasos de la glucólisis (a) utilizan ATP? (b) generan ATP o NADH? (c) son catalízados por cinasas? (d) son catafizados por deshídrogenasas? (Sugerencia: véase el Cuadro 4-4.) 3. ¿Cuál es el rendimiento energético (ATP o NADH) de una molécula de glucosa?

H20

2

Í

'T AD:,. .['-

,

\ j 2 Piruvato 1

2 .--

Cl)

B piruvato es el punto de rami4·»ficación para los metabolismos aerobio y anaerobio de la glucosa.

a

FIGURA4-13 FUNDAMENTOS

• •

Piruvato, acetil CoA y el ciclo del ácido cítrico 2 Si la célula cuenta con una cantidad adecuada de oxígeno, cada piruvato de 3 carbonos formado durante la glucólisis reacciona con la coenzima A (CoA) para formar un acetil CoA y un dióxido de carbono (002). La unidad acilo de dos carbonos del acetil CoA se incorpora en el ciclo del ,/ ácido cítrico y permite a la coenzima A reciI Piruvato , clarse y reaccionar con otro piruvato. El ci,, clo del ácido cítrico es un circulo sin fin I que añade carbonos del acetil CoA en ,, NAO" I , cada vuelta del ciclo y produce ATF', I electrones de alta energía y dióxido I I de carbono. I NADH

Citosol

j

........

,

Matriz mitocondrial

,/

I

,,

I

I

,,

I

I

'

I

AcetilCoA A

--.. CoA V

I

, ,,

,

I

La coenzima A se forma a partir del ácido pantoténico (una vitamina). Las coenzimas, al igual que las enzimas, no son modificadas durante las reacciones y pueden ser reutilizadas.

I

.....

Unidad acilo

, I

o

I

I

, •-•-•- •-• Citrato (6C)

I

I I

I

G

C( Piruvato 1

c:::J

Acetil CoA

NADH

Ciclo del ácido cítrico Electrones ~ - ' - - de alta energía

--~-~~ - - -~

r,

\

'

El piruvato reacciona con la coenzimaA para producir acetil CoA, un NADH y un C02. El acetll CoA tíene dos partes: una unidad acilo de 2 carbonos, proveniente del piruvato, y una coenzima A

/

,/ '

Si la célula cuenta con una cantidad adecuada de oxígeno, el piruvato es transportado dentro de la mitocondria.

lsocitrato (6C)

• •- •-•-•-• itrate (!iCJ

NAD'

~ - .........- , Malato (4C) •- •- •- •

NAO'

o

NADH

CICLO DEL ÁCIDO CÍTRICO

La unidad acilo de 2 carbonos se incorpora al ciclo combinándose con una molécula de oxalacetato de 4 carbonos . La molécula de citrato de 6 carbonos pasa por una serie de reacciones hasta completar el ciclo y vuelv a formar una molécula de oxalacetato.

\

''

'\

n-cetoglutarato (5C) Fumarato (4C)

', •- •=•- • ',

•- •- •- •- •

Se eliminan dos carbonos en fonna de 002.

olt~ 'o

La mayor parte de la energía liberada es atrapada en electrones de alta energía en tres NADH y un FADH2. Parte de la energía se almacena en los enlaces fosfato de alta energía del ATP. La energía restante se emite en forma de calor.

\

''

'\

\

FAD

\ \

ATP

o

NADH

' ', ~ - ' " - - - - ,

'

'

o

·-·-·-· '

Succinato (4C)

''

''

''

\

PREGUNTAS 1. En forma global, ¿el ciclo del ácido cítrico es una ruta endergónica o exergónica? 2. ¿Cuál es el rendimiento neto de energía (ATP, FADH2 y NADH) de cada piruvato que completa el ciclo? 3. ¿Cuántos C02 se generan a partir de un píruvato? Compare el número de átomos de carbono en el piruvato y en los C02.

''

LEYENDA • =Carbono CoA j = Coenzima A o = Oxigeno Los grupos laterales no se muestran

I

• FIGURA4-14 FUNDAMENTOS

El sistema transportador de electrones El paso final en la producción aerobia de ATP es la transferencia de energía desde los electrones de alta energía de NADH y FADH2 hacia el ATP. Esta transferencia de energía requiere proteínas mitocondriales, conocidas como sistema transportador d e electrones (STE), localizadas en la membrana mitocondrial interna. Las proteínas del STE incluyen enzimas y citocro mos que contienen hierro. La síntesis de ATP por parte del STE se llama fosforilacíón oxidatíva porque el sistema requiere oxigeno para que actúe como receptor final de electrones y H+. La teo ría quimiosmótica dice que la energía potencial almacenada mediante la concentración de H+ en el espacio intermembrana se utiliza para generar el enlace de alta energía del ATP.

I

1

I I

ASISTENTE

Matriz

Ciclo del ácido cítrico

1 I

I

mitocondrial

Membrana mitocondrial interna

1

,'

J

,

I (

I

,' ' I I' ,I

O

I

2 H20 + - - - - - - 02 +

'

Conjunto de H+ de la matriz

'

(

(

(

I

\ !

¡,...._ _ _..¡ ,

Electrones

de alta energía Sistema

1

.,___ _ _ _~ transpor· ", tador de , electrones \

' '\ REFERENCIAS

''

=Menor con-

\

''

-

\ centración de H-1..

=Mayor concentración de H+

NADH y FADHz A aportan electrones V de alta energía y H+ al STE. NAo+ y FAD son coenzimas que se reciclan.

'

'

''

Membrana mitocondrial externa

''

Electrones .,,...._ de alta ~ , enerqía de la glucólisi ~

- ~

La energía liberada A cuando pares de V electrones de alta energía pasan a través del sistema transportador es utilizada para concentrar H+ de la matriz mitocondrial en el espacio intermembrana. El gradiente de concentraciónde H+ es una fuente de energía potencial.

Citosol

- --:;,,,--· ,;y""

O Cada par de

Al final del STE, los electrones han cedido su energía almacenada

A

electrones liberadoV por el STE se combina con dos H+ Y un átomo de oxígeno y forma una molécula de agua (H20).

G

Los H+ vuelven a la matriz a ft través de una proteína llamada V ATP sintasa. A medida que los H+ se mueven a favor de su gradiente de concentración, la sintasa transfiere su energía cinética hacia el enlace fosfato de alta energía del ATP. Ya que las conversiones energéticas nunca son completamente eficientes, una porción de la energía se pierde en forma de calor.

Por cada tres H+ que pasan a través de la ATP sintasa se produce como máximo un ATP.

PREGUNTAS 1. ¿Qué es la fosforilación? ¿Qué se fosforila en la fosforilación oxidativa? 2. El flujo de electrones a través del sistema transportador, ¿es endergónico o exergónico? 3. ¿Cuál es el rol del oxígeno en la fosforilación oxidativa?

Una molécula de glucosapuede generar 30-32 moléculas de ATP Recuerde de la Figura 4- l l, que el metabolismo aerobio de una molécula de glucosa produce dióxido de carbono, agua y 30-32 ATP. Analicemos el papel de la glucólisis y del ciclo del ácido cítrico en esta producción de ATP. En la glucólisis (Eig 4- 1)\, el metabolismo de una molécula de glucosa ( C:6 H 110 6 ) Liene un rendimien to neto de dos moléculas de piruvato de 3 ca rbonos, 2 ATP y electrones de alta energía transpo rtados por 2 NADH: G lucosa + 2 NAD" + 2 ADP + 2 P ~ 2 Piruvato + 2 ATP + 2 NADH + 2 H• '+ 2 H,O En la siguiente fase, la conversión de p iruvato en acetil CoA produce un NADH (Fig. 4- 13) . Los carbonos de un acetil CoA que pasa por el ciclo del ácido cítrico atrapan ene rgía en tres moléculas de NADH, un FADH1 y un ATP. Estos pasos suceden dos veces por cada gl ucosa, lo que da un rendimiento total de 8 NADH, 2 FADH2 y 2 ATP para la fase del ciclo del ácido cítr ico en el metabolismo de la glucosa. En el paso final, los electrones de alta energía del NADH y del FADH2 que pasan a través de las proteínas del sistema transportador

de electrones util izan su energía para concen trar H · en el compartimen ro i.ntermembrana mitocondrial ( Fig. 4- 14). Cuando los H· se mueven a favor de su gradiente de concentración a través de un canal en la ATP sinlasa, la energía liberada se transfiere al enlace de alta energía del ATP. En promedio, el NADH y el FADH, de una glucosa producen 26-28 ATP. C uando calcul amos el rend imiento máximo de energía poten cial del catabolismo de una molécula de glucosa a través de las rutas aerob ias, obtenernos un ro tal de 30- 32 ATP Fig. 4- 1Sb). Estas canLidades so n el polencial máximo, porque habitualmente las mitocont'lrias no trabajan a su máxima capacidad. Existen varias razones para esto, incl uyendo el hecho de que una canlidad determinada de H· se

e•

filtra desde el espacio intermembrana de vuelta hacia la maLriz mi tocondrial sin producir ATP. Una segunda fuente de variabilidad en la cantidad de ATP pro ducido po r cada glucosa proviene de las dos moléculas citosólicas de NADH producidas durante la glucólisis. Estas moléculas de NADH son incapaces de ingresar a las mitocondrias y deben transferir H ts electrones a través de transportadores de membrana. Dentro de la mi tocondria, algu nos de estos electrones son atrapados por el FADH 2, que üene un rendim ie nto potencial promedio de solo 1,5 ATP en lugar de los 2,5 ATP producidos por el NADH mi tocondr ial. Si, en su lugar, los electrones citosólicos son atrapados por el NADH mitocondr ial, producen dos moléculas de ATP adicionales.

(b) M etabolismo

(a) Metabolismo anaerobio

C6 H12O6

[ 7 Glucosa G l

-

2 C3 H5O3• + 2 H+

NADH FADH2

-------

u e ó

aerobio

ATP

C02

[

[ (Glucosa

NADH FADH2

ATP

1

s

2'

l 1

-2

~2

s

1

~

1

2 Piruvato

------

1 Piruvato -2

+

TOTALES 1

NkH

1

[AiP

1

2

2

6

¡

2

4

¡

Electrones de alta energía y H+

SISTEMA TRANSPORTADOR OE ELECTRONES t-----....._-.,.

e n condiciones ae robias a través de l ciclo del ácido cítrico produce 30- 32 ATP. Una g lucosa m etabol izada en condiciones anaerobias solo produce 2 ATP.

rr

~

r --------. • FIGURA 4- 15 Resum en del rendimiento energético del catabolismo de una molécula de glucosa. Una glucosa me tabolizada

~

2

Ciclo del ácido cítrico

6 0 2~

{

j

2 Acetll CoA

----- ---

CO:i

-4

ó

2

11

-------

e

l

2 Lactato

j

TOTALES

· El NADH citoplasmático a veces rinde solo 1,5 ATP/NADH en lugar de 2,5 ATP/NADH.

26-28 1 3~ ATP 11 C02

El metabolismo anaerobio genera 2moléculas de ATP El metabolismo de la gl ucosa descri to previamente considera que las células cuentan c.on un aporte adecuado de oxígeno para mantener el sistema transportador de electrones en funcionamiento. Pero ¿qué pasa con una c~lula cuyo sum inist ro de oxígeno no puede man tener el ritmo de demanda de ATP, como sucede frecuentemente durante el ejercicio extenua nte? En ese caso, se ca mbia del metabol ismo aerobio de la glucosa al anaerobio, con punto de partida en el piruvato t• Fig. 4-16). En el metabol ismo anaerobio de la glucosa, el piruvato es convertido en lactato en lugm· de ser transportado dentro de las mitocondrias:

NADH Piruvato

NAO+

___\--_, _-=- --=~:;____,•..,. Lactato

puede ingresar al ciclo del ácido cítrico o ser desviado hacia la p ro ducción de lactato hasta que mejo re el sumi nistro de oxígeno. La transfo rmación de p iruvato en lactato convierte un NADH nuevamente en NAO- cuando u n átomo de hidrógeno y un electró n son transferidos a la molécula de lactato. Como resultado, el rencüm iento neto de energía del metabolismo anaerob io d e una molécula de glucosa es de 2 AT P y n ingún NADH ( Fig. 4- 1Sa), un rendi miento muy exiguo comparado con los 30-32 AT P/ glucosa que resultan del metabolismo aerobio ( Fig. 4- 15b). La baja eficiencia del metabol ismo anaerob io limi ta severameme su utilidad en la mayo ría de las c~l ulas de vertebrados, cuya demanda de energía es mayor que lo que puede apo rtar el metaboüsmo anaerobio. Algunas células, como las musculares en ejercicio, pueden tolerar el metabolismo anaerobio duran te un período de tiempo lim itado. Sin embargo, eventualmente deben regresar al metabolismo aerobio. (Los metabolismos aerob io y anaerobio del músculo se analizan en mayor detalle en los Capíiulos 17 Y.1.5.)

Lactato deshidroge1111sn Revisión

El piruvato es un p unto de ramificación para las ru tas metabólicas, al igual q ue una ci udad importante en un mapa de rutas. Dependiendo de las necesidades de la célula y del contenido de oxígeno, el pi ruvato

17. ¡Por qué resulta esencial para la síntesis de ATP la sepMación de la mitocondria endo; compartimento;? 18. la lactato deshidrogenasa actúa sobre el lactato - - -(¿ailadienoo ostl5trayendo?) un/a - - -Yun/a - -Este promo se llama (¡oxidacióno reducción?). 19. Describa dos difereflcias entre el metaoolismo aerobioyel anaerobio de la glucosa.

NAD+

NADH

Anaerobio

Aerobio

I Lactato]

Piruvato

Las proteínas son fundamentales para la función celular

~ -------~- ~

!CoAI Coenzima A

Corno hemos visto, las proteínas son moléculas que guían a la célula día a día. Las enzimas pro teicas controlan la sín tesis y la degradación de hidratos de carbono, lípidos, proteínas estructurales y moléculas de señalización. Los transportadores )' poros proteicos de la membrana celular y de la membrana de los o rgán ulos regulan el Oujo de moléculas hacia adentro y hacia afuera de los compa rtimen tos. Otras proteínas forman el esqueleto estructural de células y tejidos. De esta manera, la síntesis proteica resul ta fundamental para la función celular. El poder de las proteínas proviene de su inmensa variabil idad y especi l1 cidad. La síntesis proteica a par tir de 20 aminoácidos puede compararse con un idio ma que posee un alfabeto de 20 letras. Las "palabras" varían en lo ngi tud, desde tres letras hasta tien tos de ellas, )' dan lugar a mi les de proteínas diferen tes con tÜversas funciones. Un cambio en un am inoácido du rante la síntesis proteica puede alterar la función de la p roteína, al igual que el cambio de una letra convierte la palabra casa en caza. El ejemplo clásico de un cambio de am inoácidos q ue ocasio na problemas es la anemia falcifo rme. En esta en fermedad hereditaria, cuando el aminoácido val ina reemplaza a un ácido glutám ico en la cadena peptídica, el cambio altera la forma de la hemoglob ina. Como resultad o, los glób ulos rojos que contienen la hemoglobina anormal adoptan fo rma de med ialtu1a (falciforme: en forma de hoz), lo que hace que se agrupen y obstru)'an los vasos sanguíneos pequeños.

El H y el -OH no se muestran

El "alfabeto" delns prot:e fo,1 s Uno delos misterios dela b iología hasta

.............

__.........

~-,.

Matriz mitocondrial

Piruvato

Acetíl CoA

---eoA

-

Unidad

acilo

CICLO DEL ÁCIDO CiTRICO

LEYENDA • =Carbono o =Oxígeno

• FIGURA 4-16 El piruvato es el punto de ramificación entre el metabolismo de la glucosa aerobio y el anaerobio

la década de 1960 fue la cuestión de cómo solo cuatro bases nitrogenadas en la molécula de ADN - adenina {A), guanina (G), citosi na (C) y timina (T)- podían codificar más de 20 aminoác idos diferentes. Si

A David y a Sarah se les extrajo sangre para el estudio genético hace semanas y han estado esperando los resultados ansiosamente. Hoy regresaron al hospital para oír las novedades. El estu dio reveló que Sarah es portadora del gen de la enfermedad de Tay-Sachs, pero David no. Esto significa que, aunque alguno de sus hijos podría ser portador del gen, al igual que Sarah, ninguno desarrollará la enfermedad. P4:

El gen de Tay-Sachs es un gen recesivo {t). Si Sarah es portadora del gen (Tt) pero David no, ¿cuál es la probabilidad de que cualquiera de sus hijos sea portador? (Consulte un texto de biología general o de genética general si necesita ayuda para contestar esta pregunta.)

104

99

107

110 •

124

cada base controlase la síntesis de un aminoácido, una célula podría producir solo cuatro aminoácidos d iferentes. Si pares de bases represenLasen diferentes aminoácidos, la célula podría formar 42, o sea, 16 am inoácidos dislintos. Si en lugar de eso fueran LripleLes de bases los que codificasen distintas moléculas, el ADN podría generar 4' , es decir, 64 am inoácidos. De hecho, es mediante estos tripletes, llamados codones, como la información se codifica en el ADN y el ARN. La a Figura 4-17 muestra el código genético de una forma de ARN. Recuerde que el ARN sustitu)'e la base uracilo (U) por la base timina del ADN.

Segunda base del codón

e

u

uc"}

uu g}-Phe u cc u uu UCA uuaj-UU G Leu UCG

e

UAg)- Tyr UA

Ser tlAA UAG

cu} ce& c uc CCC CUA Leu CCA CUG CCG

AU~ AUC lle A AUA AU Met Iniciación

º"}

G GUC GUA GUG

Val

AC"} ACC ACA ACG

Terml•

nació,

CA~ CAC

...!:!

~~ ~-Cys UGA Tonninación..A UGG Trp G

s

CG& -...!:!

His CGC e Pro CGA Arg Gin CGG ..A G u AG~} AA~}Asn AGC Ser AAC Thr A AGA} ~ } Lys AGG Arg

GC"} Ala GCC GCA GCG

G

A

gaj-

e

-u G

GA~ GAC

ºº"}

Asp GGC

GGA GAA GAGJ- Glu GGG

Gly

e

7. G

• FIGURA 4-17 El código genético como aparece en los codones

del ARNm. Las abreviaturas de tres letras a la derecha de las llaves

indican el aminoácido que cada codón representa . Los codones de inicio y detención ta mbién están marcados. Las abreviaturas de 3 letras se explican en la fig. 2-3, p. 35.

De las 64 combinaciones posibles de un Lriplete, un codón de ADN (con la secuencia TAC) actúa como iniciador o "codón de ini ciación", que representa el comienzo de una secuencia codificante. Tres codones funcionan como terminado res o "codones de terminación': que muestran dónde finaliza la secuencia. Los 60 tripleLes restantes codifican aminoácidos. La metionina )' el triptófano Lienen so lo un codón para cada uno, mientras que los otros aminoácidos poseen entre dos y seis codones diferen Les para cada uno. Por lo tanto, al igual que las letras que forman palabras, la secuencia de bases del ADN determina la secuencia de aminoácidos de las proteínas.

Revelando el código del ADN ¿Cómo sabe una célula cuáles de los mi les de bases presentes en su secuencia de ADN debe utilizar para producir una proteína? Resul ta que la información que necesita una célula para fabricar una proteína particular está contenida en un segmenro de ADN conocido como gen. ¿Qué es un gen exactamente? La definición cambia de forma constanLe, pero, a los propósitos de este texto, defi11iremos un gen como una región de ADN que contiene la infonnación necesaria para producir un fragmento funcional de ARN, el cual puede a su vez dar origen a una proteína. La • Figura 4- 18 muesLra los cinco pasos p rincipales q ue ocurren desde la transcripción de un gen hasta obtener una p roteína funcional. Primero, una sección de ADN que contiene un gen debe ser activada para q ue su código se pueda transcribir (D_ Los genes que se transcriben continuamente en ARN mensajeros se denominan co11sti111tivame11te activos. Habitualmente, estos genes codifican proteínas que son esenciales para las funciones celulares en curso. O tros genes son regrtlados; es decir, su aclividad puede ser estimulada (inducida) o inhib ida ( reprimida) por proteínas reguladoras. Una wn que un gen se acliva, la secuencia de bases del ADN del gen se utiliza pa ra crear un fragmento de ARN mediante un proceso conocido como transcripción (trans, sobre, + scribe, escribir) ( Fig. 4- 18 ~). Las células hLtmanas poseen tres formas principales de ARN : el ARN mensajero (ARNm), el ARN de transferencia (ARNt) y el ARN ribosómico (ARNr). El ARN mensajero es procesado en el núcleo tras su formación @. Puede ser sometido a corte y empalme altemativo (será analizado en breve) ( también llamado "splicing" aLernalivo) an Les de sal ir del núcleo o ser "silenciado" )' destruido por enzimas a través de una interferencia por ARN. El ARNm procesado abandona el núcleo y se incorpora al citosol. Allí trabaja junto con el ARNt y el ARNr para dirigir la tradL1cción, que es el ensamblado de am inoácidos en una cadena proteica © . Las proteínas recientemenLe sintelizadas están sujetas a modificación postraduccional ( Fig. 4- 18 ®). Se pliegan en formas complejas, pueden ser degradadas a péptidos más pequeños por enzimas o se les puede añadir diversos grupos quimicos. En lo que resta de este capítulo estudiaremos en mayor detalle la transcripción, el procesamiento del ARN, la Lraducción y la modificación postraduccional.

El ADN guía la síntesis de ARN Los primeros pasos de la síntesis proteica esLán comparlimentados dentro del núcleo debido a que el ADN es una molécula mu)' grande que no puede atravesar la envoltura nuclea r. La transcripción uliliza el ADN como una plantilla para crear una cadena individua l de ARN que puede sal ir del núcleo (a Eig 4- 12). La sintesis de ARN a partir

Resumen de la síntesis proteica Los pasos principales necesarios para convertir el código genético del ADN en una proteína funcional.

Gen ACTIVACIÓN DEL GEN

Proteínas reguladoras

1

' Actividad regulada

Constitutivamente activos

l

l Represión

Inducción 1

1

TRANSCRIPCIÓN (Véase la Fig. 4-19.)

1

ARNm

é

Corte y empal - '"'· -- - '"''.- ..

PROCESAMIENTO

---

ARNsi

lntP.rfP.rP.nr:i::i

Represión

Inducción

4t

TRANSCRIPCIÓN (Véase la Fig. 4-19.)

1

ARNm

ARNsi

1

4)

Corte y empal me alternativo

PROCESAMIENTO DELARNm

- ....

Interferencia

'""

--

ARNm " silenciad o"

ARNm procesado

Núcleo

1)

1

POSTRADUCCIONAL

-

-

TRADUCCIÓN (Véase la Fig. 4-21.}

4, MODIFICACIÓN

{e

1:. ARNr de ribosomas 1:. ARNt 1:. Aminoácidos

Citoso/

Cadena proteica

! Plegamiento y uniones cruzadas

!

Ruptura en péptidos más pequeños

l

l

Adición de grupos: t azúcares t lípidos

Ensamblado en proteínas poliméricas

t-CH3 t fosfato -

ARN p olimerasa

La ARN polimerasa se une al A DN.

! La sección de ADN que contiene el gen se desenrolla.

r

,..

~ Bases de ARN

Las bases de ARN se unen al ADN y generan hebras individuales de ARNm. Hebra co dificante

ensamblado de udeótidos

------- -- ------------~ -~-- --

-------- --Copia deARNm

Elongación de la hebra de ARNm

ARN polimerasa

El ARNm y la ARN polimerasa se separan del ADN, y el ARNm se desplaza hacia el citosol luego de su procesamiento. Hebra de ARNm liberada

t

Abandona el núcleo luego de su procesamiento

• FIGURA 4-19 Transcripción. Un gen es un segm ento de A DN que puede producir un fragmento funcional de ARN, el cual a su vez puede d ar origen a una p roteína. El apa reamiento de bases es igual que en el ADN, excepto que la base uracilo {U) reemplaza a la timina (D.

de una palrón de ADN de doble cadena requiere una enzima llamada ARN po limerasa, además de iones magnesio o manganeso y energía en forma de enlaces fosfato de alta energía:

Plantilla de ADN + nudeótidos A, U, C, G ARN pol imerasa, Mg2"" o M n'~, y ene rgía Plantilla de ADN + ARNrn

Antes de q ue la transcripción pueda comenza r se debe activar un segmento promotor. Los factores de transcripción, que son proteinas reguladoras, se unen al ADN y activan el p romotor. El promo tor aclivo le ind ica a la ARN po li rnerasa dónd e debe Lm irse al ADN ( Fig. 4- 19 CD). La polimerasa se despla2a a lo largo de la molécula de ADN )' "desenrolla" la doble cadena rompiendo los puentes de h idrógeno en tre las bases apareadas @ . Una cadena de ADN, llamada cade11a codifican/e, sirve de guía para la sín tesis de ARN @ . El segmen to promotor no se transcribe a ARN. Durante la transcr ipció n, cada base de la cadena codiíicante del ADN se aparea con la base de ARN co mplementaria (G-C, C-G, T-A, A- U). Este apareamiento de bases complementarias es sim ilar al proceso po r el cual se forma la doble cadena del ADN (véase el Apéndice C para un repaso de la síntesis de ADN). Por ejemplo, un segmento de

ADN que conliene la secuencia de bases "AGTAC" se transcribe en la secuencia de bases de ARN "UCAUG". Las bases de ARN, al mismo tiempo que se unen a la cadena codilicante del ADN, también interactúan entre sí para crear una hebra individual de ARN. Durante la transcripción, las bases se unen a una velocidad promedio de 40 por segundo. En los seres humanos, las moléculas de ARN más grandes pueden contener hasta 5 000 bases, )' su transcripción puede ta rdar más de un minuto (período de tiempo largo para un proceso celuhtr). Cuando la ARN polimerasa llega al codón de terminación, deja de añadir bases a la cadena creciente de AR rel="nofollow">f y la libera (Fig. 4- 19 ©).

El corte y empalme alternativo crea múltiples proteínas apartir de una secuencia de ADN El próximo paso en el proceso de síntesis proteica es el procesamiento del ARNm, el cual adopta dos formas (Pig 4- 18 @): en la interferencia por ARN, el ARNm recientemente sintelizado es inactivado o destruido antes de ser traducido a proteínas ( véase el recuadro Novedades); en el corte y empalme al ternativo, las enzimas recortan segmentos del medio o de los extremos de la cadena de ARNm. Luego, otras enzimas vuelven a empalmar los fragmentos restantes. El corle y empalme alternat ivo es necesario debido a que un gen contiene al mismo tiempo segmentos que codifican proteínas (exones) y segmentos no codificantes llamados intrones Eig 4-?Q). Esto significa que el ARNm formado inicialmente a partir del ADN de un gen contiene segmentos no codificantes que deben ser eli minados antes de que el ARN rn salga del núcleo. El resultado del corte )' empalme alternativo es un fragmento de ARNm más pequeño que contiene solo la secuencia codificante para una proteb1a específica.

<•

Revisión 20. lJtÍÍJce el códi90 genético de la fiqura 4·17 para escribir los codones de ADN quecorres·

pendena los treS codones de terminación del ARNm. 21, ¡Qué lesugieie el nombre 'ARN polimerasa" respecto de la función deesta enzima?

Cadena codificante

'

Promotor,1_ _ _ _ _ _ __ ADN

b

a

Sección transcripta - - - - - - -- ' ' ,

e

f

e

1

'

g

'

TRANSCRIPCION ARNmsin procesar

&

~

A

l e 1

CJLJ<>?__ lntrones eliminados

lslol

BI

e

! E

tivo. E

G

El procesamiento del ARNm puede generar dos proteínas a partir de un gen mediante el corte y empalme alternaF

HI

Exones para la proteína Nº 1

lntrones eliminados

e

A

E

Exones para la proteína N° 2

El segmento prom otor de ADN no se transcribe a ARN. En el procesa miento del ARNm, los intrones del ARNm recientemente generado son eliminados. Los exones restantes son empalmados nuevamente para formar el ARNm que codifica una proteína funcional. La eliminación diferencial de intrones de un ARNm permite que un único gen codifique múltiples proteínas. Para la proteína nº 1 se eliminaron los intrones A, C, Ge l. Para la proteína nº 2, los seg mentos B, D, F y H se elimina ron como si fueran intrones.

• FIGURA 4-20 Procesamiento del ARNm.

F

G

Revisión

Petunias moradas ylaARNi ¿Qu ié n podría haber imaginado que la investigación d estinada a desarrollar una petunia más morada abriría el camino a una de las nuevas áreas más excitantes de la investigación e n biología molecula r? la interferencia por ARN (ARNi, por su sigla e n inglés) fue observada por prime ra vez e n 1990, cuando los botánicos que implantaron los genes d el pigme nto morado en petu nias obtuvieron plantas bla ncas o a rayas bla ncas e n lugar del colo r morado esperado. Esta observación no llamó la atención hasta 1998, cuando científicos qu e trabajaba n en biología animal y med icina tuvie ro n problemas simila res en experimentos con un gusano ne mátodo. Hoy en día, la ARNi es una de las á reas más candentes de la investigación e n biotecnología. Todavía hay muchos d e talles de la ARNi que no son bie n comprendidos. En términos muy simples, el "silenciamiento· del ARNm es un evento que ocurre natu ral mente mediante la prod ucción o la introducció n d e moléculas cortas d e ARN tales como el ARN peq ue ño de interferencia (siRNA, por su sigla en ing lés) o el microARN (ARNm1). Estos pequeños fragmentos de ARN se u ne n al ARNm e impiden su traducción; incl uso, puede n marcar e l ARNm para su d estrucción. El ARNsi comienza como fragme ntos de doble cadena de ARN q ue son cortados por u na e nzima llamad a Oicer e n porciones más peq ueñas (de 20-25 nucleótidos). los fragmentos d e d oble cad ena se combi na n con proteínas y pierden una cad ena d e ARN, convirtié ndose e n un complejo silenciador inducido por ARN, o RISC (por su sigla e n inglés). El RISC y e l ARNmi d e cade na simple se une n a fragmentos comp le mentarios de ARNm producidos por la célula. El ARNi es un meca nismo d e p rocesamie nto d el ARN que ocu rre naturalme nte y que puede haber evo lucio nado como un medio para bloquear la re pl icación d e los virus de ARN . Hoy e n día, los investigadores esperan apre nde r cómo utilizar este meca nismo para bloquear selectivame nte la producción d e proteínas individ uales d entro d e u na célula. El objetivo fina l d e los cie ntíficos es crear tecnologías q ue puedan ser utilizadas para el diagnóstico y el tratamie n to d e e nfermedades.

Una ven Laja del corle)' empalme alternaLivo es que permi Le que una única secuencia de ADN codifique ,mis de una proLeína. La designación de los segmenLos como codificantes o no codifican tes no es fija para un gen determinado. Segmentos del ARNm que son eliminados en un momenLo dado pueden ser m,ullenidos en el sigLLiente, generando un ARNm terminado con una secuencia diferente. Las formas estrechamente relacionadas de una única enzima, conocidas corno isoenzimas, probablemente son creadas mediante corte y empalme alternativo de un único gen. Tras el procesamienLo del ARNm, esLe sale de l núcleo a través de los poros n udeare,s )' se dirige hacia los ribosomas citoplasmáticos. Allí, el ARNm d irige la sintesis de una proteína.

22. Explique en una o dos oraciones la relación entre ARNm, ba~s nitrogenadas, intrones, exones, procesamiento del AANm y proteínas.

la traducción del ARNm produce una cadena de aminoácidos La síntesis proteica requiere la cooperación y la coordinación entre los tres tipos de ARN: ARNm,ARNr y ARNt. Al Uegaral citosol, el ARNm

procesado se une a ribosomas, que son partículas pequeñas de proteína y muchos tipos de ARNr. Cada ribosoma tiene dos subunidades, una grande y otra pequef1a, que se unen cuando comienza la síntesis proteica <• Pjg. [emailprotected]). La sub unidad rihosómica pequeña se une a.l ARNm y, luego, se suma la subunidad grande dejando el ARNm en el medio. Ahora, el complejo ribosoma-ARNm está listo para comenzar la traducción. Durante la traducción, los codones de ARNm se unen al aminoácido adecuado. EsLa un ión se logra con la ayuda de w1a molécula de ARNt ( Fig. 4 - 21 ©). Una región de cada ARNt conüene una secuencia de tres bases, llamada anticodón , que es complementaria a un codón del ARNrn. Una región diferente de la molécula ARNL se une a un am inoácido específico. Cuando comienza la traducción, los anticodones de los ARN t que transpo rtan amjnoácidos se adh ieren a los codones complementarios del ARNm unido a ribosomas. Por ejemplo, un ARNt con un anticodón de secuencia "U uu» transporta el am inoácido lisina. El anLicodón "UUU" se parea con un codón "AAA", uno de los dos codones para la lisina, en el ARNm. El apareamiento entre ARNm y ARNt coloca los aminoácidos recien Lemente traídos en la orien Lación adecuada para su unión a la cadena peptídica que se está sin tetizando. La síntesis por des/iidratació11 une aminoácidos mediante la formación de un e11/ace peptídico entre el grupo amino (-NH,) del aminoácido recién llegado y el extremo carboxilo (-COOH) de la cadena peptídica. Una vez que esto sucede, el ARNL "vacío" se libera del ARNm. Este ARNt puede adher irse a otra molécula de aminoácido con la ayuda de una enzima ci Losólica )' del ATP. Cuando se ha tm ido el último an1 inoácido de la cadena peptídica recientemente sinteti2.1da se alcanza la etapa de terminación ( Fig. 4-?.I ®l. El ARNm , el péplido y las subunidades ribosómicas se separan. L-0s ribosomas están listos para un nuevo ciclo de sín Lesis proteica, pero el ARNm es degradado por enzimas conocidas corno ribonuc/ensas. Algunas formas de ARNm son degradadas rápidamente, mientras que otras pueden permanecer en el ci Losol y volve r a ser traducidas muchas veces.

la distribución proteica dirige las proteínas hacia su destino Uno de los aspectos más so rprendentes de la síntesis proteica es la manera en la que proteínas especílicas van di rectamente desde los ribosomas hacia el lugar donde la célula las necesita, un proceso llamado distribucié11 proteica. Muchas proteínas recien lemen te creadas poseen una se'1al de distribuci611, una marca que le indjca a la célula dónde debe ir la proteína. Algunas proteínas que son sinLetizadas en ríbosomas citosól ícos no tienen señal de disLribución. Sin esta "eti-

AON

Transcripción

4r>_P_r-oc_e_s_a_m-ie-n-to- - , ~ delARNm

\

Acoplamiento de las subunidades ribos6micas

ARN polimerasa

---:

nuclear

~ \ \ Aminoácido

'

... ... _..--

Traducción

ARNt entrante unido aun

-·· Cadena peptidica en crecimiento

ARNt saliente '~vacío"

----.. ___·--

'

Terminación

J Q.tí'~~~~,_I

-- .. -· · - .... -

s,bomOad~

ribosómicas

~

ARNm

Cada molécula de ARNt se adhiere en un extremo a un aminoácido específico. El anticodón de la molécula de ARNt se aparea con el codón correspondiente del ARNm y permite la unión de los aminoácidos en el orden especificado por el código del ARNm.

completo

• FIGURA 4-21 Traducción. El ARNm procesado abandona e l núcleo y se asocia con ribosomas.

La traducción une los codones del ARN co n aminoácidos para crear una proteína.

queta de entrega", permanecen en el citosol tras liberarse de los ribosornas (Fig. 3-7 O>). La seflal de disLribución es un segmenLo especial de los am inoácidos llamado secuencia señal. La secuencia señal dirige la proteína hacia el org,\nulo adecuado, como las m iLocondrias o los peroxisomas, y le permiLe ser Lransportada a Lravés de su membrana. Los pépLidos sintelizados en ribosomas adheridos al retículo endoplasmático rugoso Lienen una secuencia seña l que los dirige a través de la membrana de RE rugoso )' denLro de la luz de esLe o rgán ul o. Cuando la proteína ingresa a la l uL del RE, se elimina enzimátic.amente la secuencia señal.

Las proteínassufren modificacionespostraduccionales La secuencia de am inoácidos que sale de un ribosoma es la estructura p ri maria de una p ro Leí na recientemenle sintetizada, pero no es la forma final. Ahora, la nueva proteína puede fo rmar d iferentes tipos de enlaces covalentes )' no covalentes, un proceso conocido como modificación postraduccional. La ruptura de la cadena de aminoácidos, la adición de moléculas o grupos y las uniones cruzadas son tres tipos de modificación posLraduccional. Hasta el momen to, se han descriLo más de 100 tipos diferentes de modificación postraducc ional.

En algunas formas com unes de este proceso, la cadena de ami noácidos puede: 1

2

Plegarse y adquirir diversas formas tridimensionale.s. El plegamiento de la proteína forma su estructura terciaria. Crear uniones cruzadas entre diferentes regiones de su estructu-

vas que deben desprenderse de segmentos para poder volverse activas. La enzima quimotripsina debe perder dos pequeños fragmentos pepúdicos antes de ser capaz de catalizar una reacción (fjg. 2-12a). El procesamiento postraduccional también activa algunas ho rmonas pepúdicas.

ra.

Uni611 a otras moléculas o grupos Las proteinas pueden ser modi-

Ser escindida (o dividida) en fragmentos. Unirse a olras moléculas o grupos. Acoplarse con otras cadenas de aminoácidos formando una proteína polimérica (es decir, de muchas partes). El acoplam ien to de proteínas en polímeros fonna la estruct ura cuaternaria de la proteína.

ficadas mediante su unión a azúcares (glL1cosilación ), generando glucoproteínas, o mediante su combinación con lípidos, formando lipoproteínas. Los dos grupos químicos que son más comúnmente añadidos a las proteínas son los grupos fosfato (PO, '·) y los grupos metilo (-CH 3 ) . La ad ición de un grupo metilo se denomina me1i-

Plegmniento prot.eico Los péplidos liberados desde los ribosomas pueden adoptar su forma l ridimensional final. Primero, cada péplido forma su estructura secundaria, la cual puede ser una hélice a o una lámina plegada ~- Luego, la molécula se pliega hasta su forma mediante puentes de h idrógeno, enlaces covalentes y enlaces iónicos que se generan entre aminoácidos de la cadena. Diferentes estudios muestran que parte deJ plegamiento proteico tiene luga r espontáneamente, pero frecuentemente es facilitado por proteínas colaboradoras llamadas chaperonas moleculares. La forma tridimensional de las proteínas habitualmente resulta esencial para su correcto funcionamiento. Las proteínas mal plegadas, junto con otras proteínas que la célula desea desu·uir, son marcadas con una proteína llamada 11bicuiti11a y enviadas hacia los proteosomas, complejos enzimáticos citoplasmálicos con (orma cilíndrica que degradan proteínas.

Acoplamiento en proteínas poliméricas Muchas proteínas complejas tienen una estructura cuaternaria con múltiples subun idades, en las cuales las cadenas proteicas se acoplan en dímeros, trímeros o te trámeros. Un ejemplo es la enzima lactato deshidrogenasa (descrita en la página 105). Otro ejemplo es la molécula de hemoglobina, con cuatro cadenas proteicas ( Fig. 2-3).

3 4 5

Uniones cruzaclas Parte del plegamiento proteico es mantenido en su lugar mediante puentes de hidrógeno )' enlaces iónicos relativamente débiles. Sin embargo, otras proteínas form an fuertes enlaces covalentes entre diferentes partes de su cadena de aminoácidos. Estos enlaces frecuentemente son puentes disulfuro (S- S) formados entre dos cisteínas, que contienen átomos de azu fre. Por ejemplo, las tres cadenas de la enzima digestiva q uimotripsina se mantienen unidas por puentes disulfuro.

Escisión Algunas proteínas biológicamente aclivas, como las enzimas y las hormonas, son sintetizadas inicialmente como moléculas inacti-

/aci611.

Revisión

23. ¿Cómo se llama la eliminación de un grupo fosfato? 24. Crtetres tipos generales de modificzción postraduccional de las proteínas. 2S. La hemoglobina, ¿es un monómero, un dímero, un tómero o un tetrámero?

Las diversas maneras en que las proteínas pueden ser modificarse tras finalizar sus síntesis aportan complejidad al cuerpo humano. No solo debemos conocer la secuencia de una proteína, sino también cómo es procesada, dónde se localiza (dentro o fuera de la célula) )' qué hace. Los científicos que trabajan en el Pro¡recto Genoma Humano inicialmente creían que nuestro ADN podía codificar alrededor de 30 000 proteinas, pero no tuvieron en cuenta el corte y empalme alternati vo ni las modificaciones postraduccionales. Los científicos que actualmente trabajan en el Proyecto Proteoma Humano estiman que descubriremos más de un millón de proteínas diferentes. La magnitud de este proyecto supone que deberá continuar desarrollándose en el futuro durante muchos años.

Enfermedad de Tay-Sachs En este tema relacionado, usted aprendió que la enfermedad de TaySachs es un trastorno genético recesivo e incurable en el cual falta la enzi ma que degrada los gangliósidos en las células. En Estados Unidos, uno de cada 27 estadounide nses descendientes de judíos de Europa del Este porta el gen de este trastorno. Otras poblaciones de alto riesgo incluyen a los canadienses franceses, los cajunes de Luisiana y los estadou nidenses irlandeses. Se estima que alreded or de una de cada 250 personas en la población gene ral estadouniden se es portadora del gen de la enfermedad de Tay-Sachs.

Usted tambié n aprendió que un análisis de sangre pu ede detectar la presencia de este gen fatal. Compruebe lo que ha aprendido sobre este tema comparando sus respuestas co n las del cuadro de resumen. Pa ra saber más sobre la enferm edad de Tay-Sachs, visite la página de referencia del NIH (www.ninds.nih.gov/disorders/taysachs/taysachs.htm) o a la página web de la Asociación de la Enfermedad de Tay-Sachs y Enfermedades Relacionadas (www.ntsad.org).

Resu m en del capítulo

Pregunta

Hechos

Integración y análisis

1. ¿Qué otro síntoma es esperable encontrar en le enfermedad de Tay-Sachs, además de la pérdida del control muscu lar y de la función cerebral?

la hexosamin1dasa A degrada los ga ngliósidos. En la enfermedad de Tay-Sachs, esta e nzima no está presente y los gangliósidos se acumulan en las células, incluyendo las células fotosensibles del ojo, y hace que funcionen anormalmente.

El daño a las células fotosensibles del ojo podría ocasionar problemas de visión e incluso ceguera.

2. ¿Cómo podría usted evaluar si Sarah y David son portadores del gen de Tay-Sachs?

los portadores del gen tienen niveles de hexosaminidasa menores a lo normal.

llevando a cabo pruebas para determinar los niveles prom ed io de la e nzima en portadores ya estab lecidos de la enfermedad (es decir, personas que son padres de niños con la enfe rmedad de Tay-Sachs) y en personas que tienen poca probabilidad de ser portadoras. luego, comparando los niveles enzimáticos de los supuestos portadores, como Sarah y David, con los valores p romedio de los portadores conocidos y de los no portadores,

3. ¿Por qué este nuevo método para la detección del gen de Tay-Sachs es más exacto que el estudio anterior que detecta cantidades d isminuidas de hexosaminidas.a A?

El nuevo método detecta el gen defect uoso. El método anterior analizaba los niveles de la enzima p roducida por el gen.

l a nueva prueba es una forma direct a de evaluar si una persona es portadora. El método anterior era indirect o. Es posible que otros facto res distintos a un gen defectuoso alteren los niveles enzimáticos de una persona. ¿Puede pensar en algunos? (Véase la respuest a al final de este capítulo.)

4 . El gen de Tay-Sachs es un gen recesi-

El apareamiento de Tt X TT tiene como resultado la siguiente des-

Si solo un progenitor es portador, cada niño tiene una probabilidad del 50% de ser portador (Tt). Si

r an~ on,-¡:ii. TT T t TT Tt ~l :;:;n ..::tr a::i -

"M9paéRlfU191i'ib?W ~S\.'e ~f1f},ffif8.'f<

El apareamiento de Tt X TT tiene como resultado la siguiente descendencia: TT, Tt, TT, Tt. El aparea miento de Tt X Tt tiene como resultado la siguiente descendencia: TT, Tt, Tt, tt.

Si solo un progenitor es portador, cada niño tiene una probabilidad del 50% de ser portador (Tt). Si ambos progenitores son portadores, existe una probabilidad del 25% de que un niño tenga la enfermedad de Tay-Sachs y una probabilidad del 50% de que sea portador.

vo {t). Si Sarah es portadora del gen \Tt)

4 . El gen de Tay-Sachs es un gen recesi-

vo {t). Si Sarah es portadora del gen \Tt) pero David no, ¿cuál es la probabilidad de que cualquiera de sus hijos sea portador? {Consulte un t exto de biología general o de genética general sí necesita ayuda para contestar esta preg unta.)

99

104

107

110

125

cvi ~ t o 11n:11 n r n .

118 .

Resumen del capítulo El tema principal de este capítulo es la e11ergía e11 los sistemas biológims y cómo es adquirida, transfeiida y milizada para reafü.ar trabajo biológico. La energía es almacenada en grandes biomoléculas, como las grasas y el glucógeno, y es extraída de ellas a través de los procesos del metabolismo. La energía extraída habitualmente es almacenada temporalmente en los enlaces fosfato de alta energía del ATP. Las reacciones y los procesos que requieren energía utilizan frecuentemente el ATP como fuente energética. fste es un patrón que usted verá repetidamente al estudiar más sobre los sistemas orgánicos del cuerpo. Otros temas en este capítulo incluyen dos tipos de relacümes estructura-f1111ció11: las interacciones moleculares y la compartimenta-

cion. Las i11temccio11es moleculares son i mportan tes para las enzimas, cuya capacidad para unirse a sm sustratos influye en la actividad enzimática. La compartimentaciim de las enzimas perm ite a la célula dirigir el flujo de energía sepa rando las funciones. La glucólisis tiene lugar en el citosol celula r, pero el ciclo del ácido cítrico ocurre dentro de las mitocondrias, por lo que requiere que los sustratos sean transportados a través de la membrana mitocondrial. La modulación de la actividad enzimática y la separación de rutas demro de compartimentos subcelulares son esenciales para la organi1.ación y la separación de los procesos metabólicos.

La energía en los sistemas biológicos

Metabolismo

1. La energía es la capacidad para generar trabajo. El trabajo químico permite a las células y los organismos crecer, reproducirse y llevar a cabo las actividades normales. El trabajo de transporte permite a las células movilizar moléculas para generar gradientes de concentración. El t rabajo mecánico es utilizado para el movimiento. (pp. 100- LO l ) 2. La energía cinética es la energía del movimiento. La energía potencial es energía almacenada. (p. 101; Fig.4-2 )

16. fodas las reacciones químicas del cuerpo constituyen colectivamen-

Reacciones químicas 3. Una reacción química comienza con uno o más reactivos y finaliza con w10 o más productos /Cuadra 4-7) . La velocidad de reacción se mide como el cambio en la concentración de los productos en el tiempo. (p. 102 ) 4. La energía almacenada en los enlaces químicos de una molécub y disponible para desarrollar trabajo es la energía libre de esa molécula. (p.

te el metabolismo. Las reacciones catabólicas liberan energía y degradan grandes bio moléculas. Las reacc.iones anabólicas requieren un aporte neto de energía y sintetizan grandes biomoléculas. (p. 109) 17. Las células regulan el flujo de moléculas a través de sus mtas metabólicas mediante ( 1) el control de las concentraciones enzimáticas, (2) la producción de moduladores alostéricos y moduladores, (3) la uti-

lización de diferentes enzimas para catalizar reacciones reversibles, ( 4) el aislamiento de enzimas dentro de orgánulos intracelulares o ( 5)

el mantenimiento de una proporción óptima entre ATP y ADP. (pp. 110-111 ) 18. Las rutas aerobias requieren oxígeno y tienen el mayor rendimiento

de ATP. Las rutas anaerobias pueden producirse sin oxígeno, pern generan ATP en cantidades mucho más pequeñas. (p. 1 11 )

102)

5. La energía de act ivación es el aporte inicial de energía necesaria para comenzar la reacción. (p. !03; Fig. 4-3) 6. Las reacciones exergónicas liberan energía. Las reacciones endergónicas utilizan energía. (p. l03; Fig. 4 -3) 7. Las rutas metabólicas acoplan reacciones exergónicas con reacciones endergónicas. (p. 104: Fjg :J -4 \ 8. La energía parn llevar a cabo las reacciones endergónicas se almacena en el ATP. (p. 104) 9. Una reacción que puede ocurrir en ambas direcciones se llama reacción reversible. Si una reacción puede ocurrir en un sentido pero no en la otra, es una reacción irreversible. El cambio de energía libre de una reacción determ ina si la reacción puede ser revertida. (p. 104)

Producción de ATP

Enzimas 1O. las enzimas son catalizadores biológicos que aceleran las reacciones químicas sin sufrir modificaciones. En las reacciones catali;mdas por enzimas, los reactivos se llaman sustratos. (p. 105) 11. C..omo otras proteínas que unen ligandos, las enzimas muestran saturación , especificidad y competición. Las isoenzimas relacionadas pueden tener diferentes actividades. (p. 105) 12. Algunas enzimas son producidas como precursores inactivos y deben ser activadas. Esto puede requerir la presencia de un cofactor. Los cofactores orgánicos son llamados coenzimas. (p. 106) 13. la actividad enzimática es alterada por la temperatura, el pH y las moléculas moduladoras. (p. 106) 14. Las enzimas actúan disminuyendo la energía de activación de una reacción. ( p. 107; f'ig. 4-7) 15. La mayoría de las reacciones se pueden clasificar como reacciones de oxidorreducción, de hidrólisis-deshidratación, de adición-sustracción -in tercambio o de ligadura. (p. 108; Cuadra 11-4)

22.

Líquidos y electrolitos: introducción a los fluidos corporales

19. A t ravés de la glucólisis, una molécula de glucosa se transforma en dos moléculas de piruvato y produce 2 ATP, l NAD H y 2 H ·. la glucólisis no requiere la presencia de oxígeno. (p. 113; Fig. 4-12) 20. El metabolismo aerobio del piruvato a través del ciclo del ácido cítri-

21.

23.

24.

25.

26.

co produce ATP, dióxido de carbono y electrones de alta energía captados por NAD H y FADH,. (p. 114; Fig. 4-13) Los electrones de alta energía del NADH y del FADH, ceden su energía al pasar por el sistema transportador de electrones. Esta energía se almacena en los enlaces de alta energía del ATP. (p. ll5; Fig. 4-14) El máximo rendimiento de energía del metabolismo aerobio de una molécula de glucosa es 30-32 ATP. En el metabolismo anaerobio, el piruvato se transforma en lactato, con un rendimiento neto de 2 ATP por cada molécula de glucosa. (p. 116; Fig. 4-15) La síntesis proteica es controlada por genes nucleares hechos de AUN . El código representado por la secuencia de bases de un gen se transcribe a un código complementario de bases de ARN. El corte y empalme alternativo del ARNm en el núcleo permite a un gen codificar múltiples proteínas. (pp. 119-121; f'igs. 4 - 18, 4-19, 4-20 ) El ARNm abandona el núcleo e ingresa al citosol, donde, con la a)'tlda del ARN de transferencia y el ARN ribosómico, ensambla aminoácidos en la secue.nc.ia correspondiente. Este proceso se denomina traducción. (p. 123; Fig. 4-21 ) La modificación post raduccional convierte la proteína recientemente sintetizada en su forma final. (pp. 123-124)

Preguntas Nivel 1: revisión de hechos y términos 1. C ite las t res formas básicas de trabajo y dé un ejemplo fisiológico de cada una. 2. Explique la djferencia entre energía potencial y energía cinética. 3. Enuncie las dos leyes de la termodinámica en sus propias palabras. 4. La suma de todos los procesos químicos a través de los cuales las células obtienen y almacenan energía se llama - - - -

Véanse las respuestas en ef apéndice A

5. En la reacción C0 2 + H ,O ~ H 2CO,, el agua y el dióxido de carbono son los reactivos y el H,CO, es el producto. Debido a que esta reacción es catalizada por una enzima, también es apropiado llamar al agua y al dióxido de carbono - - - - La rapidez con la que ocurre la reacción se llama - - - - de reacción, expresada habitualmente como molaridad/segundo. 6. Las/los - - - -son moléculas proteicas que aceleran las reacciones quimicas al (¿disminuir o aumentar? ) la energía de activación de la reacción.

7. Una cada definición de la columna de la izquierda con el término

correcto de la columna de la derecha (no utilizará todos los términos): l. reacción que puede ocurrir en

(a) exergónica (b) endergónica (c) energía de activación (d ) reversible (e) irreversible ( f) especificidad (g) energía libre (h) saturación

cualquier dirección 2. reacción que libera energía 3. capacidad de una enzima para catalizar una reacción y no otra 4. aporte de energía necesario para poner en marcha una reacción

18. Cuando los enlaces se rompen durante ttna reacción qmmica, ¿cuáles son los tres posibles destinos de su energía potencial? 19. Una cada proceso metab61ico con el tema biológico que mejor lo describe: (aJ Utilización de la energía biológica (b ) Compa:rtimentación (c) Interacciones molenúares

8. Desde 1972, las enzimas se han designado afiadiendo el sufijo

9.

JO.

1 l.

l 2.

13.

14.

J 5.

16.

- - - -a su nombre. Las moléculas orgánicas que deben estar presentes para que una enzima funcione se llaman - - - - Los precursores de estas moléculas orgánicas provienen de las - - - - de nuestra dieta. En una reacción de oxidorreducción, en la cual los electrones se transfieren entre moléculas, se dice que la molécula que gana tm electrón se - - - - y la que pierde un electrón se - - - La eliminación de H 10 de las molérnlas reactivos se denomina - - - - La utilización de H,O para degradar polímeros, como el almidón, se denomina - - - La eliminación de un grupo amino (-NH,) de una molécula (como un aminoácido) se llama - - - - La transferencia de un grupo amino de una molécula al esqueleto de carbono de otra molécula (para formar un aminoácido diferente) se llama - - - En el metabolismo, las reacciones - - - -liberan energía y resultan en la degradación de grandes biomoléculas, mientras que las reacciones - - - - requieren un aporte neto de energía y resultan en la síntesis de grandes biomoléculas. ¿Cuál es la unidad que utilizamos para medir la energía del metabolismo? La regulación metabólica en la cual el ultimo producto de wrn ruta metab61ica (el producto final ) se acumula y enlentece o detiene las reacciones que ocurren antes en la ruta se llama - - - Explique cómo el flujo de H · a través de la membrana mitocondrial interna tiene como resultado la síntesis de ATP. Nombre las dos moléculas transportadoras que llevan los electrnnes de alta energía al sistema transportador de electrones.

Nivel 2: revisión de conceptos 17. Realice un mapa conceptual utilizando los siguientes términos.

Mapa 1: metabolismo • acetil CoA • ATP • ciclo del ácido cítrico

• co,

• • • •

glucólisis elearones de alta energía lactato mitocondrias

1. La glucólisis tiene lugar en el citosol; la fosforilación oxidativa ocurre dentro de las mitocondrias. 2. El sistema transportador de electrones capta energía en w, gradiente de concentración de iones hidrógeno. 3. Las proteínas son modificadas en el retículo endoplasmático. 4. Las reacciones metabólicas habitualmente se acoplan a la reacción AlP ~ AüP + P, S. Algunas proteínas tienen enlaces S-S entre aminoácidos no adyacentes. 6. Las enzimas catalizan reacciones biológicas.

20. Explique por qué es ventajoso para la célula almacenar o secretar una

21.

22. 23.

24. 25.

enzima en forma inactiva. Compare los siguientes conceptos: (a) el rendimiento energético de la degradación aerobia de la glucosa en CO, y H,O y (b) el rendimiento energético de una molécula de glucosa a través de la glucólisis anaerobia que finaliza en lactato. ¿Cuáles son las ventajas de cada ruta? Describa brevemente los procesos de transcripción y traducción. ¿Qué orgánulos están involucrados en cada proceso? ¿En qué molécula aparece el anticodón? Explique el papel de esta molécula en la síntesis proteica. La energía del enlace fosfato del ATP, ¿es un ejemplo de energía potencial o de energia cinética? Si el ATP libera energía para llevar a cabo una reacci6n química, ¿usted espera que esa energía de activación sea grande o pequeña? Explique.

Nivel 3: resolución de problemas 26. 'Jeniendo en cuenta el siguiente fragmento de ADN, escriba la secuencia entera de bases que debería aparecer en el ARNm complementario. Escriba el codón de ARNm correspondiente a cada rriplete subrayado. Luego, nombre los aminoácidos codificados por esos cuatro tripletes. ADN:CGC1ACAAGTCACGTACCGTAACG ARNm: Aminoácidos: Nivel 4: problemas analíticos 27. El gráfico muestra el cambio de energía libre para la reacción A + H - > D. ¿Se trata de una reacción endergónica o exerg6nica?

• citosol • NADH • sistema transportador de electrones • oxígeno • FADH, • piruvato • glucosa • agua Mapa 2: síntesis proteica • • • • • •

corte y empalme alternativo apa:reamiento de bases bases (A, C, G, T, U) ADN exón gen

• intrón

• promotor • ARNm • ARNt

AeB

• • • • • • • • •

ribosoma ARN polimerasa procesamiento de ARN codón de iniciación codón de terminación cadena codifican te transa-ipción factores de transcripción traducción

o

Tiempo -

28. Si la región codificante de una molécula de ARNm procesado tiene una longitud de 450 bases, ¿cuántos aminoácidos tendrá el polipépti-

do correspondiente? (Sugerencia: el codón de iniciación se traduce en un aminoácido; no así el codón de terminación.)

Respuestas (

Respuestas a las preguntas de revisión

1

Página 100 1. Los aminoácidos y los nucleótidos siempre contienen nitrógeno. Página 102 2. La energía se almacena en el cuerpo en enlaces químicos y gradientes de concentración. 3. La energía cinética es la energía del movimiento: algo está sucediendo. La energía potencial es energía almacenada: algo está por suceder. 4. La entropía es un estado de aleatoriedad o desorden. Página 105 5. Las reacciones endergónicas consumen energía; las exergónicas liberan energía. 6. Los reactivos son el bicarbonato y el vinagre; el producto es el dióxido de carbono. 7. La producción de espuma indica que se está liberando energía, por lo que ésta es una reacción exergónica. La gran cantidad de energía liberada indica que la reacción no es fácilmente reversible. Página 107 8. La presencia de isoenzimas permite que una reacción sea catalizada en una variedad de condiciones. 9. Las cuatro cadenas proteicas representan el nivel cuaternario de la estructura proteica. Página 109 LO. Los sustratos son lactosa (para la lactasa), péptidos (para la peptidasa), lípidos (para la lipasa) y sacarosa (para la sacarasa). l l. (a) 3; (b ) 2; (c} 4; (d ) l Página 111 12. Las células regulan el llujo mediante ( 1) el control de la cantidad de enzima, (2 ) la producción de moduladores alostéricos y covalentes, (3) la utilización de dos enzimas diferentes para catalizar Jas reacciones reversibles, ( 4 ) el confinamiento de las enzimas dentro de orgánulos intracelulares)' (5) la modificación de la proporción entre ADP y AT P dentro de la celula. 13. En el ATP, Ja energía es almacenada en w10 de los tres enlaces fosfato. En el NADH, la energía se almacena en los electrones de alta energía. 14. las rutas aerobias requieren cantidades suficientes de oxígeno molecular (0 2) dentro de la célula. Las rutas anaerobias pueden funcionar sin oxígeno. Página 112 IS. (a ) 4; (b ) 5, 5; (c) 2, 5; (d ) l, 3 16. Las reacciones endergónicas almacenan energía en los productos. Página 117 17. Cuando los iones H- son bombeados hacia el espacio intermembrana se almacena energía en su gradiente de concentración. La liberación de esta energía a medida que los H+ pasan a través de la ATP sintasa se acopla a la síntesis de ATP. 18. la lactato deshidrogenasa act úa sobre el lactato sustrayendo un electrón y un átomo de hidrógeno. Este proceso se llama oxidación. 19 . El metabolismo anaerobio de la glucosa puede funcionar en amencia de oxígeno; el metabolismo aerobio requiere oxígeno. El metabolismo anaerobío produce mucho menos ATP por cada glucosa utilizada que el metabolismo aerobio.

Página 121 20. Los tripletes de ADN son: A'r r, A l'C y ACT. 2 1. La polimerasa ARN sintetiza polímeros de AJlN. Página 122 22. Durante el procesamiento del ARNm, las secuencias de bases llamadas intrones son eliminadas del ARNm. los segmentos restantes (exones) son empalmados nuevamente entre sí, conformando el código para la sintesis de una proteína. Página 124 23. La eliminación de un grupo fosfato se llama desfosforilación. 24. Tres tipos de modificació n postraduccional son: escisión, unión a grupos y uniones cruzadas. 25. La hemoglobina es un tetrámero debido a que cuenta con cuatro cadenas proteicas.

O Respuestas a las preguntas de las figuras Pág ina 105

Figura 4-5: El gráfico muestra una reacción endergónica. Página 106 FigLira 4-6: Cuando el pH cae de 8 a 7,4 , la actividad enzimática aumenta. Página 110 Figura 4- 1O: Una cinasa traslada un grupo fosfato de una molécula a otra. Una fosfatasa elimina un grupo fosfato. Página 113 Figura 4-12: 1. La glucólisís es una ruta exergónica. 2. (a ) (ú , @ . (b ) Cli), ® , ®. (c) las cínasas a11aden un grupo fosfato. (!), @ , @ . ( d} Las deshidrogenasas eliminan un electrón y un átomo de hidrógeno. En el paso ® , el NAO · adquiere un electrón y un H, lo que sugiere que este paso es catalizado por una deshidrogenasa. 3. El rendimiento neto por cada molécula de glucosa es de 2 ATP y 2 NADH . Página 114 Figura 4-13: l. El ciclo del ácido citrico es exergónico. 2. El rendimiento neto por cada piruvato es de 4 NADH, l FADH 2 y l ATP. 3. Se generan 3 C0 2 por cada piruvato. El número de carbonos en los 3 CO, es igual al número de carbonos en un piruvato. Página 11 s Figura 4-14: l. La fosforilaciém es la adición de un grupo fosfato. En la fosforilación oxidativa se fosforila el ADP. 2. El flujo de electrones es exergónico. 3. El oxígeno actúa como receptor de electrones y de iones hidrógeno al final del ETS.

O Respuesta a la conclusión del tema relacionado Página 124 Pregunta 3. Otros factores además del defecto genético podrían alterar los niveles enzimáticos, incluyendo una disminución en la síntesis proteica o un aumento de su degradación en la céhúa. Tales cambios podrían ocurrir incluso si el gen fuese normal.

Dinámica de la membrana 130

Homeostasis no significa equilibrio

ósmosis y tonicidad 132 El cuerpo está formado principalmente por agua 132 El cuerpo se encuentra en equilibrio osmótico 133 La osmolaridad describe el número de partículas en solución 134 La tonicidad describe el cambio de volumen de una célula Los procesos de transporte 140 Las membranas celulares son selectivamente permeables Difusión 142 Las moléculas lipófilas atraviesan lasmembranas por difusión simple Transporte mediado por proteínas 145 Las proteínas de membrana cumplen cuatro funciones principales 146 Las proteínas de canal forman túneles abiertos llenos de agua 148 Las proteínas transportadoras cambian su conformación para movilizar

149 150 153

moléculas La difusión facilitada utiliza proteínas transportadoras El transporte activo moviliza sustancias en contra desus gradientes de concentración El transporte mediado por transportadores presenta especificidad, competición ysaturación

Transporte mediado por vesículas 155 La fagocitosis crea vesículas utilizando el citoesqueleto 155 La endodtosis forma vesículas más pequeñas 157 La exocitosis libera moléculas demasiado grandes para las proteínas

transportadoras Transporte transepitellal 158 El transporte transepitelial puede ser paracelular olranscelular 159 El transporte transcelular de glucosa utiliza proteínas de membrana 160 La transcitosis utiliza vesículas para atravesar un epitelio El~ncialde mbrana de reposo 161 Repasoso ricidad ,,,,. 161 La membran1 c r permite la separación de las cargas eléctñcas en el cuerpo 163 Etpoteociat'cle m na de reposo se debe principalmente al potasio

166

e.os en la per

Proce$os de membr1.1 · ulina Q

"dad alos iones modifican el potencial de membrana

n 1992, el personal médico del apartado Hospital Atoi fi , en las islas Salomón del Pacífico Sur, se en frentó a un dilema. Un paciente se presentó con vóm itos y req uería hidratación intravenosa (TV ), pero los s umi nistros del hosp ita l se habían agotado, y el próximo av ión con provisiones no \•olvería h asta dentro de muchos dias. La solución del equipo fue intentar algo que solo habían escuchado: crearon una preparació n IV con agua de coco, el líquido estéril que se forma en el interio r de estos frutos. Durante dos días, el pacie nte recibió un go teo len to por vía intravenosa del liquido proveniente de cocos que colgaban cerca de su cama. Pronto se recuperó)' se encontró suficien temen te bien co mo para irse a su casa.• No se sabe qu iénes fueron los p rimeros en utiliza r el agua de coco como so lución IV, aunque hay versiones que cuentan que tanto japoneses como b ritán icos la utilizaban en el teatro de operaciones del Pacífico dura nte la Segunda Guerra Mundial. Sin embargo, elegir la solución JV adecuada es más que una cuestión de suerte: requiere un sólido conocimien to de los compartimentos corporales y de las diferentes formas en q ue los solutos se desplazan en tre ellos.

E

Homeostasis no significa equilibrio El cuerpo tiene dos compartimentos líquidos diferenciados: las células y el líqu ido que las rodea Fig. 5-1). El líquido extracelular (LEC), fuera de las cél ulas, actúa como un in termediario entre estas)' el medio exterior. Todo lo q ue entra o sale de la mayoría de las células atrav iesa el LEC. El agua es, en esencia, la única molécula q ue se desplaza libremente en tre las células y el líquido ext racelular. Debido a este lib re movimiento del agua, los compartimentos extracel ula.r e in tracelular alcanzan un estado de equilibrio osmótico (osmos, empujar o propulsar), en el cual las concentraciones en el líquido son iguales a ambos lados de la membrana celular (la concentración se expresa como una cantidad de sol u to por unidad de volumen [Fig. 2-7] ). Aunque las

<•

Fibrosisquística Hace más de cien años, las parte ras rea lizaban una prueba muy particular: lamían la frente del recién nacido. Un sabor salado sig· nificaba que e l niño moriría de una misteriosa enfermedad q ue debilitaba los músculos y quitaba el aliento. Hoy se le realizará a Daniel Biller, un niño de 2 años de edad con antecedentes de pérdida de peso y problemas respi ratorios, una 'prueba del sudor" en un hospital central (esta vez, con técnicas modernas). ¿El nombre de esta misteriosa enfermedad? Fibrosis quística.

14B

158

161

168

D. C.ampbeU-Fakk et al The imravenous use of coconutwater. A111 J Emerg Med 18:108-111, 2000.

~

130

concen traciones totales en el LEC y el líquido intracel ular (LIC) son iguales, algunos sol utos están más concen trados en uno de los dos compartim entos corporales (Fig. 5- Ld). Esto sign ifica que el cuerpo está en tm estado de desequilibrio qtúmico. La Figura 5-ld muestra la distribución desigual, entre los compartimentos líquidos del cuerpo, de la mayoría de los principales salutes. Por ejemplo, los iones sodio, cloruro y bicarbonato (HCO;) están más concentrados en el líquido extracelular que en el intracelular. El calcio (que no se muestra en la figttra ) está más concentrado en el líquido extraceltilar que en el citosol, aunque muchas células alm acenan Cai• dentro de orgánulos como el retículo endoplasm!itico y las mi tocondr ias. Incluso el líqu ido extracelular no se encuen tra en equilibrio en tre sus dos subcompartimen tos, el plasma y el líquido intersticial (LI ). El plasma es la mat riz líquida de la san~re y se encuentra dentro del aparato ci rculatorio. Las proteínas y otros an iones grandes están concentrados en el plasma pero no pueden atravesar el epitelio íenestrado de intercambio de los vasos sanguíneos, por lo que mayoritariamen te no están p resentes en el líqu ido intersticial. Po r otro lado, las moléculas )' los iones más pequeños, como el Na+ y el CI·, son suficientemente pequeños para pasar libremente entre las células endoteliales, por lo que tienen las m ismas co ncentraciones en el plasma y en el líquido in tersticial. Las d iferencias de concen tración del desequilibrio químico son una característica d istintiva de todo ser vivo, ya que solo el aporte continuo de energía mantiene al cuerpo en este estado. Si los solutos se filtran a través de las membranas celulares (q ue dividen los compa rtimen tos in tracel ular y extracel ular), se requiere energía para devolverlos al compartimento del cual salieron. Po r ejemplo, los iones K· , que salen de la célula, y los iones Na·, q ue penetran en ella, son devueltos a sus comparti mentos originales mediante una enzima que requiere energía, llamada Na·-K+-ATPasa o bomba de sodio-potasio. Cuando las cél ulas mueren )' no pueden utilizar energía, obedecen la segw1da ley de la term odinám ica y regresan a un estado de aleatoriedad caracterizado por la pérdida del desequilibrio quim ico. Muchos de los sol utos co rporales mencion ados hasta aquí son iones, y po r esta razón también debemos considerar la distribución de la carga eléctrica entre los compar timentos intracelular y extracelular. El cuerpo en su totalidad es eléctricamente neutro, pero algunos iones negativos adic ionales se acumulan en el líq uido intracelular, m ientras que sus iones positivos correspondientes se local izan en el líquido extracelular. Como resul tado, el in ter ior celular es levemen te negat ivo en relación con el líquido extracelular. Este desequil ib rio ión ico resulta en un estado de desequilibrio eléctrico. Cambios en este desequilibr io generan sefiales eléctricas. Analizaremos este tema con mayor detalle más adelante en este capítulo. En resumen, observe que homeostasis no es lo mismo que equilibrio. Los compartimentos co rporales in tracel ular y extracelular están en equilibrio osmótico, pero en desequilib rio químico y eléctrico. Más aun, el equilibrio osmótico y los dos desequilib rios son equilibrios dinámicos. La meta de la homeostasis es mantener los equilibr ios dinámicos de los compartimentos co rpora.les. En lo que resta del capítulo analizaremos estos tres equil ibrios y el papel que cumplen los mecanismos transpo rtadores)' la permeabilidad selectiva de las membranas celulares en el mantenimiento de estos estados.

• FIGURAS-1 FUNDAMENTOS

• •

Compartimentos líquidos del cuerpo (a) Los líquidos corporales se encuentran en dos compartimentos: el liquido extracelular (LEC) y el liquido intracelular (UC}. El LEC y el UC se encuentran en equilibrio osmótico, pero tienen composiciones químicas muy diferentes.

V

El líquido intracelular constituye 2/3 del volumen total del agua corporal. Las sustancias que se desplazan hacia y desde el LIC deben atravesar la membrana celular. El líquido extracelular incluye todo el liquido fuera de las células. El LEC representa 1/3 del volumen del liquido corporal y consiste en:

--

1

.-

-

''

PREGUNTAS

'

'

-

-

-

120 -

:Q

100 -

e :Q

80

o ·1: o ro

~

e ~ e o

ü

-

-

.s.ro

-

-

60 -

-

LEYENDA

-

-

40 20 -

Líquido intracelular

-

160 140

Plasma

frecuentemente representando diagramas de caja como el siguiente.

'' 1. Utilizando el volumen del LEC que 80% ' se muestra en (b), calcule los vo'' o o ' lúmenes del plasma y del liquido 28 L ' ro :::, ' intersticial. '' g> 60% ro ' 2. ¿Cuál es el volumen de agua corE: vi , Líquido poral total de una persona? ~ : intersticial 3. Utilice las respuestas de las dos .'' preguntas anteriores para calcular ' -14 L Plasma el porcentaje del agua corporal total '' - (25% del LEC) ' que representan el plasma y el líqui'' .do intersticial. 20% Líquido inters'' 4. Una mujer pesa 55 kg (121 libras). - ticial (75% del '' ' Utilizando las proporciones estánLEC) '' dar para los compartimentos líquiLíquido Líquido dos. calcule su volumen de LEC, 1<- ECF intracelular (LIC) extracelular (LEC} LIC y plasma (1 kg = 2,2 libras; 1/3 Membrana 1 kg de agua =; L). celular (d) Los compartimentos corporales se encuentran en un estado de desequilibrio químico. La membrana celular es una barrera selectivamente permeable entre el LEC y el LIC.

o E

Líquido intersticial

(c) Los compartimentos líquidos son ilustrados

oi 100%

:J' :::,

Líquido intracelular

• Plasma, la matriz liquida de la sangre, que representa el 25% del volumen del LEC. Las sustancias que se desplazan entre el plasma y el líquido intersticial deben atravesar el epitelio fenestrado de la pared capilar.

para un hombre "promedio" de 70 kg.

i

D D D

• Líquido intersticial (U), el cual se encuentra entre el aparato circulatorio y las células y constituye el 75% del volumen del LEC.

(b) Esta figura muestra los volúmenes de los compartimentos

§

LEYENDA

n - ··' Líquido intracelular

,_ ,.

n

Líquido intersticial

,_

1, íl

Plasma

o o o

•o

Na

K Ci

HC03

Proteínas

º

ICF I 23

PREGUNTAS 5. ¿En qué se distingue la composición iónica entre el plasma y el U? 6. ¿Qué iones se concentran en el LEC? ¿Cuáles en el LIC?

Revisión

1. Utilizando lo aprendido sobre la nomenclaturade lasenzimas 2. El líquido intracelular puede distinguirse del extracelular por la alta concentración enel LIC de iones _ _ ysu bzja concentración de iones _ _ - - - Y- -3. Clínicamente, evaluamos l.; homeostasisde diversos solutos, tales como iones, ga56 en

sangre ysolutos Oigánicos, tomando una muestra de sangre y analizando el plasma. Para cada una de las siguientes sustancias, mencione si el hecho de conocer su concentración p!osmática también iadica suconcentración enel LEC y enel LIC. Justifique su respuesta. (a) Na·

Contenido de agua como porcentaje del peso corporal total por edad ysexo

Edad

Hombre

Mujer

Bebé

65%

65%

1-9

62%

62%

10-16

59%

57%

17-39

61 %

51%

40-59

55%

47%

60+

52%

46%

(b) K•

(c)agua (d) proteínas

Ósmosis y tonicidad La distribución de solutos en el cuerpo depende de la capacidad de las sustancias para atravesar las membranas celulares. El agua, por o tro lado, es capaz de moverse lib remente dentro y fuera de casi todas las células del cuerpo, atravesando canales iónicos )' canales de agua especiales formados por la proteína acuaporina (AQP, por sus siglas en inglés). En esta sección estud iaremos la relación ent re el flujo de sohttos y el ílujo de agua a Lravés de las membranas celula res. Un b uen entend imiento de este tema proporciona los fundamentos para la utilización clínica del Lralamiento con líquidos intravenosos ( IV).

El cuerpo está formado principalmente por agua El agua es la molécula más importante del cuerpo humano, ya q ue es el solven Le de todos los seres vivos. Cuando b uscamos vida en regiones distantes del sistema solar, una de las primeras preguntas que los científicos se hacen sobre un planeta es: "¿Tiene agua?". Sin ella, la vida tal y como la conocemos no puede existir. ¿Cuánta agua hay en el cuerpo humano? Debido a las diferencias interindividuales, no hay una 1u1ica respuesta. Sin embargo, en fisiología humana utilizamos habitualmente valo res estánda r para las funciones fisiológicas con base en el "hombre de 70 kg''. Estos valores estándar provienen de la información publicada a med iados del siglo 20 por la Comisión ln lernacional de Protección Rad iológica ( ICRP, por sus siglas en inglés). La !CRP estaba estableciendo guías para la exposición permilida a la radiación y seleccionó un hombre joven (20-30 af1os de edad), blanco, europeo, que pesaba 70 kilogramos (kg) o 154 libras, y lo llamó "hombre de referenc ia" u " hombre estándar''. En l 984, al Hombre de Referencia se le unió la Mujer de Referencia, una joven mujer de 58 kg ( 127,6 libras). Sin embargo, la población estadounidense se está vo lviendo cada vez más grande y pesada, y en l 990, el Hombre de Referencia equivalente había engordado hasta los 77,5 kg y era 8 cm más alto. El Hombre de Referencia de 70 kg tiene un 60% de St L peso corporal total, es decir, 42 kg (92,4 libras) en forma de agua. Cada kilogramo de agua Liene un volumen de l litro, por lo que su agua corporal total es de 42 litros. ¡Esto equivale a 2 l botellas de refresco de dos litros! Las mujeres adultas tienen menos agua por cada kilogramo de masa corporal q ue los hombres debido a que tienen más tejido adipo -

Adaptado de Edelman y Leibman, Am J Med 27; 256-277, 1959.

so. Las grandes gotas de grasa del tejido adiposo ocupan la mayor parle del volumen celular y desplatan el citoplasma acuoso (véase la Fig. 3-13e). La edad también influye en el contenido de agua. Los niños Lienen relativamente más agua q ue los adultos, y el conten ido de agua disminuye a parLi r de los 60 años de edad. El a Cuadro 5- 1 muestra el contenido de agua como porcentaje del peso corporal total en personas de diversas edades y de ambos sexos. En la práctica clínica, es necesario tener en cuenta la variabi lidad del contenido corporal de agua al momento de prescribir medicamentos. Debido a que las mujeres y las personas mayores tienen menos agua corporal, tendnín una concentración del fárm aco en el plasma mayor que la de un hombre joven, si a todos se les da la misma dosis por kilogramo de peso corporal. La distribución de agua entre los compartimen tos corporales es menos variable. Cuando observamos los vol(unenes relativos de los compartimentos corporales, el compartimento intracelular cont iene alrededor de dos tercios (67%) del agua cor poral ( Fig. 5- l b, c). El ter· cio restante ( 33%) se divide entre el líqtúdo intersticial (el cual contiene alrededor del 75% del agua extracelular) y el plasma (que con tiene cerca del 25% del agua exLracelular). Revisión

4. Si la Mujer de Refel€ncia de 58 kg tiene un agua corporal total equivalente el 50% de su peso corporal, ¿cuál es (a) suvolumende agua corporal total, cuáles (b) su; volúmenes de LEC yde LIC ycuál{c) su volumén plasmático?

El cuerpo se encuentra en equilibrio osmótico El agua tiene la capacidad de moverse libremente entre las cél ulas y el líquido extracel ular }' se d istribuye hasta que sus concentraciones son iguales en todo el cuerpo; en otras palabras, hasta que el cuerpo akanui un estado de equilibrio osmótico. El desplazamien Lo de agua a Lravés de las membranas en respuesta al gradiente de concentración de un soluto se llama ósmosis. Mediante la ósmosis, el agua íl uye para diluir la solución más concentrada. Una vez. que las concentraciones se igualan, el desplazamiento neto de agua se detiene.

Observe el ejemplo de la • Figura 5-~, en el cual una membrana selectivamente permeable separa dos compartimentos de igual volumen. La membrana es permeable al agua, pero no pennite el paso de la glucosa. En


La solución B es más concentrada A que la solución A

---

8

Aumento del volumen r---.....-i

-

•• • T___l •• •

Membrana L.---i selectiva-

• •

1..,,---,,.J

Moléculas de glucosa Dos compartimentos están separados por una membrana que es permeable al agua, pero no a la glucosa.

El agua se desplaza por ósmosis hacia la solución más concentrada. Se ejerce fuerza a B para contrarrestar exactamente la ósmosis de A a B.

Los

~

1. - - - .1V?liif!l~~eJ _~

se igualan

••

..>,

se puede ev itar el desplazam iento de agua desde A hacia 13. La presión que debe aplicarse al pistón para contra rrestar exactamente el ílujo osmótico del agua hacia el compartimento l3 se conoce como presión osmó tica de la solución 13. Las unidades de la p resión osmótica, al igual que de otras presiones en fisiología, son atmc5s{eras (atm ) o mil/metros de mercurio (mm Hg). Una presión de I mm Hg equivale a la presión eje rcida sob re un área de I cm' por una columna de mercurio de l mm de alto.

La osmolaridad describe el número de partículas en solución Otra manera de medir cuantitativamente el desplazamien to osmótico de agua es conociendo las concentraciones de las sol uciones sobre las que se está actuando. En quím ica, las concentraciones se exp resan habitualmente como mo/<1ride1d (M), que se define como el número de moles del soluto disuelto po r litro de sol ución (mol/L). Recuerde que un mol son 6,02 x I oi. moléculas (Fig. 2-7). Si n embargo, utilizar la molaridad para determ inar las concentraciones biológicas puede ser engañoso. El factor fundamental para la ósmosis es el número de parffwlas osmótic.amen te activas en un determjnado vol umen de solución, no el número de moléculas. Debido a que algw1as mo léculas se disocian en iones cuando se disuelven en una sol ución, el nú mero de partículas en solución no es siempre igual al número de moléculas. Por ejemplo, una molécula de glucosa disuelta en agua constituye una parúcula, pero w1a molécula de NaCJ disuelta en agua teóricamente genera dos iones (partículas): Na" y c1-. El agua fluye por ósmosis en respuesta a la concentración total de todas las partículas en la solución. Dichas partículas pueden ser iones, moléculas sin carga o una mezcla de ambas. En consecuencia, para las sol uciones b iológicas expresarnos la concemración en térm inos de osmolaridad, número de partículas osmóticamente activas (iones o moléculas intactas) po r litro de solución. La osmolaridad se exp resa en osmo/es por litro (osmol/L u OsM) o, en el caso de las sol uciones fisiológicas muy ttil uidas, m iliosmoJes/l itro (müsM). Para realizar la conversión entre molaridad y osmolar idad utilice la siguien te ecuación: molaridad ( mol/L) X número de partículas/molécula (osrnol/mol) = osmo laridad (osmol/L) Veamos dos ejemplos, glucosa )' cloruro de sodio, y comparemos su molaridad con su osmolaridad. Un mol de moléculas de glucosa disueltas en suficiente agua como para forma r J litro de soluc ión, consti tuye una sol ución l molar (J M). Debido a q ue la glucosa no se d isotia en solución, solo forma rá un mol de partículas osmólicamente activas: Glucosa I M x I partícula/molécula de glucosa =glucosa l OsM

1

• FIGURA 5-2 ósmosis y presión osmótica

La presión osmótica es la presión que debe ser ejercida sobre B para contrarrestar la ósmosis.

A diferenc ia de la glucosa, el c.loruro de sodio se d isocia al disolverse. A temperatura corporal, algunas moléculas de NaCl no logran separarse, por lo q ue, en lugar de 2 iones por cada NaCI, el factor de disociacic511 es alrededor de l,8.

Po r lo tanto, un mol de NaCl se disocia en sol ución para fo rmar 1,8 moles de partículas ( Na-, Cl-y NaCl). El resultado es una solución l,8 OsM: l mol de NaCI/L x l,8 osmoles/mol de NaCl = l ,8 osmoles de NaCI/L l a osmolaridad solo describe el número de partículas en la solución. No dice nada sobre la composición de úichas parLículas. Una sol ución l OsM podría estar compuesta solo por glucosa o por Na- y c1- o bien por una mezcla de esos tres sol utos. La osmolar idad normal del cuerpo humano oscila emre 280 y 296 miliosmoles por litro ( mOsM). En este libro, para simplificar los cálculos, redondearemos el núme ro a 300 mOsM. Un término relacionado con la osmo la ridad es osmolalidad. La osmolalidad es la coocenlración expresada como osmoles de soluto por kilogramo de agua. Debido a que las soluciones biológicas están diluidas y una mínima parte de su peso proviene del so luto, los fisiólogos utilizan frecuentemente los térm inos osmolaridad y osmohilidad de forma intercambiable. La osmolalidad se ulil iza habitualmente en si tuaciones clínicas, ya que es fácil es ti mar el con tenido de agua co rporal de una persona pesándola. Los médicos clín icos calculan la pérdida de líquido de una persona deshidratada equiparando la pérdida de peso con la pérd ida de líquido. Debido a que l litro de agua pura pesa l kilogramo, Ltna disminución del peso corporal de I kilogramo (o 2,2 libras) se considera equivalente a la pérdida de I litro de agua corporal. Un bebé con diarrea puede pesarse fácilmente para estimar su pérdida de líqLúdo. Una disminución de 0,5 kg ( 1,1 libras) en el peso corpo ral se asume como una pérdida de 500 mL de agua. Este cálculo proporciona una rápida estimación de cufoto líqtLido necesita ser adminisuado o repuesto. Revisión

S. Una madre trae a subebé al servido de emergencias debido aque ha tenido diarrea y vómitos durante dosóías. El pe1sonal de salud pesa al bebéy determina que ha perdido 0,9 kg (2 libras}. Si asumimos que la pérdidade peso se debe a la pérdida deagua, ¿qué volumen de agua ha perdido el bebé? (2,2libras = 1 kilogramo).

Co111pamci6n de las osrn o/aridades de dos soluciones La osmolaridad es una propiedad de cada solución. Se pueden comparar las osmolaridades de diferentes sol uciones siempre y cuando las concentraciones se expresen en las mismas un idades (p. ej., en miliosmoles po r litro). Si dos soluciones contienen el mismo número de pa rtículas de soluto por unidad de volumen, se d ice que las sol ucio nes son isosmóticas ( isa-, igual). Si la solución A tiene una osmolaridad mayor (conliene más partículas po r Lmidacl de volumen, es decir, está m¡\s concentrada) que la solución B, decimos que la sol ución A es hiperosmótica con respecto a la solución B. En el mismo ejemp lo, la solución B, que tiene menos osmoles por un idad de vol umen, es hiposmótica con respecto a la solución A. En el • Cuadro 5-2 se m ueslran algunos ejemplos de osmolaridades comparativas. La osmolaridad es wia propiedad coligativa de las soluciones, lo que significa q ue depende estrictamente del número de partículas por liLro de solución. La osmolaridad no dice nada sob re el tipo de partículas o sob re su comportamiento. Antes de poder predeci r si la ósmosis tendrá lugar en tre dos sol uciones div ididas por una membrana debemos conocer las propiedades de esa membrana)' de los solutos a cada lado.

Comparación de osmolaridades

Solución A= Glucosa 1 OsM

Solución 8 = Glucosa 2 OsM

Solución C = NaCI 1 OsM

A es h iposmótica con respecto a 8

8 es hiperosmótica con respecto a A

C es isosmótica con respecto a A

A es isosmótica con respecto a C

8 es hiperosmótica con respecto a C

C es hiposmótica con respecto a 8

Si la membrana es so lo permeable al agua )' no a los solu tos, el agua se desp lazará por ósmosis desde la solución menos concentrada (h iposmótica) hacia la más concentrada (hiperosmótic.a), como se observa en la Figura 5-2. Sin embargo, la mayoría de los sistemas biológicos no son tan simples. Las membranas biológicas son permeables de una manera selectiva, permitiendo que algunos solutos las atraviesen junto con el agua. Para pronosticar el desplazamien to de agua hacia dentro o hacia fuera de las células se debe conocer la tonicidad de la solución; esto lo estudiaremos en la siguiente sección.

La tonicidad describe el cambio de volumen de una célula Tonicidad ( tonikos, concerniente al estiramiento) es un término fisiológico utilizado para descr ibi r una so lución y cómo el volumen celLL· lar se pod ría ver afectado s i la célula se colocase en la solución pe rmi tiéndosele llegar al eq uil ibrio (• Cuadro 5-3 ). Si una célula colocada en esa solución incorpora agua J1asta llegar aJ equi lib rio, hinchándose, se dice que la sol ución es hipotónica con respecto a la célula. Si la célula pierde agua y se encoge al alcanzar el equilibrio, se dice que la solución es hipertónica. Si la cél ula no cambia de tamaño en el equilibrio, la sol ución es isotónica. Por convención, siempre describimos la tonicidad de la solució n en relació n con la célula. Entonces ¿cómo difiere la ton icidad de la osmolar idad?

Tonicidad de las soluciones

Comportamiento de una célula cuando se la coloca en la solución

Descripción de la solución con respecto a la célula

A

La célula se hincha

La solución A es hipotónica

8

La célula no cam bia de tamaño

La solución 8 es isotónica

e

La cé lula se encoge

La solución C es hipertónica

Solución

ó smosis y tonicidad

1

2

3

La osmolaridad describe el número de partículas de soluto disueltas en un volumen de solución. Tiene un idade,s, como osmoles/liLro. La osmolaridad de una solución puede medirse con una máquina llamada osmómetro. La tonicidad no tiene unidades: es solo un término comparativo. La osmolaridad se puede uLilizar para comparar dos soluciones cualesquiera, y la relación es recíproca (la solución A es hiperosmótica con respecto a la solución B; po r lo tanto, la solución 13 es hiposmótica con respecto a la solución A). La ton icidad siempre compara una solución con una célula y, por convención, la tonicidad se utiliza para describir únicamente a la solución ( p. ej., "La so lución A es hipotónica con respecto a los glób ulos rojos"). La osmolaridad por sí sola no nos dice Jo que le sucede a w1a célula que se coloca en una so lución. Por definición, la tonicidad nos dice q ué ocurre con el volumen celu lar cuando se coloca una célula en una sol ución hasta alcanza r el equilibrio.

fate tercer punto es el que resulta más confuso para los estudian tes. ¿Por qué la osmolaridad no puede se r utilizada para predecir la tonicidad? La razón es que la tonicidad de w1a solución no depende solo de su concentración (osmolaridad), sino también de la 11aturaleEste tercer punto es el que resulta más confuso para los estudiantes. ¿Por qué la osmolaridad no puede ser utilizada para predecir la tonicidad? La razón es que la tonicidad de tma solución no depende solo de su concentración (osmolaridad ), sino también de la 11at11mlez.a de los solutos disueltos en ella. La "naturaleza de los solutos" se refiere a la capacidad de las partículas de so luto para atravesar la membrana celular. Si las partículas de sol uto ( iones o moléculas) pueden introducirse en el inLerior de la célula, las llamaremos sol utos penetran tes. A las que no puedan atravesa r la membrana celular las llamaremos solutos no penetran tes. la tonicidad depende únicamente de la concen Lración de los solutos no penetrantes. Veamos por qué sucede esto. Primero, un poco de información preliminar. El soluto no penetranLe más importante en fisiología es el NaC:J. Si una célula se coloca en una solución de NaCI, los iones Na+ y CJ- no penetran en el interior de la célula. Esto convierte al NaCI en un soluto no penetrante. (En realidad, algunos iones Na- pueden filtrarse a través de la membrana celular, pero son transportados inmediatamente de vuelta hacia el líquido extracelular por la Na·-K· -ATPasa. Por esta razón se considera al NaCJ un sol uto JHncionalmente no penetrante.) Por convención, se asume que las células están llenas de otros tipos de solutos no penetrantes. En otras palab ras, los sol utos dent ro de la célula son incapaces de sal ir de ella mientras tanto la membrana celular permanezca intacta. Ahora estamos preparados para comprender por qué la osmolaridad por sí sola no puede ser utilizada para predecir la ton icidad. Suponga que conoce la composición y la osmolaridad de una solución. ¿Cómo podría averiguar la ton icidad de esta solución sin colocar una célula en ella? La respuesta se obtiene conoc iendo las co11ce111racúmes relativas de los solzaos 110 pene1m11tes dentro de la célula y en fo solu.ció11. El agua siempre llure hasta que las concentrac iones de los sol utos no pene trantes en la célula y en la solución se igualan. Aquí describ imos las reglas para predeci r la tonicidad:

Si la c.é/11/a tiene una mayor concentracic5n de so/u tos 110 penetrantes que la solución, habrá desplazamiento neto de agua hacia denLro de la célula y esLa se h inchará. La solución sen\ liipotóniw.

2

3

135

Si la célula tie11e una menor co11ce11traci611 de so/u.tos 110 penetrantes t¡ue la solución, habrá llujo neto de agua hacia fuera de la célula y esta se encogerá. La solución será hipert611ic11. Si las concentraciones de solutos no penetrantes son iguales dentro de la cél11ln y en la solución, no habrá movimiento neto de agua en el equilibrio. La solución sen\ isotóllica con respecto a la célula.

¿Cómo se relacionan la tonicidad y la osmolaridad? La • Figura 5-3 muestra las combinaciones posibles de osmolaridad y tonitidad. Una solución hiposmólica siempre es hipotónica, sin importar su composición. La célula sie mpre tendrá una ma}'Or concentración de soluLos no penetrantes que la solución y el agua !luirá dentro de la célula ( regla número 1). Una sol ución isosmótica puede ser isotónica o hipotón ica pero no hipertónica, po rque nunca podrá tener una mayor concenLración de solutos no penetrantes que la célula. Si todos los solutos en la solución isosmólica son no penetrantes, entonces la solución también es isotónica. Si ha)' solutos penetran tes en la solución isosmótica, la solución es hipotónica. Las soluciones hiperosmó ticas pueden ser h ipe rtón icas, isotónicas o h ipotónicas. Su ton icidad depende de la concentración relativa de solutos no penetran tes en la solución comparada con la cél ula, solución es hipotónica. Las soluciones hiperosmó ticas pueden ser h ipertón icas, isotónicas o h ipotón icas. Su ton icidad depende de la concentración relativa de solutos no penetran tes en la solución comparada con la célula, como se describe en la lista más arriba. Normalmente se explica la Lonicidad mediante el ejemplo de una célula colocada en una solución, pero aquí utilizaremos w1 sistema más ap ropiado desde el punto de vista fisiológico: un modelo de caja con dos comparlimentos que representa Lodo el cuerpo, d ividido en LEC y LlC (véase la Fig. 5- lc). Para simplificar los cálculos utilizaremos un cuerpo de J litros, con 2 liLros en el LIC )' 1 lilro en el LEC. Asum imos que la osmolaridad in icia l es de 300 mOsM (0,3 üsM ) y que los sol utos en cada compartimento son no penetrantes (NP) y no pueden desplazarse de un comparlimento a otro. Al determinar volúmenes y concentraciones, podemos utilizar la ecuación soluto/volumen = c-1mcen1ració11 (S/V = C) para determinar matemáticamen te los cambios de volúmenes y de osmolaridad. Concentmción es osmolaridad Siempre se debe comenzar definiendo las condiciones iniciales, que pueden ser el estado normal de la persona o un estado alterado que se in ten La volve r a la normalidad. Un ejemplo de esto úllimo sería intentar restablecer el vol umen y la osmohu-idad normales en una persona que se ha deshidratado deb ido a tma gran pérdida de sudor. l a • Figura 5-4 muestra las condiciones iniciales para el cue rpo de 3 liLros en forma de un diagrama de ca_jas y en forma de cuadro. El cuadro permite resolver matem,\Licamente un ejemplo si se conocen los volúmenes del cuerpo)' de la solución aiiadida o perdida.

1

OSMOLARIDAD

. T ONICIDAD Hipotónica 1

Isotónica

Hiposmótica

lsosmótica

-J

......

Hiperosmótica

-J -J

-J -J

Hipertónica

..__

-J

• FIGURA 5-3 La relación entre osmolaridad y tonicidad

-

Osmolaridad y tonicidad Para todos los problemas, defina las condiciones iniciales. Asuma que todos los solutos corporales iniciales son no penetrantes {NP} y permanecerán en el LEC o en el LIC.

Utilice la ecuación

para resolver los problemas. Conocerá dos de las tres variables y así podrá calcular la tercera.

Soluto/ volumen = concentración (SN = C)

;.----LIEC

LIC

300 mosmol NP

Recuerde que los compartimentos corporales se encuentran en equilibrio osmótico. Una vez conocida la osmolaridad (concentración) corporal total, también se conoce la osmolaridad del LEC y del LIC, ya que son iguales.

600 mosmol NP

1L

2L

Condición inicial Tenemos un cuerpo con 3 litros y una osmolaridad de 300 mOsM. El LEC es de 1 litro y el LIC, de 2 litros. Utilice la ecuación SN = C para determinar cuánto soluto hay en cada uno de los dos compartimentos. Reordene la ecuación para calcular S: S = C x V También podemos realizar estos cálculos utilizando el siguiente cuadro. Este cuadro ha sido completado con los valores corporales Iniciales. Recuerde que LEC + LIC siempre debe igualar los valores corporales totales y que,

1

Suc = 300 mosmol/ L x 2 L = 600 mosmol de soluto NP en el LIC

2

SLEC = 300 mosmoVL x 1 L = 300 mosmol de soluto NP en el LEC

2

SLEC = 300 mosmoVL x 1 L = 300 mosmol de soluto NP en el LEC

11n ::i \/07 n1 ICl f"Ann7r-~ J:::1 ncmAl:::1rirl:::trl r-nl'nnr::11 tnt~I

También podemos realizar estos cálculos utilizando el siguiente cuadro. Este cuadro ha sido completado con los valores corporales iniciales. Recuerde que LEC + LIC siempre debe igualar los valores corporales totales y que, una vez que conozca la osmolaridad corporal total, conocerá la osmolaridad del LEC y del LIC.

Soluto (mosmoles) Volumen (L)

-Osmolaridad (mOsM)

---

Total corporal

LEC

900 mosmol

300mosmol

Para ver el efecto de la adicíón de una solución o de la pérdida de líquido, comience por este cuadro y añada o sustraiga volumen y soluto según corresponda. No se puede añadir o sustraer concentraciones. Siempre debe utilizar volúmenes y cantidades de soluto.

LIC 600 mosmol

3L

1L

2L

300mOsM

300mOsM

300 mOsM

t Primero solucione la columna del total corporal añadiendo o sustrayendo solutos y volumen. Una vez calculada la nueva osmolaridad corporal total, traslade ese valor hacia la fila inferior de las columnas de LEC y LIC (los compartimentos se encuentran en equilibrio osmótico}. t Distribuya los solutos no penetrantes en el compartimento apropiado. 1

"

En los cuadros de abajo y en la siguiente página, las casillas amarillas ind ican las incógnitas que deben ser calculadas.

El NaCI permanece en el LEC. La glucosa penetra hacia el interior de las células. Utilice la ecuación V = SN para calcular los nuevos volúmenes compartimentales.

Ejemplo 1

Añada 1 litro de una solución IV de NaCI 300 mOsM a este cuerpo. Esta solución aporta 1 litro de volumen y 300 mosmoles de NaCI.

Respuesta Primero calculemos el total corporal. Añada soluto y volumen; luego, calcule la nueva osmolaridad (casilla amarilla).

Total corporal Soluto (mosmoles} Volumen

(L) Osmolaridad (mOsM)

Traslade la nueva osmolaridad hacia las casillas de LEC y LIC (flechas}. Todo el NaCI añadido Soluto permanecerá en el LEC, entonces (mosmoles) añada la cantidad de soluto a la Volumen casilla del LEC. La cantidad de (L) soluto del LIC no se modifica. Utilice la ecuación V= S IC para Osmolaridad calcu lar los nuevos volúmenes {mOsM) de LEC y LIC (casillas amarillas).

7

900 + 300 = 1 200 mosmol

3+ 1 =4L

_J

1 20014 =300 mOsM

Total corporal

1 200 mosmol 4L

LJC

LEC

300 + 300 = 6: L600 mosmol

2L

]

2 L ----"

300 mOsM -

300 mOsM

: = i =300 mOsM

La solución añadida era isosmótica (300 mOsM), y su concentración de solutos no penetrantes era igual a la del cuerpo (300 mOsM NP). Usted predijo que la solución seria isotónica. Ello se confirmó mediante estos cálculos, que muestran que no hay incorporación ni egreso de agua de las células (no hay modificación en el volumen del LIC).

• Ejemplo 2

Añada 2 litros de una soluc ión 500 mOsM. La solución tiene igual cantidad de NaCI (no penetrante) que de urea (penetrante), o sea, tiene 250 mosmol/ L de NaCI y 250 mosmol/L de urea.

Respuesta Esta solución tiene tanto solutos penetrantes como no penetrantes, pero solo los no penetrantes contribuyen a la tonicidad y generan el desplazamiento de agua entre compartimentos.

Antes de resolver este problema, responda las siguientes p reguntas: {a) Esta solución es _ _ _osmótica con respecto al c uerpo (300 mOsM). {b) ¿Cuál es la concentración de los solutos no penetrantes [NP] de la solución? _ __ (c) ¿Cuál es la [NP] del cuerpo? _ __ (d) Utilizando las reglas de la tonicidad del Cuadro 5-4 , ¿habrá flujo de agua? En caso afirmativo, ¿será hacia dentro o hacía fuera de las células? (e) Basándose en su respuesta en (d), la solución es _ _ _tónica con respecto a las células corporales. Ahora resuelva el problema utilizando el cuadro con las condiciones iniciales como punto de partida. ¿Qué se añadió? 2 L de (250 mosmol/ L de urea y 250 mosmol/ L de NaCI) = 2 litros de volumen + 500 mosmoles de urea + 500 mosmoles de NaCI. La urea no contribuye a la tonicidad, por lo que dejaremos de lado los 500 mosmoles de urea y, en el primer paso, solo añadiremos el volumen y el NaCI:

J

~~-ª~~-~!:.º~!

NaCI y 250 mosmol/L de urea.

-=:7

1 500 Pa~~ (b) ¿Cuál es la concentración de los solutos no penetrantes [NP] de la solución? _ __ (c) ¿Cuál es la [NP] del cuerpo? _ __ (d) Utilizando las reglas de la tonicidad del Cuadro 5-4 , ¿habrá flujo de agua? En caso afirmativo, ¿será hacia dentro o hacía fuera de las células? (e) Basándose en su respuesta en (d), la solución es _ _ _tónica con respecto a las células corporales.

vv" .,v_vv.. •vv,-vl ~~ª~~°--~~~O \~~v,..

Ahora resuelva el problema utilizando el cuadro con las condiciones iniciales como punto de partida. ¿Qué se añadió? 2 L de (250 mosmol/ L de urea y 250 mosmol/ L de NaCI) = 2 litros de volumen + 500 mosmoles de urea + 500 mosmoles de NaCI. La urea no contribuye a la tonicidad, por lo que dejaremos de lado los 500 mosmoles de urea y, en el primer paso, solo añadiremos el volumen y el NaCI:

Paso 1: añada 2 litros y 500 mosmoles de NaCI. Primero calcule la columna del total corporal.

Total corporal Soluto 900 + 500 = 1 400 mosmol (mosmoles)

------------1

Volumen 3 + 2 = 5 L (L) Osm~~~~: Paso 2: traslade la nueva osmolaridad hasta las casillas del LEC y del LIC. Todo el NaCI permanece en el LEC; por lo tanto, se debe añadir ese soluto en la columna del LEC. Calcule los nuevos volúmenes del LEC y del LIC.

1:. Nótese que volumen de LIC + volumen de LEC corporal total.

= volumen

Paso 3: ahora añada la urea al soluto corporal total para obtener la osmolaridad final. Esta osmolarídad se mantiene en el LEC y en el LIC. La urea se distribuirá por todo el cuerpo hasta q ue su concentración sea igual en todos lados, pero no ocasionará flujo de agua entre el LEC y el LIC; por lo tanto , los volúmenes del LEC y del LIC se mantienen iguales a como estaban en el paso 2.

-

-

11 400/5 = 280 mOsM

Total corporal Soluto 1 (mosmoles) Volumen (L)

Osmolarídad (mOsM)

Volumen (L)

-

1 400 mosmol

300+ 500 = 800

600

5L

2,'857 L

2,1 43 L

280mOsM-

280mOsM-+

280 mOsM

Total corporal Soluto (mosmoles)

LIC

LEC

LEC

LIC

1 400 + 500 = 1 900

5L

----i,-2-,8-57 L

Osmolaridad (mOsM) 1 B00/ 5 = 380 mOsM

-

~

43 L

380amOsM -

Responda las siguientes preguntas a partir de los resultados del cuadro:

(n

¿Qué le suced ió a la osmolaridad corporal tras añadir la solución? _ __ Este resu ltado significa q ue la solución añadida era _ _ _osmótica con respecto a la osmolaridad corporal inicial. (g) ¿Qué le sucedió al volumen del LIC? _ _ _. Esto significa que la solución añadida era _ _ _tónica con respecto a las células.

Compare sus respuestas en

{n y en (g) con sus respuestas en (a)-{e). Deberían concordar.

Si conoce las condiciones iniciales del cuerpo y la composición de la solución que está añadiendo, debería ser capaz de describir la osmolaridad de la solución y su tonicidad con respecto al cuerpo respondiendo los interrogantes (a)-{e}. Ahora ponga a prueba sus conocimientos resolviendo las preguntas 8 y 9 de la Revisión.

Los volúmenes y las concenLraciones corporales se modificarán como consecuencia de la adición o la pérdida de solutos, agua o ambos (ley de equilibrio de masas). Los aportes que recibe el cue rpo provienen normalmente de la ingesta de al imentos y bebidas, pero, en el ámbito médico, las soluciones se pueden a1iadir directamente al LEC a través de infusiones intravenosas ( IV). Pérdidas sign ificativas de solutos )' agua pueden ocur rir por sudoración, vóm itos, d iarrea o hemorragia. Una vez definidas las condiciones iniciales, usted puede sumar o restar vo lumen y solutos para encontrar la nueva osmolaridad corporal. El paso final es determinar si los volúmenes del LEC y del LIC se modificarán como resultado de la ganancia o la pérdida de agua. En este último paso, se debe separar los solutos añadidos en penetrantes y no penetrantes. En nuestrns ejemplos, ut ilizamos tres solutos: NaCl, ure,1 y glucosa. El NaCI es considerado no penetrante. Todo el NaCI añadido al cuerpo permanece en el LEC. La urea penetra libremente y se comporta como si las membranas cel ulares q ue separa n el LEC del LIC no exisLieran. Una carga afladida de urea se distribU)'e hasta que su concentraci1Sn sea igual en todo el cuerpo. La glucosa ltambién llamada dextrosa) es un sol ulo especial. Como todos los sol ulos, primero penetra en el LEC. Si.n embargo, con el tiempo, el l 00% de la glucosa añadida se inco rporará al interior de las células . Cuando la glucosa penetra en el inter ior de las cél ulas, es fosforilada en glucosa -6-fosfa to (G-6-1') )' no puede volver a salir. Por lo tanto, aunque la glucosa penetra en las cél ulas, no atraviesa libremente la membrana celular porque se queda dentro de la célula y se suma a los solutos no penetra ntes. Swninistrarle a alguien una solución de glucosa es lo mismo que administrarle una infusión lenta de agua pura, ya que la glucosa-6-fosfato es el primer paso en el metabolismo aerobio de la glucosa. Los productos finales del metabolismo aerobio de la glucosa son Cü1 y agua. Los ejemplos que se muestran en la Fig ura 5-4 lo guían a Lravés del proceso de la administración o la sustracción de soluciones al cuerpo. Hágase las siguientes p reguntas cuando esté evalua ndo los efectos de una solución sobre el cuerpo:

J 2

¿Cómo es la osmolaridad de esta solución con respecto al cuerpo? (Cuadro 5-2.) ¿Cuál es la to nicidad de esta so lución? (Utilice la Eig 5-3 como ayuda para descartar posibil idades. ) Para determinar la tonicidad, compa re la concentración de solutos no penetrantes en la solución con su concen tración en el cuerpo. (Todos los sol utos cor porales se consideran no penetrantes.)

Por ejemplo, cons idere una solución 300 müsM (isosmótica con respecto al cuerpo). la ton icidad de la solución depende de la concentración de solutos no penetrantes en ella. Si la solución es de NaCl 300 mOsM, su concentración de solutos no penetrantes es igual a la del cuerpo. Cuando la solució n se mezcla con el LEC, la concentración de solutos no penetrantes del LEC y su osmolaridad no se modifican. No se incorpora ni sale agua de las células (el LIC) y la solución es iso tónica. Usted p uede calcular esto resolviendo el Ejem plo J de la Fi~ura 5-4. Aho ra suponga que el ún ico sol ulo de la so lució n 300 mOsM es la urea. Ésta es un solulo penetran te, por lo que la solución no posee solulos no penetrantes. Cuando la solución de urea 300 mOsM se mezcla con el LEC, el volumen afladido de solución de urea d iluye los

solulos no penetran tes de LEC (SN = C. La misma cantidad de soluto NP en un vo lumen mayor significa una menor co ncentración de NP ).

Entonces, la concentración de solutos no penetrantes del LEC es menor que 300 müsM. las células todavía poseen una concentración de so lutos no penetran tes de 300 mOsM, por lo que el agua se incorpora a ellas para igualar las concent raciones ( regla: el agua flu)1e hacia el compartimento con la mayor concentración de solutos NP). Las células ganan agua y aumentan su volumen. Esto significa q ue la solución de urea es hipotónica aun s iendo isosmólica. El ejemplo 2 de la Figura 5-4 muestra cómo la comb inación de solulos penetran tes y no penetrantes puede complicar la situación. En este ejemplo se le pide que describa la osmola ridad y la tonicidad de la so lución con base en su composición an tes de realizar los cálcul os matemá ticos. Esta habilidad es importante para las situaciones clínicas, en las q ue usted no conocerá exactamente los volúmenes de los líquidos corporales de cada persona a la que deba administmr una solución IV. El • Cuadro 5-4 muestra algunas reglas para ayudarlo a diferenciar osmolaridad de tonicidad. Comprender la diferencia en tre osmolaridad y tonicidad es crítico para tomar buenas decisiones clín icas respecto al tratamiento con líquidos in travenosos ( fV ). La elección del líqu ido fV depende de cómo el médico clín ico quiere q ue se distribuyan los solutos y el agua en tre los compartimentos intra y exl racelular. Si el problema son las células deshidratadas, la solución fV adecuada es hipotónica l'ª que son las células las que necesitan el líquido. Si la situación requiere que el líqu ido permanezca en el comparLimento extracelular para compensar una pérdida de sangre, se utiliza una so lución IV isotónica. En medicina, la tonicidad de una solución es habitualmente una consideración trascendental. El • C¡,adro S-5 m uestra algunas soluciones IV comunes, su osmolaridad y su tonic idad relativa aproximadas. ¿Y con respecto al agua de coco descrita al inicio del capítulo? El análisis químico demuesLra que no es una sol ución IV ideal, a pesar de que resulta útil bajo situaciones de emergencia. Es isosmó Lica con respecto al plasma

Reglas para la osmolaridad y la tonicidad

1. Asumir que todos los solutos intracelulares son no penetrantes. 2. Comparar las osmolaridades antes de exponer las células a la solución. (En el equilibrio, la célula y la sol ución siempre son isosmóticas.) 3. La tonicidad de una solución describe el cambio de volumen de una célula al llegar al equilibrio (Cuadro 5-6). 4. Determinar la tonicidad comparando las concentraciones de solutos no penetrantes dentro de las células y en la solución. El desplazamiento neto de agua ocurre hacia el compartimiento con la mayor concentración de solutos no penetrantes. S. Las soluciones hiposmóticas son siem pre hipotónicas.

1111

Soluciones intravenosas Solución

También conocida como

Osmolaridad

Tonicidad

Solución salina 0,9%*

Solución sali na normal (o solución fisiológica)

lsosmótica

Isotónica

Dextrosa' 5% en solución salina 0,9%

OS-so lución salina normal

Hiperosmótica

Isotónica

Dextrosa 5% en agua

DSW (por sus siglas en inglés)

lsosmótica

Hipotónica

Solución salina 0,45%

Solución sali na a la mitad de su concentración normal

Hiposmótica

Hipotónica

Dextrosa 5% en solución salina 0,45%

OS- solución sa lina a la mitad de su concentración normal

Hiperosmótica

Hipotónica

·Salina = NaO 'Dextrosa = glucosa

Revisión 6, ¿Cuál/es de las siguiente; solucione; tienoJn másagua por unidad de volumen: glucosa 1 M,NaCI 1 MoNaCI 1 OsM?

7, Dos compartimentosestánseparados por una membrana permeable alagua y a la urea, pe10 no al NaO. ¿En quédirección fluilá elagua cuando las siguiente; soluciones seancolocadas enlos compartimentos?{Sugerencia: ~enga encuenta las unidadesQ Compartimento A

Membrana

Compartimento B

(a) NaO 1 M

NaCI 1 OsM

(b) Urea 1 M

Urea2 M

(c) NaO 1 OsM

Urea 1 OsM

8, Utilice el mismo cuerpo de 3 litrosy 300 mOsMde la figura 5-4 para el siguiente problema.

Añada ! litro de glucosa 260 mOsM al cuerpo ycalcule los nuevosvolúmenes yosmolari· dad corporales una vezque la glucosa haya penetrado enlascélulasy haya sido íosfoñlada Antes de hace; los cálculos, realicelas siguientes predicciones: Esta solución e; _ __ osmótica con respecto alcuerpo y ___ tónica con respecto a lascélula~ 9, Utilke el mismo esquemacorporal de 3litros y300 mOsM de la Fioura 5-4 para elsiguiente

problema Esta persona, trabajando al sol, pierde 500 ml de sudor equivalente a una solu· ción de NaCI 130 mOsM. Supongaque todo el NaCI proviene del LEC. (a) El sudor perdido es - - -osmótico con respecto al cuerpo. Esto significa que la osmolaridad del cuerpo después desuda; (aumentaráldisminuiráíno se moomcara1, (b) Como resulrado de e;ta pérdida de sudor, el volumencelular corporal (aumentará/disminuirá/no se modificará}. (e) Utilizando elcuad10, calcule quésucede con el volumen y la osmolaridad como resulta·

do de la pérdida de sudor. los resultados dee;tos cálculos, iCOincidencon sus re;pues· tas en{a) y (b)? 1O. Usted tiene un paciente que ha pHdido ! litro desangre y necesita restablece; el volumen rápidamente mientras espera que llegue la sangre desde el banco de sangre para realizar una transfusión.

(a) ¡Qué solución sería mejor. dextrosa 5%en agua o NaCI 0,9% enagua? (Sugerencia: piense cómo se distribuyen estos solutosenel cuerpo.}Justifique suelección. (bi ¿Quévolumende la solución elegida se deberiaadministrar para de-volve1 la volemia a la normaíidad?

humano, pero es hipotónica, con concentraciones de Na- mucho menores que las del LEC normal y altas concentraciones de glucosa}' fructosa, junto con aminoácidos.

Los procesos de transporte Los seres humanos so n organismos complejos, y el movim iento de sustancias dentro de los compartimentos corporales y entre ellos resulta necesa rio para la comunicación. Este mov imiento requiere una gran variedad de mecanismos de transporte. Algunos precisan una fuente externa de energía, como la almacenada en los en laces de alta energía del ATP, mien tras que o tros procesos de transporte solo utiliza n la energía cinética o potencial que ya se encuentra en el sistema. El movim iento entre compartimen tos sign ifica habi tualmen te que una molécula debe cruza.r una o más membranas celulares. El desplazamiento dentro de un compartimento se encuentra menos restr ingido. Por estas razones, el transpone biológico es otro de los temas con el cual se encontran~ repetidamente a lo largo del estudio de los sistemas o rgán icos. l a (orma más general de transporte b io lógico es la co nvección o !lujo en masa de !luidos dentro de un compartimento. Aunque muchas personas consideran iguales los fluidos y los líquidos, en física, tanto los líqu idos como los gases son considerados !luidos debido a que p ueden !luir. la principal diferencia entre los dos !luidos es que los gases son compresibles, debido a q ue sus moléculas se encuentran mu}' separadas en tre sí. Los líq uidos, especialmente el agua, no son compres ibles (imagínese apretando un globo lleno de agua). En la convección, un gradiente de presió11 ocasiona el desplazam iento del fl uido de las regiones de mayor p resión hacia regiones de menor presión. Con este !lujo convectivo, el !luido acarrea consigo todos sus componentes, inclu}'endo las sustancias disueltas o suspendidas en él. La sangre que se desplaza por el aparato circulato rio es un excelente ejemplo de Dujo por convección. El corazón funciona como una bomba que genera una región de al La presión y empuja el plasma, con su, solutos disueltos y las células sanguíneas suspendidas, por los

vasos sanguíneos. El flujo aéreo en los pulmones es otro ejemplo de corrien te convectiva q ue usted encontrará en el estudio de la fisiología. Otras fo rmas de transpo rte son más específicas que la convecció n. Cuando los anal izamos, debemos nombrar la/s molécula/s que se está/n desplazando. Los mecanismos de transporte q ue ap renderá en las siguientes secciones incl uyen la d ifusión, el transporte mediado por pro teínas y el transporte vesicular.

Las membranas celulares son selectivamente permeables Aunque muchas sustancias fl uyen libremente dentro de un compartimen to corpo ral, el intercambio entre los comparLimentos intracelular y extracelular se encuentra restringido po r la membrana celular. Si una sustancia se incorpora al interio r de una célula o no, depende de las p ropiedades de la membrana celular y de las propiedades de la sustancia. Las membranas celulares son selectivamente permeables, lo que significa q ue algunas moléculas las pueden atravesar m ientras que otras no pueden hacerlo. La composición lipídica )' proteica de una membrana celular determina qué moléculas penetrarán o saldrán de la célula. Si una membrana permite el paso de una sustancia, se dice q ue la memb rana es permeable a esa sustancia (penne.are, pasar a través) . Si una membrana no perm ite el paso de u na sustancia, se dice q ue la membrana es impermeable (im-, no) a dicha sustancia.

La permeabilidad de la membrana es variable y puede ser modificada alterando sus proteínas o sus líp idos. Algunas mo léculas, como el oxígeno, el d ióxido de c.trbono y los lípidos, se desplazan fáci lmen te a través de la mayoría de las membranas cel ulares. Por o tro lado, los iones, la mayo ría de las moléculas pola.res y las moléculas muy gran des (como las proteinas) penetran en las células co n mayor dificultad e, incl uso, pueden no inco rporarse. Dos propiedades de una molécula infl uyen en su movimiento a través de las memb ranas celulares: el tamaño de la mo lécula y su solubilidad en lípidos. Las moléculas muy pequeñas y aquellas que son li posolubles pueden atravesa r d irectamente la bicapa fosfol ipídica. Las moléculas más grandes y menos liposol ubles habitualmente no penetran ni salen de una célula a menos q ue esta cuente c.on proteínas de membrana específicas para transportar esas moléculas a través de la bicapa fosfol ipídica. Las moléculas lipó Cilas muy grandes no pueden ser tmnsportadas por proteínas )' deben incorporarse y sal ir de las cél ulas a través de vesículas. Hay dos maneras de descri bir cómo se desplazan las moléculas a través de las membranas. Una descrita recien temen te, clasifica el movi miento de acuerdo con los requer imientos físicos: si se desplaza di rectamen te a través de la bicapa fosfoli píd ica, si se mueve con la ayuda de una pro teína de membrana o si se incorpora a la cél ula por med io de una vesícula (pa rte inferior de la • Fig. 5-5). La segunda manera es clasificar el mov imiento de acuerdo con sus requeri mien-

REQUERIMIENTOS ENERGÉTICOS 1

,¡.

t Utiliza energía del movimiento molecular. No requiere ATP.

TRANSPORTE DE MEMBRANA

Requiere ener9la proveniente del ATP.

.

Oitus1on 1

1

Endocítos1s

t

t

Dffusión simple

Difusión

Transporte activo secundano

facilitada

La molécula atraviesa ta b1capa lipídica.

t

-

-

genera un gradiente de concentracfón para

'

Exocrtos.1s

Tran';f'orte activo pnmano

El transporte mediado requiere una proteína de membrana

1

Fagocitosis

Ubhza una

vesícula

-

unida a membrana.

t 1

~

OUERIMIENTOS FÍSICOS¡

• FIGURA 5-5 Mapa conceptual del transporte de membrana. El movimiento de sustancias a

través de las membranas ce lulares puede clasificarse según sus req uerimientos energéticos de transporte (extremo superior del mapa) o según si el transporte ocurre por difusión, por medio de una prote ína de membrana o mediante una vesícula (parte inferior del mapa).

La difusión cuenta con las siguientes siete propiedades:

En la historia clínica de Daniel se detalla una cronología aterradora de problemas médicos casi constantes desde su nacimiento: episodios recurrentes de infecciones respiratorias, enfermedades digestivas y, en los últimos seis meses, pérdida de peso. luego, la semana pasada, cuando Daniel comenzó a tener dificultad para respirar, su madre lo llevó rápidamente al hospital. Una muestra pulmonar tomada para cultivo disparó las alarmas dirigiendo e l diag nóstico hacia una fibrosis q uística: el moco de las vías aéreas de Daniel estaba extrañamente espeso y desh idratado. En la fibrosis quística, este moco espeso ocasiona congestión respiratoria potencialmente fatal y constituyen un ambiente perfecto para las bacterias infecciosas. P1:

La difusi611 es

148

158

161

168

tos energéticos (parte superior de la Fjg. 5-5 ). El transporte pasivo no requiere aporte de energía. El transporte activo sí requiere aporte de energía desde una fuente externa, corno los en laces fosfato de alta energía del ATP. Las secciones sigujentes describen cómo las células movilizan sustancias a través de sus membranas. Los p rincipios discutidos aquí también se aplican al desplazamiento a través de las membranas intracel ulares, cuando las sustancias se desplazan entre los org,\nulos.

2

• Algunos textos utilizan el término difusión como definición de cualquier movimiento aleatorio de moléculas y denominan movimiento molecular mediado por un gradiente de concentración a la difusión neta. Para simplificar esto, utilizaremos el término difusión en referencia al desplazamiento a favor de una gradiente de concentración.

Las moléculas se desplazan desde un área de mayor co11ce11tmci611 hacia u11 rln.>11 de menor concentmción. La diferencia de la concenLración de una sustancia entre dos lugares se llama gradiente de concentración, también llamado gradiente químico. Decimos que las moléculas difunden a favor del gradiente cuando van de una concentración mayor a una menor. La velocidad de difusión depende de la magnitud del gradjente de concentración. Cuanto mayor sea, más rápidamente ocurrirá la difusión. Por ejemplo, cuando se abre por primera vez un frasco de colonia la velocidad de difusión es la más alta, ya que constituye el primer momento en el que las moléculas e$c.apan del frasco hacia el a ire. Después, cuando la colonia se ha dispersado uniformemente por la habitación, la velocidad de difusión disminuye hasta anularse debido a que ya no existe gradiente de concentración.

3

El movimie11to neto de moléculas ocurre has/a que la concentmci6n es igual en iodos lados. Una vez que las moléculas de una sustancia determinada se han d istrib uido uniformemente, el sistema alcanza un equil ibrio y la difusión se detiene. Las moléculas individuales contjnúan moviéndose en el equilibrio. El estado de equilibrio di11timico en la difusión significa que la concentración se ha igualado en todo el sistema, pero las moléculas continúan moviéndose.

4

Difusión El transporte pasivo a través de las membranas utiliza la energía cinética intrínseca de las moléculas. Las moléculas de gas y las moléculas en solución se mueven constantemente de un lugar a oLro, rebotando co11Lra otras moléCL1las o contra las paredes de su contenedor. Cuando se encuentran concentradas en un área de tm espacio cerrado, su movimiento hace que se d ispersen gradualmente hasta distribuirse de manera unifor me por todo el espacio disponible. Este proceso se denomina difusión. La difusión ( dif(uudere, verter) puede definirse como el movimiento de moléculas desde un área de mayor concentración hacia un área de meno r concentración.• Si se deja abierto un frasco de colonia, un poco más tarde se nota s u fragancia por toda la habitación; esto se debe a que las moléculas aromMicas de la colonia han difundido desde el lugar donde están más concentradas (dentro de la botella ) hacia donde están menos concenLradas (en la habitación).

proceso pasivo. Al decir pasivo nos referimos a

que no requiere el aporte de energía desde una fuente externa. La difusión solo utiliza la energía cinética que poseen todas sus moléculas.

En las personas con fibrosis q uística, el movimiento de cloruro de sodio dentro de las vías respiratorias está alterado. ¿Por qué la dificultad para mover NaCI dentro de las vías aéreas genera un moco espeso? (Sugerencia: recuerde que el ag ua fluye hacia las reg iones hiperosmóticas.)

130 •

1111

5

La dif11si611 es rápida e11 distancias cortas, pero mucho más lenta en ~randes distancias. Albert Einstein estudió la difusión de las moléculas en sol ución y encontró que el tiempo requerido para que una molécula difunda desde el punto A hasta el punto Bes i1wersamente proporcional al cuadrado de la distancia entre A y B. En otras palabras, si la distancia se duplica de l a 2, el tiempo necesario para la difus ión aumenta de l' a 2' ( de I a 4). ¿Qué significa para los sistemas biológicos que la velocidad de difusión sea baja para grandes distancias? En los humanos, los nutrientes tardan cinco segundos en difundir desde la sangre hasta una céluh1 que se encuemre a LOO ~lm del capihLr más cercano. A esa misma velocidad, llevaría años a los nutrientes difundir desde el intestino delgado hasta las células en el dedo gordo del pie, y las células morirían por inanición. Para superar estas limitaciones de la difusión a través de grandes distancias, los organismos utiljzan diversos mecanismos de transporte que aceleran el despla:,,,amiento de las moléculas. La ma)'oría de los organismos multicelulares poseen alguna forma de aparato circulatorio para llevar oxígeno )' nutrientes rápidamente desde el lugar en el que penetran en el cuerpo hasta la totalidad de las células. La difusión está directamente relacio11ada c011 la temperatura. A mayores temperaturas, las moléculas se mueven más rápidamente. Debido a que la difusión resulta del movim iento molecular, la velocidad de aquella aumenta cuando lo hace la temperat Ltra . Generalmen te, cambios en la temperatura no alteran sign ificativamen te las velocidades de difusión en los seres humanos, ya que mantenernos una temperatw-a corporal relativamente constante.

KI

Rojo Congo

(b) Difusión de las tinciones 90 minutos más tarde

(a) Tinciones colocadas en los pocillos de la placa de a gar en el tiempo O • FIGURA 5-6 Experimento de difusión. (a) Los pocillos de una placa de gel de agar se llenan con dos tinciones de igual concentración: yoduro de potasio (KI, 166 daltons) y rojo Congo (697 daltons). (b) Noventa minutos más tarde, el KI (más pequeño y liviano) ha difundido por el gel, tiííendo un área más grande.

6

7

La velocidad de difusión está i11versame11te re/aciemada con el peso y el tnm,1110 molecular. Las moléculas más pequeñas requieren menos energía para desplazarse una d istancia determinada y, por lo tanto, difunden más rápidamente. Einstein demostró que la fricción entre la superficie de una partícula y el medio por el cua l difunde es una fuen te de resistencia al mov imiento. Calculó que la difusión es inversamen te proporcional al radio de la molécula: cuanto mayor es la molécula, más len ta es su difusión a través de un medio determinado. El experi mento de la • Figurn 5-6 muestra que las moléculas de ioduro de potasio ( IK), más pequeñas y livianas, d ifunden más rápidamente por el gel de aga r que las moléculas de rojo Congo, más grandes)' pesadas. La difusión puede tener lugar en un sistema abierto o a través de 1111 tabique q11e separa dos comparti111e11tos. La difusión de la colonia dentro de una habitación es un ejemplo de difusión que ocurre en un sistema abierlo. No hay barreras para el movimiento molecular, y las moléculas se dispersan para ocupar todo el sistema. La difusión también puede ocw·rir entre dos compartimentos, tales como el intracelular y el extracelular, pero solo si el tabique que los divide permite el paso de esas moléculas que d ifunden. Por ejemplo, si se cierra el frasco abierto de colonia, las moléculas no p ueden difundir hacia el aire de la habitación porque ni el frasco n i su tapa son permeables a la colonia. Sin embargo, si se reemplaza la tapa de metal por una bolsa plástica con pequeftos agujeros se comenza rá a oler la colonia en la habitación porque la bolsa sí es permeable a d ichas moléculas. De fo rm a similar, si una membrana celular es permeable a una molécula, esta puede penetrar o salir de la célula por d ifusión. Si la membrana no es permeable a una molécula en particular, la molécula no puede pasar.

El • Cuadro 5-6 resume estos puntos. Un importante punto a tener en cuenta: los iones no se desplaLan por difusión, aunque usted leerá )' escucha rá que los iones difunden a través de las membranas. La difusión es un movimiento molecular azaroso a favo r de un gradiente de co11ce11tració11. El movimiento iónico se ve iníluido por la existencia de gradientes eléctricos, debido a la atracción de cargas opuestas y a la repulsión de cargas iguales. Por esta razón, los iones se desplazan en respuesta a una combinación de gradientes eléctricos y quím icos, o gradientes electroquímicos. Este movimiento electroquímico es un proceso rn,\s complejo que la difu-

sión, que resulta solo de un gradiente de concentración, y los dos procesos no deben con fundirse. Analizaremos con mayor detalle los iones y sus gradientes electroquímicos al fo1al de este capítulo. En resumen, la difus ión es el desplazamiento pasivo de moléculas sin carga a favor de su gradiente de concentración debido al movimiento molecular aleatorio. La difusión es más lenta en distancias grandes y m,\s lenta para moléculas grandes. Cuando la concentración de las moléculas en difusión es la misma en todo el sistema, este ha alcanzado un equilibrio químico, aunque el movimiento aleator io de moléculas continúe. Revisión

11, Si la distancia por la cual una molécula deb? difundir~ triplica de 1a 3, ¿cuántasveces aumenta el tiempo de la difusión?

las moléculas lipófilas atraviesan las membranas por difusión simple La d ifusión a través de las membranas es un poco más complicada que la difusión en un sistema abierto. Solo las moléculas liposolubles (]ipófi las) pueden atravesar la b icapa fosfolipídica. El agua y muchos nutrientes vitales, iones y otras moléculas que se disuelven en agua son lipófobos por regla genernl: no se d isuelven fácilmente en lipidos. Para estas sus tancias, el centro hidrófobo de la membrana cel ular actúa como una barrera que impide su paso. Las sustancias lipóiilas que pueden atravesar el centro lipídico de una membrana lo hacen por difusión. La difusión directa a través de la bicapa fosfol ipídica de una membrana se llama difusión simple y tiene las siguientes propiedades, además de las enumeradas en la lista anterior para la difusión. l

La velocidad de difllsió11 depende de la aipacidad de la molécula en

dif11síó11 de disolverse en la capa lipídim de la 111embmm1. Otra forma de describirlo es d iciendo que la velocidad de difusión depende de lo penneable que sea la membrana a las moléculas que difunden. La mayoría de las moléculas en solución pueden unirse a las cabezas polares de glicerol-fosfato de la bicapa, pero solo las moléculas no polares que son liposo lubles (]ipófilas) pueden disolverse en el centro lipídico de la membrana. Como regla, solo los lipidos, los esteroides y las moléculas lipófilas pequeñas pueden atravesar las membranas por difusión simple.

Reglas para la difusión de moléculas sin carga

Propiedades generales de la difusión 1. La difusión utiliza la e ne rgía cinética del movimiento molecular y no req uiere una fuente externa de ene rgía. 2. Las moléculas di fun den desde un área de mayor concentración hacia un á rea de menor conce ntración. 3. La difusión continúa hasta q ue las concentraciones alcanzan el equilibrio. Sin e mba rgo, el movimie nto molecula r prosigue después de habe rse alcanzado el equili brio. 4. La difusión es más rápida - cua ndo hay gradientes de co ncentra ción más g ran des. - cua ndo hay dista ncias más cortas. - a mayo res temperaturas. - para las moléculas más pequ eñas. 5. La difusión puede tene r lugar e n un sistema abierto o a través de un tabique q ue sepa ra dos sistemas.

Difusión simple a través de una membrana 6. La velocidad de difusión a través de una membra na es mayor si - el área superficial de la mem brana es más g rande. - la mem brana es más delgada. - el g rad ie nte de conce ntración es mayor. - la mem brana es más permeable a la molécula. 7. La -

permeabili dad de la membrana a una molécula depende de la li posolu bilidad de la molécula. el tamaño de la molécula. la composició n li pídica de la membra na.

Una excepción importante a esta regla es el agua. Aunque es una molécula polar, el agua puede difundir lentamente a través de algunas membranas fosfolipídicas. Durante af10s se pensó que la naturaleza polar de la molécula de agua evitaba que se desplazara a través del centro lipídico de la bicapa, pero experimentos realizados con membranas artificiales han demostrado q ue el pequefio tamafio de la molécula de agua le permiten deslizarse entre las colas lipídicas de algunas membranas. La facilidad con la que pasa el agua a través de la membrana depende de la composición de la bicapa fosfolipídica. Las membranas con mucho contenido de colesterol son menos permeables al agua que aquellas con bajo contenido de colesterol, presumiblemente debido a q ue las moléculas liposolubles de colesterol ocupan los espacios entre las colas de los ,leidos grasos de la bicapa lipídica e impiden el paso del agua; por ejemplo, las membranas celulares de algunas regiones del rifión son esencialmente impermeables al agua a menos que las células introduzcan canales proteicos especiales para el agua en sus bicapas fosfolipídicas. La mayor parte del desplazamiento de agua a través de las membranas tiene lugar a través de cm1ales proteicos.

2

La velocidad de dif11sió11 a lmvé.s de una me111bra11a es direcwmenle proporcio11al al áre.n supe1j,ci11l de /11 membrana. En otras palabras, cuanto mayor es el área superficial de la membrana, mayor cantidad de moléculas pueden difundir a través de ella por unidad de tiempo. Este hecho puede parecer obvio, pero tiene

importantes impl icancias en fisiología. Un ejemplo asombroso de cómo un cambio en el área superficial puede afectar la difusión es la patología pulmonar denominada enfisema. A medida que el tejido pulmonar se degrada y destruye, el área superficial disponible para la difusión de oxígeno disminuye. Por consiguiente, puede penetrar menos cantidad de oxígeno hacia el interior del cuerpo. En casos severos, la cantidad de oxígeno que llega a las células no resulta suficiente para mantener la actividad muscular y el paciente est,I limitado a permanecer en cama. Las reglas para la difusión simple a través de las membranas se resumen en el Cuadro 5-6. Pueden ser combinadas matemáticamente para formar una ecuación conocida como ley de la difus ión de Fick, una relación que abarca los factores recién mencionados para la difusión a través de membranas más el factor del gradiente de concentración. De forma abreviada, la le y de Fick dice que la velocidad de difusión aumenta cuando el área superficial, el gradiente de concentración o la permeabilidad de la membrana aumentan: velocidad de difusión

la •

ex

área superficial

X

gradiente de x permeabilidad concentración de membrana

Figura ~- 7 ilustra los principios de la ley de Fick.

l a permeabilidad de la membrana es el término más complejo en la ley de Fick, debido a que le afectan muchos factores:

144

Capitulo 5 Dinámica de la membrana

Líquido oxtracolular Area superlic1al do ta membrana

Tamaño moO,C.ctJlar

L,poso1u.. blfldad

Conceotracton fue
r

• • • • •

Gradiente de concentración

Compos,ic1ón do

1• capa liprdlca

Liquido intracelular

Liposotubd1dad Tamaño molecular Gradiente de concentrac1on Área supeñietal do la mcmbmna Composlcióo de la capa lipídica

Conceotracton dentro de la célula

. Ley de la difusión de Fick

Penneabilidad de membrana Permeabilidad de membrana oc liposolubilidad

Velocidad de difusión °" área superficial x gradiente de concentración x permeabilidad de membrana

tamaño molecular Cambios en la composición de la capa lipídica pueden aumentar o disminuir la permeabilidad de membrana.

• FIGURA 5-7 ley de la difusión de Fick. Esta ley relaciona matemática mente los factores que influyen en la velocidad de difusión simple a través de una mem brana.

2

el tamaño (y la forma, para las moléculas grandes) de las moléculas que difunde. A medida que el tamaño molecular aumen La, la permeabilidad de la membrana disminuye. la liposolubilidad de la molécula. A med ida que la liposolubi li-

Revisión 12, ¡De dónde proviene la energía para la difusión?

13. ¡Qué molécula tiene más probabilidades de atravesar una membrana celular por difusión pueaen aumentar o 01smmu1r 1a permeaor11aaa de membrana.

• FIGURA 5-7 Ley de la difusión de Fick. Esta ley relaciona matemáticamente los factores que influyen en la velocidad de difusión simple a través de una mem brana.

l

2

3

el Lamaño (y la forma, para las moléculas grandes) de las moléculas que difunde. A medida que el tamaño molecular aumen la, la permeabilidad de la membrana dism inuye. la liposolubilidad de la molécula. A medida que la liposo lubi lidad de la molécula que difunde aumenta, la permeabilidad de la membrana a la molécula aum enla. la composición de la bicapa lipídica a través de la cual difunde la molécula. Las alteraciones en la composición lipídica de la membrana modifican la facilidad con la cual las moléettlas que difunden pueden deslizarse entre fosfolípidos indiv id uales. Por ejemplo, las moléculas de colesterol en las membranas se meten en los espacios entre las colas de ácidos grasos y retrasan el movimienLo de moléculas a través de esos espacios (Fig. 3-2), haciendo que la membrana sea menos permeab le. Podemos reordenar la ecuación de Fick de la siguiente manera: velocidad de difusión

gradiente de

-------= concentración área superficial

permeabilidad

Revisión

12, ¿De dónde proviene la energía para la difusión? 13. ¡Qué molécula tiene más probabilidades de atravesar una membrana celular por difusión simple, unadeácidograsoounadeglucosa? 14. ¡Qué le sucede al flujo de las moléarlas en cada uno de los si9uientes casos?

(a) El tamaño molecular aumenta. {b) El gradiente deconcentración aumenta.

(c) El área superficial de la membrana disminuye. 1S. Dos compartifll€ntos se encuentran separados por una membrana permeable solo alagua y a lasmoléculas de tinta amarilla. El compartimento Aestá lleno de una solución aruosa de tinta amarilla yel compartifll€nto Bestá lleno de una solución mrosa de tinta azul de

igual concentración. Si el sistema se deja enreposo, ¡dequé color será el compartimento A? ¿Amarillo, azul o •1erde?{Recuerde, amañllo más azul forman verde.) ¡De q~ color será el compartimento B? 16. ¡Qué impide al oxígeno atmosítrico difundir [emailprotected] dentro de nuestros cuerpos a través de

la piel? (Sugerencia: ¡qué tipo de epitelio es la piel?)

X

de membrana

Ahora, esla ecuación describe el flujo de una molécula a través de la membrana, ya que Dujo se define como la velocidad de difusión por unidad de área superficial de la membrana: flujo = gradiente de concenLración x permeabilidad de membrana En otras palabras, el flujo de Ltna molécula a Lravés de una membrana depende del gradiente de concentración y de la permeabilidad de la membrana a la molécula. Recuerde que los principios de difusión se aplican a Lodas las membranas biológicas, no solo a la membrana celular. La difusión de las sustancias dentro )' fuera de los orgámtlos sigue las mismas reglas.

Transporte mediado por proteínas En el cuerpo, la difusión simple a través de las membranas se lim ita a las moléculas lipófilas. La mayoría de las moléculas en el cuerpo son lipófobas o están cargadas elécLricamenLe y, por lo Lanto, no p ueden atravesar membranas por difusión simple. Por otro lado, la gran mayoría de solutos atraviesa las membranas con la ayuda de pro teínas de membrana, un proceso denominado transporte mediado. Si el Lransporte mediado es pasivo y desplaza moléculas a favor de su gradienle de concenLración, y si el Lransporte neto se detiene cuando las concentraciones son iguales a ambos lados de la membrana, el proceso se denomina difusión facilitada (Fig 5-5). Si el trans-

Transporte mediado por proteínas

porte mediado por proteínas reqLúere energía del ATP o de otra fuen te externa y desplaza una sustancia en contra de su gradiente de concentración, el proceso se llama transporte activo.

14S

líos de transporte son un ejemplo de cómo el citoesq ueleto da forma a la membrana (Fig. 3- 10e). Producen uniones celulares que mantienen unidos los tejidos, tales como las uniones estrechas )' las tmiones en hendidura. (Fig. 3-8). Unen las células a la matriz exlracelular en lazando las fibras del citoesq ueleto al colágeno extracelular y a o tras fibras proteicas.

2

Las proteínas de membranacumplen cuatro funciones principales

3

El transpone mediado por proteínas a través de una membrana es llevado a cabo por proteínas que atraviesan la membrana, llamadas t ra11sportadores. Para los fisiólogos, clasificar las proteínas de mem brana de acuerdo con su función es más útil que clasificarlas según su eslructura. Nuestro esquema de clasificación funcional reconoce cuatro categorías amplias de proteínas de membrana: ( l ) proteínas estructmales, í2) enzimas, (3) receptores y (4) transportadores. La a Figura 5-8 es un mapa conceptual en el que se comparan las clasificaciones estructural y funcional de las pro leí nas de memb rana. Estas categorías no son completamente distintas y, como aprenderá más adelante, algunas proteínas de membrana cumplen más de um1 fun ción, ta.les como los receptores-canales y los receptores-enzimas.

Enzimas Las enzimas de membrana catalizan reacciones químicas que tienen lugar tanto sobre la superficie externa de la célula como en su inter ior; por ejemplo, las enzimas sobre la superficie externa de las células que recubren el intestino delgado son responsables de d igerir péptidos y carbohidratos. Las enzimas adheridas a la superficie interna de muchas membmnas celulares cumplen un papel importante en la lransmisión de señales desde el medio extracelular hacia el citoplasma (véase el Capítulo 6).

Proteínas estructurales Las proteínas estructmales cumplen tres fun ciones principales. Conectan la membrana con el citoesqueleto para mantener la forma de la célula ( Fig. 3 -4 ). Las microvellosidades de los epite-

Receptores Los receptores proteicos de membrana forman parte del sistema de señalización qtLímica del cuerpo. La un ión de un receptor con su ligando habitualmente desencadena otro suceso en la membrana <• Eig '\-9). A veces, el ligando permanece sobre la superficie celular y el complejo recepto r-ligando desencadena una respuesta intracelular. En o tras situaciones, el complejo receptor-ligando es incorpo rado a la célula a través de una vesícula. Los receptores de mem-

l.:ROTEÍNA~ MEMBRA . c1ºó n, tales como 1os receptores-cana1es y 1os receptores-enumas.

Proteínas estructurales Las proteínas estructmales cumplen tres funcicrnes princ ipales. Conectan la membrana con el citoesqueleto para mantener la forma de la célula ( Fig. 3-4). Las mic rovellosidades de los epite-

Receptores Los receptores proteicos de membrana lorman parle del sistema de señalización química del cuerpo. La w1ión de w1 receptor con su ligando habitualmente desencadena otro suceso en la membrana (• Eig '\-9). A veces, el ligando permanece sobre la superficie celular y el complejo receptor-ligando desencadena una respuesta intrace lular. En otras situaciones, el complejo receptor-ligando es in corpo rado a la célula a través de una vesicula. Los receptores de mem-

PROTEÍNAS DE MEMBRANA

• se pueden categorizar de acuerdo con 1

t

t Estructura

Función

-

1 Proteínas integrales

¡

+ Proteínas

Proteínas estructurales

Transportadores de membrana

periféricas

Enzimas de 14- activan membrana

1 se encuentian en

""

Proteínas transportadoras

"" Proteínas de canal

t cambian de conformación

foJman

l 1 Canales abiertos 1

Canal con compuerta mecanica

Receptores de membrana

-

1

están activas en están actNas en

l

+

Uniones celulares

Canales tipo compuerta

Canal regulado por voltaje

Endocitosis mediada por receptor

1 Citoesqueleto 1

! 1 Metabolismo 1

Canal regulado por compuerta química

• FIGURA 5·8 Mapa conceptual de proteínas de membrana. Las categorías funcionales de las proteínas de m em brana incluyen transportadores, proteínas estructurales, enzim as y receptores.

Transferencia de señal abren y denan

Uquido extrace/ular

El complejo receptor-ligando penetra en el interior de la célula.

El ligando se une al receptor proteico de membrana.

El complejo receptor-ligando desencadena una respuesta intracelular.

Familias degenestransportadores

1

\ "íj,ernbcmacaular

Receptor

...b

Un resultado del proyecto Genoma Humano ha sido el reconocimiento de q ue muchas proteínas están relacionadas e ntre sí, tanto dentro de una misma especie como entre distintas especies. Como resultado, los científicos han descubierto que la mayoría d e los transportadores de membrana para solutos orgánicos pertenecen a una de dos "superfamilias' de genes: los transportadores ABC (del inglés ATP-binding cassette) o la superfa milia de transportadores de sol utos (Sl C, por sus siglas en inglés). los transportadores de la fami lia ABC utilizan energ ía del ATP para transportar moléculas orgánicas pequeñas a través de las membranas. Es interesa nte señalar que el canal de cloruro CfTR, que ocasiona la fibrosis quística cuando está ausente o es defectuoso, también es miembro de la familia ABC y es el único cana l iónico conocido de esa superfamilia. las 43 familias de la superfamilia SlC incluyen la mayoría de los transportadores de difusión facilitada, tales como los transportadores de glucosa GlUT, así como transportadores activos secundarios, que se muestran en el Cuadro 5-8.

Acontecimientos en la célula

Vesicula citoplasmática Uquido intracelular

Los recep tores proteicos de membrana se unen a Jigandos extrace/ulares

• FIGURA 5-9

brana también cumplen un papel importante en algunas formas de transporte vesicular, como aprt rel="nofollow">nderá más adelan te en este capítulo. túnel o poro en su centro. Los complejos del poro nuclear )' las un iones en hendidura ( Fig. 2-8b ) pueden ser considerados tipos muy grandes de canales. En este libro, restringimos el LL~O del término canal a canales más pequeños cuyos centros son poros estrechos y rellenos de agua (• Fig. 5-J l ). El flujo a través de estos canales m,\s pequeños eslá restringido principalmente para el agua y los iones. Cuando los canales están ab iertos, decenas de millones de iones por segundo pueden pasar a toda velocidad a través de ellos sin impedimento. Los canales proteicos son denominados según las sustancias cu)'º paso permiten. La mayoría de las células tienen canales de agua hechos de una proteína llamada acuapori11a. Además, más de 100 tipos de canales iónicos han sido identificados. Los canales iónicos pueden ser específicos para un ion o permitir el paso de iones de tamafio y carga s imilares. Por ejemplo, existen canales de Na· , canales de K- y canales de cationes mo11ova.lentes (de carga igual a uno) no específicos q ue Lransportan iones Na-, K' y litio ( Li·). Otros canales iónicos que encont rará frecuentemente en este texto son canales de ca2 • y canales de CJ-. La selectividad de un cana l está determinada por el diámetro de su poro central y por la carga eléctrica de los aminoácidos q ue re,Llbren el interior del canal. Si los aminm\cidos del canal están cargados positivamente, se repele.n los iones positivos y los iones negativos pueden pasar a través del canal. Por otro lado, un canal de cationes debe tener una carga negativa que atraiga cationes pero evite el movimiento de CJ- u o tros aniones. Los cana les proteicos son como puertas estrechas en la célula. Si la puerta está cerrada, nada puede pasar. Si la puerta está abierta, hay un llujo continuo entre las dos habitaciones conectadas por ella. El estado abierto o cerrado de una canal eslá determinad.o por regiones de la molécula proteica que actúan como "puertas giratorias". w1

Tm11sportadores El cuarto grupo de proteinas de membrana ( transportadores) mueve moléculas a través de las membranas (• Fig. 5- 10). La clasificación acrua]• reconoce dos tipos de transportadores: canales y transportadores. Existe superposición entre los dos tipos, tanto estructural como funcionalmente. Po r ejemplo, se ha demostrado que la proteína acuaporina (AQP) actúa como canal de agua y como transpo rtador de ciertas moléculas o rgán icas pequeñas ( véase el recuadro Novedades: fami lias de genes transportadores). Los canales p roteicos forman túneles rellenos de agua que unen directamente los compartimentos intracelular y exLracelular. Las proteínas transportadoras se unen a los sustratos que transportan, pero nunca forman una conexión directa enlre el líquido intracelular y el líquido extracelular. Como se muestra en la Figura 5- LO, los transportadores están ab iertos en uno u otro lado de la membrana, pero no en ambos al mismo tiempo, como sí lo están los canales proteicos. ¿Por qué necesitan las células canales y transportadores? La respuesta yace en las diferentes propiedades de los dos transportadores. Los canales proteicos permiten un transporte más rápido a través de la membrana, pero generalmente están ).imi tados a movilizar agua y pequeños iones. Los Lransportadores, si bien son más lentos, pueden movilizar mo léculas más grandes.

Lasproteínas de canal forman túneles abiertos rellenos de agua Los canales proteicos esh\n formados por subunidades pro teicas que atraviesan la membrana )' que forman un conj Lmto de cilindros con

,.; El Sistema de Clasificación de Tran.sportadores, w-.vw.tcdb.org

Transportadores de membrana Los transportadores de membrana son proteínas que atraviesan la membrana y que ayudan a trasladar moléculas lipófobas a través de las membranas.

TRANSPORTADORES DE MEMBRANA

(a) Las proteínas de canal crean un poro lleno de agua.

(b} Las proteínas transportadoras nunca forman un canal abierto entre los dos lados de la membrana.

LEC Membraha celular

... Transportador El mismo transporabierto hacia el LIC tador abierto hacia el LEC

L/C 1 'fi carse en pueden clas1

1

l Los canales de compuerta se abren y se cierran en respuesta a señales.

... ._.• ...,. , ,{).v,v,, ,,... ,, ._,,, ,,.,,...,...,.....,._.~._....._

señales.

pueden el sificarse en

l

Los canales abiertos o poros están habitualmente abiertos.

A

están habitualmente abiertos.

Cotransportadores

Los uniportadores transportan un único tipo de sustrato.

Los simportadores movilizan dos o más sustratos en la misma d írección a través de la membrana.

[ Glu] co tipo de sustrato.

G) CQE

ma d irección a través de la membrana.

Los antiportadores' movilizan sustratoJ en direcciones opuestas.

e

en direcciones opuestas.

1 Cerrado

- olo- -

-+-,

ATP

En las dos filas superiores se muestra un primer plano de los transportadores, y vistas más distantes se muestran en la fila inferior. El transporte activo primario está indicado por el ATP sobre la proteína.

De acue rdo con los mode los acLuales , las "p uertas" de los canales tienen muchas fo rmas. Algunos cru1ales proteicos tienen puertas en el medio del poro de la proLeína. Otras p uertas son parte del lado ciLop lasmático de la proteína de membnu1a. La puerta de este tipo p uede ser ejemplificada como una cadena con una bola que se mueve hacia a rriba y b loq uea la enLrada del canal ( Fjg ~- !Oa). Un tipo de cana l en las neuronas tiene dos puertas diferenLes.

Los canales se pueden clasificar según si sus puertas esLán habi tualmente abiertas o cerradas. Los canales abiertos pasan la mayor parte de su tiempo con su puerta ab ierta, perm itie ndo a los iones desplazarse en ambas di recciones a través de la membrana sin regulación. OcasionalmenLe, estas puertas pueden cerrarse de forma transitoria, pero la mayor parte del tiempo estos canales se comportan como si no tuv iesen puerla. A los e.anales abierLos se los denomina a veces canales permeables o poros, como los poros de t1g1111.

Capitulo 5 Dinámica de la membrana

148

Muchos canales está hechos de múltiples subunidades proteicas que se ensamblan en la membrana. $

r

~

1

1 1 1 1 1

:1

IÍl

'

1 1

!.r4. 1

1 1 1 1

1 1 1 ~.

-

Canal a través del centro de la proteína de membrana

Una subunidad proteica de canal Canal a través del centro e proteína de membram, (visto desde arriba)

• FIGURA 5-11 Estructura de los canales proteicos. Los aminoácidos hidrófilos de la proteína recubren el interio r del canal, creando un túnel relleno de agua que p ermite que los iones y m oléculas muy pequeñas, como el agua, pasen a través del canal.

l a fibrosis q uística es una e nferme dad debilitante causada por un defecto e n u n ca na l proteico de membrana que normalmente transporta iones cloruro (CI·). la p roteína - llamad a regulador de la conductancia transmembrana de la fibrosis quística o Cf TR, por sus sig las en inglés- se e ncuentra e n los epitelios q ue recu· bre n las vías aéreas, en las glándulas sudoríparas y en el páncreas. El can al de la prote ína CFTR se abre cu an do se le une u na molécula d e ATP. En los pulmones, este canal abie rto transporta el· fue ra de la-s células e piteliales h acia la luz d e las vías aéreas. En las personas con fibrosis q u ística, el CFTR es no funcional o está a usente. Com o resultado, e l trans porte de cloruro a través d e l e pite lio está afectado, lo que genera un moco espeso. P2:

¿El CFTR es u n canal proteico regulado q uímica mente, por voltaje o mecá nicamente?

130

Los can ales tipo compuerta pasan la mayor parte de su tiempo en estado cerrado, lo que permite a estos canales regular el desplazamiento de iones a través de ellos. Cuando un canal tipo comp uerta se abre, los iones íluyen a través del canal como lo hacen a través de canales abiertos. Cuando un canal tipo compuerta está cerrado - lo que puede durar mucho tiempo- no permite el movimiento de ningún ion entre los Ouidos intracelular y extracel ular. ¿Qué controla la apertura )' el cierre de los canales tipo compuerta? Para los canales regulados por compuerta qtúmica, la puerta está controlada por moléculas mensajeras i.ntracelulares o ligandos extracelulares que se unen al e.anal proteico. Los canales regulados ¿'-


17. Los iones cargados positivameo~ se llaman _ __ y losiones cargados negativamen· te se llaman _ __

Las proteínas transportadoras cambiansu conformación para movilizar moléculas El segundo tipo de proteínas de transporte lo forman las proteínas transportadoras I Eig ~- 1Oh). Estas se unen a sustratos específicos y los movilizan a través de la membrana cambiando su conformación. las moléculas orgánicas pequeñas (como la glucosa )' los am inoácidos) que resultan demasiado grandes para pasar a través de canales atraviesan las membranas uti.lizando transportadores. Los iones como el Na· y el K· pueden movilizarse mediante transportadores o pasar a través de canales. Las proteínas transportadoras movil izan solutos e iones dentro y fuera de las cél ulas así como dentro y fuera de los orgánulos intracelulares, como las mitocondrias.

141

158

161

168

Algunas proteínas transportadoras movilizan un solo tipo de molécula y se conocen como uniportadores. Sin embargo, es común encontrar transportadores que movilizan dos e incluso tres Lipos de moléculas. Un transportador que moviliza más de un tipo de molécula al m ismo tiempo se denomina cotransportador. Si las moléculas transportadas se desplazan en la misma d irección, ya sea hacia dentro o haci a fuera de la célula, las proteínas t ransportadoras son simportadores (sym-, juntos,+ portare, acarrear) (a veces, el térm ino cotransporte se uliliza en lugar de simporte). Si las moléculas transportadas se uansponaua~ se rn:sptazan en ta misma lllrecoon, ya sea nana uemro o haci a fuera de la célula, las proteínas t ransportadoras son simportadores (sym-, juntos,+ portare, acarrear) (a veces, el térm ino cotransporte se uliliza en lugar de simporte). Si las moléculas transportadas se desplazan en direcciones op uestas, las proteínas transportadoras son antiportadores ( a111i, opuesto,+ portare, acarrear), también llam adas intercambiaaores. Los simportadores )' los anliportadores se muestran en la Figura 5- IOb. Los transportadores son proteínas grandes y complejas con múlLiples subunidades. El cambio en la confonnación al que debe someterse una proteína Lransporladora hace que este tipo de transporte transmembrana sea mucho más lento que el movim iento a través de canales proteicos. Una proteína transportadora solo puede movilizar en tre 1 000 y 1 000 000 de moléculas po r segundo, en comparación con las decenas de millones de iones po r segundo que íluyen a través de un canal proteico. Las proteínas transportadoras difieren de los canales proteicos en otro aspecto: los transportadores nunca forman un conducto con Linuo entre el interior y el exterior de la célula. Si los canales son como túneles, los transportadores son como p uertas giratorias que penniten el flujo entre el interior y el exterior sin formar un canal abierto. Las proteínas transportadoras pueden movilizar moléculas a través de la membrana en ambas direcciones, como la puerta giratoria de un hotel, o pueden restringir su transporte en un sen tido, como el molinete de un parque de diversiones que solo permite a las personas pas1tr en una dirección. Un lado de la pro teína transportadora siempre forma una barrera que evita el intercambio libre a través de la membrana. Con respecto a este tema, las proteínas transpo rtadoras son como el canal de

Compuerta cerrada

\

Uqwdo mtracelular

UQwdo extracelular

Océano

Paso abterto

Atlántico

hacia un lado

Molécula a transportar

~

Compuerta cerrada Transportador Membrana

Océano Pacífico

Océano Atlántico

Estado de trans1c1ón con ambas compuertas cerradas

Océano Pacífico

Paso abierto hacia el o tro lado

(a)

(b)

• FIGURA 5- 12 Difusión facilitada por medio de una proteína transportadora. Las proteínas t ransportadoras, como el canal ilustrado, nunca forman un t únel conti nuo entre los líquidos extracelular e intracelular.

Panamá (a Fi!l.. 5- 12). Imagine el canal con solo dos compuertas, una sobre el océano AtlánLico y o lra sobre el océano Pacífico. Solo una de las compue rtas se encuenlra abierla cada vez. Cuando la compuerta atlánLica está cerrada, el canal se abre hacia el Pacífico. Un barco entra en el canal desde el Pacífico y la compuerta se cierra detrás de él. Entonces el canal está aislado de ambos océanos y el barco, atrapado en el medio. Luego, la compuerta atlántica se abre, comu nicando el canal con el océano Atlántico. El barco sale navegando del canal y entra en el Atlántico, habiendo cruzado la barrera de tierra sin que el canal fo rmase una conexión con tin ua en tre los dos océanos. El desplazamiento a Lravés de una membrana por medio de una proteína transporLadora es similar ( Fi¡¡. 5-12b). La molécula que se transporta se une al transportador en un lado de la membrana (en el lado extracelular, en nuestro ejemplo). Esta unión camb ia la conformación de la proteína transporladora, Lra; lo cual la abertura se cierra. Tras una breve trans ición, en la cual ambos lados están cerrados, el lado opueslo del transportador se abre hacia el otro lado de la membrana. El transpo rtador libera luego la molécula transportada en el compartimen lo opuesto, habiéndola transportado a Lravés de la membrana sin crear una conexión continua en tre los compartimentos extracelular e intracelular.

Revisión 18. Nombrecuatro funciones de las proleín..s de membra1w1,

19. ¿Qué tipos de partículas pasan a través de canales abiertos?

l as p roteínas transportadoras pueden dividirse en dos categorías de acuerdo con la fuente de energía que utili za n para el transporte. Como se destacó ante rio rmente, la difusión facilitada es un Lnuisporte mediado por proteínas en el cual no es necesaria una fuente externa de ene rgía para movilizar moléculas a través de la membrana celular. El transporte activo está mediado por proteínas q ue sí requieren de una fuente externa de energía, ya sea el ATP o la energía potencial almacenada en un gradiente de concentración. Estudiaremos primero la difusión facil itada.

La difusión facilitada utiliza proteínas transportadoras Algunas moléculas polares parecen desplazarse dentro y fuera de las células por difusión, aunque sabemos, a partir de sus p ropiedades químicas, que son incapaces de pasar fácilmente a través del centro lipídico de la membrana celular. La solución a esta aparente contradicción es que estas moléculas polares aLravies,u1 la membrana celular por difusión facilitada, con la ayuda de transportado res específicos. Los azúcares y los am inoácidos son ejemplos de moléculas que entran o salen de las células Lllilizando la difusión facilitada. Por ejemplo, la familia de las proteínas transportadoras conocidas como transportado res GLUT moviliza glucosa y hexosas relacionadas a Lravés de membranas. la difusión facilitada tiene las m ismas propiedades que la difusión simple (véase el Cuadro 5-6). Las moléculas transportadas fluyen a favor de su gradiente de concen lración, el proceso no reqwere aporte de energía y el movim iento neto se detiene en el equilibrio, cuando la concentración den tro de la célula iguala a la co ncentración fuera de

ella r• Eig 5- I3l:

20. Nombre dos diferEncias entre loscanales ylos transportador~ 21, Si un canal se recubre conaminoácidos que tienen una carga neta positiva, ¿cuáVes de los

siguientesiones tienelnmás probabilidaifas de fluir librEmente a traV€s delcanal? ¡Na·, et, K· o Ca''? 22. ¿Por qué la gfoco;a no puede atravesar fa membrana celular a través de canales abiertos?

(gl ucosa luc = (glucosa)uc""

* En este libro, la presencia de co rche te s alred edor d el nombre d e un soluto indica concentración.

1 SO

Capitulo 5 Dinámica de la membrana

Alta concentración de glucosa

ftJ

-

[glucosa] fuera=

&:::t

e:,

D[glucosa] dentro

-

-

Baja concentración de glucosa

e;,

o

&:::t

a

a

cP

(a) La difusión facilitada introduce glucosa dentro de la célula a favor de su gradiente de concentración.

'

o

[glucosa]

-

dentro ) permanece b "

~p

CI

1

~

Alta [glucosaJfuera ~

lucogeno Glucólisis

o

(b) La difusión alcanza el equilibrio cuando las concentraciones de glucosa dentro y fuera de la célula son iguales.

'

C:t

-

ATP

ADP

~

a

(c) La conversión de la glucosa importada en glucosa-6-fosfato (G-6-P)

• FIGURA 5-13 Difusión facilitada de glucosa dentro de las células. Esta figura muestra el transporte de glucosa por medio de la proteína transportadora GLUT.

Los Lransportadores de la difusión facilitada siempre movilizan moléculas a favor de su gradiente de concentración. Si el gradiente se invierLe, también lo hace la dirección del LransporLe. Las células en las que tiene lugar la difusión facilitada pueden evitar akam-.ar el equilib rio manteniendo una baja concentración de sustrato en el interior celular. Con la glucosa, por ejemplo, esto se consigue mediante la fosforilación (Fig. 5- 13c). Tan pronto como una molécu la de glucosa entra en la célula mediante el transponador GLUT, es fosfori lada a glucosa-6-fosfato, el primer paso de la glucóli sus,rmu en et 111,enur cetuiar. 1..,011 ta gtucusa, por eJemptu, e~,u se consigue mediante la fosforilación (Fig. 5- 13c). Tan pronto como una molécula de glucosa entra en la célula mediante el transponador GLUT, es fosfori lada a glucosa-6-fosfato, el primer paso de la glucóli sis. La adición deJ grupo íosfato evita la acumulación de glucosa den tro de la célula y, también, que la glucosa salga de la célula. Revisión

23. las célulashepáticas son capaces deconvertir elglucógeno englucosa, haciendo que la concentradón intracelulai deglucosa sea mayor que la extracelular. ¡Qué piensa usted ~ socedecon la difusión facilitada de la glucosa cuando esto ocurre?

1

_J

El transporte activo moviliza sustancias en contra de sus gradientes de concentración El transporte activo es un proceso que moviliza moléculas e11 contra de sus gradientes de concentración; es decir, desde áreas de menor concentración hacia áreas de mayor concentración. En vez de generar un estado de equilibrio, en el que la concentración de la molécula es igual en todo el sisLema, el transpone activo crea un estado de desequilibrio aJ hacer que las diferencias de concentración sean más pronunciadas. Movil izar moléculas contra sus gradientes de concentración requiere el aporte de energía externa, al igual que empujar una pelota cuesta arriba por una colina (véase la Fig. 4-2 ). La energía para el transporte activo proviene di recta o indirectamenLe del enlace fosfato de alta energía del ATP. El transporte acLivo puede dividirse en dos tipos. En el transporte activo primario (directo), la energía para movilizar las moléculas

en conLra de sus gradientes de concentración proviene directamente del enlace fosfato de alta energía del ATP. El transpo rte activo secundario ( indirecto) utiliza la energía potencial almacenada en el gradiente de conce.nLración de una molécula para movilizar otras moléculas en contra de sus gradientes de concentración. Todo transporte activo secundario depende en última instancia del Lransporte activo primario, debido a que los gradientes de concentración que dirigen el transporte secundario son generados utilizando energía del ATP. El mecanismo para ambos tipos de Lransporte activo es similar acuvu secunuanu uepenue en utuma ms,anna uet Lranspune acuvu primario, debido a que los gradientes de concentración que dirigen el transporte secundario son generados utilizando energía del ATP. El mecanismo para ambos tipos de Lransporte activo es similar al de la difusión facilitada. Un sustrato que debe ser transportado se tme a un transportador de membrana, el cual cambia su conformación y libera el sustrato en el compartimento opuesto. El transporle activo difiere de la difusión facilitada en que el cambio de conformación de la proteína transportadora requiere un aporte de energía.

Transporte activo primario Debido a que el transporte activo primario utiliza ATP como fuente de energía, muchos transportadores acti vos primarios son conocidos como ATPasas. Usted recordará que el sufijo - asa significa que se trata de una enzima, y la raíz (ATP ) es el sustrato sobre el cual actúa la enzima. Estas enzimas hidroliz.an el ATP en ADP y fosfato inorgánico ( P,), liberando en el proceso energía utilizable. La ma)'oría de las ATPasas que enconLrará en su estudio de la fisiología se encuentran listadas en el • Cuadro "i-7 A las ATPasas a veces se las denomina bombas (p. ej., la bomba de sodio-potasio, o Na-- K·-ATPasa, mencionada con anterioridad en este capítulo). La bomba de sodio-potasio es probablemente la proteína trans portadora individual más importante en las células animales, ya que mantiene los gradientes de concentración del N,c y del K- a través de la membrana (• Eig '>- 14 ). El transportador está ubicado en la mem brana celular y bombea 3 Na• hacia fuera y 2 K. hacia dentro de la célula por cada ATP consum ido. En algunas células, la energía uecesaria para movilizar estos iones utiliza el 30% de todo el ATP producido en la célula. La • Eigwa 5- 15 ilustra el modelo actual del funcionamiento de la Na·-K·-ATPasa.

Transportadores activos primarios

Nombres

Tipo de transporte

Na•-K·-ATPasa o bomba d e sodio-potasio

Antip o rte

Ca2·-ATPasa

Unip orte

H·-ATPasa o bomba de pro to n es

Unip orte

H•-K• -ATPasa

Antip o rte

La Na+-K+-ATPasa utiliza energía del ATP para bombear Na+ fuera de la célula y K+ dentro de ella.

o

o

o

o o

o

o

, Líquido extracelular: 1 Alta [Na+] 0 Baja [K+J

Líquido intracelular: Baja [Na+] Alta [K+J

o

• • • • •• • o • •• o • • • • o o

o o

l

o

o

o

o

o

o

El transporte activo secundario utiliza la energía cinética de una molécula que se desplaza a favo r de su gradiente de concentració n para movi lizar olras mo léculas en co ntra de sus gradientes de concenLración. Las moléculas cotransportadas pueden desplazarse a través de la membrana en el mismo sen tido (simpone) o en sentidos opuestos (antiporte). Los sistemas de transporte activo secundario más comunes son conducidos por el gradiente de concen tración del sodio. A medida que el Na- enlra en la célula, trae consigo una o más moléculas o intercambia lugares con moléculas que salen de la cél ula. Los pr incipales transportadores dependientes de Na- se muestran en el • Cuadro 5-8. Nótese que las sustancias cotransportadas pueden ser io nes o moléculas sin ca rga, corn o la glucosa. Al estudiar los d iferen tes sistemas corporales, usted encon trará estos transportado res activos secundar ios par ticipando en muchos procesos fisio lógicos. El mecan ismo del transportador activo secundar io de Na• -glucosa (SGLT, por sus siglas en inglés) se iluslra en la • Figu ra 5- 16 en la página J53. Tanto el Na- co mo la gl ucosa se unen a la proteína SGLT del lado del liquido ex tracelular. El sodio se une primero y produce un cambio coníormacional en la proteína, lo q ue genera un lugar de un ión de al ta a finidad para la glucosa (i), Cuando la glucosa se une al SGLT ®, la proteína ca mb ia nuevamen te su con formació n y ab re su canal hacia el líq uido intracelular @. El sodio es liberado en el LI C, desplazándose a favo r de su gradiente de concen tración. La separació n del Na+ de. la proteína vuelve el lugar de un ión de la glucosa a su estado de baja afin idad, por lo q ue la glucosa es liberada y íluye junto al Na+ hacia el ci toplasma © . El resultado neto supone el movi-

o

o o o o o

o

Simportadores

o

o

Ejemplos de transportadores activos secundarios

Antiportadores

Transportadores dependientes de sodio

o

o o o

Na· -glucosa (SGLT)

Na· -Ca 2• (NCX)

• FIGURA 5- 14 La bomba de sodio-p otasio (Na' -K' -ATPasa). En

este lib ro, las p roteínas transporta doras q ue hid rolizan ATP se escriben sobre la proteína de membrana.

Na•-HCO3Na+-ami noácid os (muchos tipos)

Transporte activo secundario El gradiente de concenLración de sodio, con u na alta co ncentración de Na+ en el líquido extracel ular y una baja concentració n dentro de la célula, es um1 fuen te de energía potencial que la célula puede aprovecha r para im pulsar otras funciones. Por ejemplo, las neuronas utiliza n el gradiente de sod io para transmiti r señales eléctricas, y las células epiteliales lo utilizan parn favorecer la absortión de nutrien tes, io nes )' agua. Los transportadores de membrana q ue utilizan la energía potencial al macenada en los grad ientes de concen tració n pa ra mov ilizar moléculas se Llaman

1ra11sportt1dores activos secundarios.

Na+-sales bi liares (intestino d e lgado) Na+-captación d e colina (células ne rviosas) Na+-captación d e n eu rotransmisore s (cé lulas ne rviosas) Transportadores no dependientes de sodio

Simp ortador H"-pépt idos (p epT)

HCO 3--cr

o

LEC Alta [Na+] ATP

L 8

Aparecen sitios de alta afinidad para el Na+.

ADP + energía

e

tic

3 Na+ del se unen a sitios de alta afinidad. Baja [Na+] L/C

Los lugares de O unión de K pierden 1

.,-

su afinidad por el K+ y liberan 2 K+ en el LIC.

®--.:

El Pi es liberado.

LaATPasaes fosforilada con Pi delATP. La proteína cambia su conformación.

La proteína cambia su conformación. 2 K+ del LEC se

o

Los lugares de unión de Na pierden su afinidad por el Na+ y liberan 3 Na+ en el LEC.

Baja (K+J

Aparecen los P lugares de unión de alta afinidad para el K+.

Alta [K+J • FIGURA 5-15 Mecanismo de la Na•-K•-ATPasa. Esta figura representa un modelo de cómo la

Na•-K•-ATPasa utiliza la energía y el fosfato inorgánico (P,) del ATP para movilizar iones a través de una membrana.

miento de glucosa hacia el interior la célula en con tra de SL1 gradiente de concentración, acoplada al fl ujo de Na- hacia dentro de la célula a favo r de su grad ien te de concentración. Por el contrario, los transportado res GLUT son reversibles y pueden movilizar glucosa dentro o fuera de la célula dependiendo del gradiente de concentración. Por ejemplo, cuando los niveles de gl ucosa en sangre son elevados, los transportado res (~LUT de las células h epáticas int roducen glucosa a d ichas células. En períodos de ayuno, cuando los niveles de glucosa en sangre disminuyen, las células hepáticas convierten sus depósitos de glucógeno en glucosa. Crnmdo la concen tració n de gl ucosa dentro de los hepatocitos supera la concentración plasmática, la glucosa sale de las células a través de los transportadores GLUT reversibles. Estos transportadores se encuentra n en todas las células del cuerpo.

Si los transportadores GLUT están en todos lados, ¿por qué necesita el cuerpo el simportador SGLT? La respuesta es sencilla: tan to el SG LT corno el GLUT son necesa rios para movilizar glucosa de un lado de un epi telio al otro. Por consiguiente, los transportadores SG LT se encuentran en ciertas células epiteliales, como las intestinales y las renales, que introducen glucosa al cuerpo desde el medio externo. Analizaremos el proceso de transporte transepitelial de glucosa más adelante en este capítulo.

Revisión 24. Nombredos diferencias entre el transportador activo Na··K··ATPasa (Eig.ilS) yel trans· portador sernndario SGlJ (Fig. S·16).

El transporte mediado por transportadores presenta especificidad, competición ysaturación Tanto la fonna pasiva como la activa del transporte mediado po r transportadores presen tan especificidad, competición y saturación, tres propiedades que resultan de la un ió n de un sustrato a una proteína.

B Na+ se une al transportador.

Uquido intracelular

Luz intestinal o renal

e -0

Alta [Na+]

Proteína SGLT

@] Baja [glucosa] Baja [Na+] Alta [glucosa]

unión del Na+ genera un sitio de alta afinidad para la glucosa.

uc

Luz

La unión de la glucosa m odifica la conforn,ación del transportador, tras lo cual los fugares de unión se disponen al LIC.

L/C

Luz

El Na+ es liberado en el citosol, donde la [Na+] es baja. Esa liberación hace que el lugar de unión a la glucosa vuelva a ser de baja afinidad. La glucosa se libera.

~

- -fGr-,..

Baja [Na+]

--~-( _, ~ ___

Alta {glucosa]

Luz

L/C

• FIGURA 5-16 Mecanismo del transportador SGLT. Este t ransportador utiliza la energ ía potencial almace nada en el gradiente de concentración del Na+ para movilizar glucosa en contra de su gradi ente de concentración.

Especificidad La espec ificidad se refiere a la capac idad de un lranspo rtado r de movilizar un único tipo de molécula o un único grupo de molfr ulas estrechamente relacio nadas. Un ejemp lo de especiíicidad se encuentra en la familia de transpo rtado res GLUT, que mov iliza azúcares de 6 carbonos ( hexosas), tales como glucosa, manosa, galactosa y fr uctosa, a través d e las membranas celu la res. Los transportadores GLUT liene n luga res de unión que reconocen y Lra nsporlan hexosas, pero no transportan el disacárido mahosa n i cualqu ier otra forma de glucosa q ue no se encuentre en la naturaleza f ig. 5- l 7b). Por esta razón podemos decir que los transportadores GLUT son específicos para monosacá ridos de 6 carbo nos naturales. Durante muchos años, los científicos supusieron que debía haber diferen tes isoformas del transportador para la difusión facilitada de glucosa, ya que hab ían observad o que el lransportador de glucosa estaba regLLlado por hormo nas en algunas célu.las pero no en otras. Si n emba rgo, no fue hasta l 980 que se aisló el primer transportador de glucosa. Hasta la fecha, se han jdenti ficado alrededor de 12 genes GLUT. Las proleínas GLUT importantes q ue usted encontrará en este libro incluyen el GLUT L, hallado en la mayo ría de las cél ulas del cuerpo; el GLUT2, hallado en el hígado y en los ep itel ios intestinal y renal; el GLUT3, hallado en las neuronas; el c; LUT4, el transpo rtador regulado por insul ina del músculo esquelético; y el G LUTS, el transportador intesLinal de fr uctosa. La restr icció n de diferentes GLUT a diferentes tej idos es una característica importante en el metabolismo y la homeostasis de la glucosa.

<•

Competición La propiedad de competición está estrech amente relacio nada con la especiíicidad . Un transpo rtador puede movilizar muchos miembros de un grupo de sustratos relacio nados, pero esos sustratos compilen entre sí para ocup.tr los lugares de unión del transportador. Po r ejemplo, los transpo rtadores GLUT movilizan la familia de las hexosas, pero cada GLUT diferente Liene "preferencia" -basada en s u aíi nidad de un ión- por una o más hexosas. Los resullados de un experimento que prueba la compelición se muestran en la figura 5- 17c. El grá fi co muestra la velocidad de transporte de la glucosa en función de su concen tración. La línea superior (de color rojo) muestra el transporte cuando solo está presen te la glucosa. l a línea infer ior (de color negro) muestra que el Lransporte de glucosa d isminu)'e si también se encuentra presente la galactosa. Esta compite por los lugares de unión de los transportado res GLUT y desplaza algunas moléculas de glucosa. Con menos glucosa disponible para un irse al GLUT, la velocidad de transpo rte de glucosa al interio r cel ular disminuye. A veces la molécula competidora no es transportada, sino que simplemente bloquea el transpon e de ot ro sustrato. En este caso, la molécula competido ra es w1 inhibidor competitivo. En el s istema de transporte de la glucosa, el disacárido mah osa es un inh ibido r competitivo (f ig. 5- 17b). Este compile co n la glucosa por los lugares de unión, pero, una vez que se une, es demasiado grande para ser transportado a través de la membrana. l a cornpeLición entre sustratos transportados ha sido bien uLilizada en medicina. Un ejemplo de e$l0 es el de la gota, una enfermedad causada po r niveles elevados de ácido úrico en el plasma. Un método para d ism inuir estos niveles es aumen Lando la excreción de ácido úrico en la o rina. Normalmente, el tmmportador de aniones orgánicos del riñón (OAT, por sus siglas en inglés) reabsorbe el urato

Líquido extracelular C-

Glucosa

Transportador GLUT

Líquido intracelular (a) El transportador GLUT transporta glucosa a través de las membranas celulares.

(b) La maltosa es un inhibidor competitivo que se une al transportador GLLJT, pero no es transportada a través de la membrana.

Solo glucosa Glucosa y galactosa (1 mM)

, ,

, ,,

/ /

G,,REGUNTA ¿Puede decir a partir de este gráfico si hay transporte de galactosa?

,/

5

10

15

Concentración de glucosa (mM) (c) Este gráfico muestra la velocidad de transporte de la glucosa en función de su concentración. En el primer experimento solo había glucosa. En el segundo experimento se añadió una concentración constante de galactosa.

i

º Transporte máximo

~

~ .s

---- ------;-- ....-------¡

Q)

PREGUNTA ¿Cómo puede hacer la célula para aumentar la velocidad de transporte en este ejemplo?

.!:l

o

"'

,,::;

i ! i 'O

"' ~

'O

~

Concentración extracelular de sustrato

-

La velocidad de transporte es proporcional a la concentración de sustrato hasta que los transportadores se saturan.

más urato se elimi na del cuerpo por la orina, d ism inuyendo la con centración de ácido úrico en el plasma. Saturación La velocidad de tra nsporte de un sustrato depende de su concen tración y del número de moléculas del Lmnsportador, una p ropiedad que se comparte con las enzimas y otras proteínas de unión. Sin emba rgo, para un número fijo de transportadores, a medida que la concentración de sustrato aumenta también lo hace la velocidad de transporte hasta un máximo, el pun to en el cual todos los lugares de un ión del transportado r están ocupados por sustrato. En este punto, se dice que los transportadores han alcanzado la saturación. En la saturación, los Lransportadores trabajan a su máxima velocidad, y un aumento extra en la concentración de sust rato no tiene efecto. La Figura 5-17d representa grá ltcamente la saturación. Como analogía, piense en los Lransportadores como puertas de acce$O en una sala de co nciertos. Cada puerta tiene un número máximo


(d) Este gráfico muestra que el transporte puede alcanzar una velocidad máx

• FIGURA 5-17 Saturación y competición

Revisión 25. ¿Cómo llamaría a un transportador que moviliza áos stJStratos a través óe la membrana en

direcciones opuestas?

(la forma aniónica del ácido úrico) de la ori na y lo dev uelve en forma de ácido úrico al plasma. Sin embargo, si al paciente se le adminisLra un ácido orgánico llamado probenecida, el OAT se une a e$te en lugar de al ácido úrico, evi tando la reabsorción de urato. Como resultado,

26, En la analogía de la sala de conoertos, describimos cómo la velocidad máxima de trans·

porte puede veise inciementada por un aumentar enel número de puertas quepermiten la entrada a lasala. Utilizanoo lami;maanalogía, ¡pue


Transporte mediado por vesículas ¿Qué les sucede a las muchas macromoléculas que son demasiado grandes para en lntr o salir de las células a través de canales proleicos o de tra nsponadores? Tales moléculas se desplazan denlro y fuera de la célula con la a)'uda de vesículas con forma de b urbuja creadas por la memb rana cel ular. Las cél ulas utilizan dos procesos básicos para impo rtar grandes molécul as y parLículas: la fagociLosis y la endocitosis. Algunos científicos consideran la fagoci losis corno un tipo de endocitosis, pero, desde el punto de visla mecán ico, los dos procesos son di ferentes. La, sustancias abandonan las cél ulas med iante el proceso conocido co mo exociLosis, el cual es sim ilar a la endoci Losis pero en sen Lido inverso.

La fagocitosis crea vesículas utilizando el citoesqueleto Al esLudia r a las amebas en el laboratorio se puede observar que estas crialuras un icel ulares ingieren su comida rodeándola y encerrándola den Lro de una vesícula que luego es inLroducida en el ciLoplasma. La fagocitosis (phagei11, com er,+ cyte, célula,+ -sis, proceso) es el proceso mediado por actina por el cual una célula envuelve una bacteria tt o tra partícula denLro de una gran vesícula un ida a la membra na llamada fogos oma ( soma, cuerpo). El fagosoma se separa de la membrana celula r y se mueve hacia el interior de la célula, donde se fus iona con un lisosoma, cuyas enzimas digestivas deslruyen la bacteria. La fagocilosis requiere energía proven ien Le del ATP para el movimiento del ciLOesqueleLo y para el transporLe in Lracelula r de las vesículas. En los seres humanos, la fagocitosis ocurre en cierLos tipos de glóbulos b lancos, llamados fagocitos, que se especializan en "comer" bacterias y o Lras parLículas exlrañas Fig. 5- 18).

Bacteria

Fagocito Lisosoma

El glóbulo blanco fagocítico se encuentra con una bacteria, la cual se une a la membrana celular.

o

El fagocito utiliza su citoesqueleto para empujar su membrana celular alrededo de la bacteria, creando una gran vesícula, el fagosoma.

o

El fagosoma que contiene la bacteria se separa de la membrana celular y se desplaza hacia el citoplasma.

<•

La endocitosis forma vesículas más pequeñas La endocitosis, el segundo proceso por el cual las moléculas o las parLículas grandes se incor poran al inlerio r de las cél ulas, difiere de la fagocilosis en dos aspectos importantes. Primero, en la endociLOsis, la superficie de la membrana forma hendiduras en lugar de sob resalir. Segundo, las vesículas formadas en la endoci tosis son mucho más pequeñas. Además, parle de la endociLosis es co11sti:tufiva; es decir, constituye una función esencial que contin uamente se está llevando a cabo. Po r el contra rio, la fagoci Losis debe ser desencadenada po r la presencia de una sustancia q ue será ingerida. La endocitos is es un proceso activo que requiere energía proveniente del ATP. Puede se r no selectivo, perm itiendo la entrada del líquido extracelular a la célula ( un proceso llamado pinocitosis [pino, beber] ), o puede ser altamente selecLivo, permiliendo solo la en Lrada a la cél ula de moléculas específicas. En la endocitosis mediada po r recepto r, un ligando se une a una proleína receptora de membrana para activar el proceso.

E11docitosis mediada por recept.or La endocitosis mediada por recepto r tiene lugar en regiones de la membrana celular conocidas como fosetas recubiertas de clat rina, hendiduras en las que el lado ciLOplasmáLico de la membrana tiene altas concenLracio nes de la pro Leína clatri11a, il ustrada en la • Figura 5- 19.

4..

A

u

El fagosoma se fusiona con lisosomas que contienen enzimas digestivas.

4 t La bacteria muere y es digerida dentro de la vesícula.

• FIGURA 5-18 Fagocitosis

En el pr imer paso del proceso, cierLos ligandos extracelulares que pentrarán en el in Lerior de la célula se unen a sus recepto res de membrana G)_ El complejo receptor- ligando migra por h1 superúcie cel ular hasLa encontrarse con u na fosiLa recubierLa de claLrina ®. Una vez que el complejo receplor- ligando se dispone en la fosita recubier-

a

FIGURAS-19 FUNDAMENTOS

Endocitosis, exocitosis y reciclado de membrana

La membrana separada de la superficie celular debido a la endocitosis es reciclada nuevamente mediante la exocitosis.

Uquido extrace/ular 8 ligando se une al receptor de membrana. Exocitosis

El complejo receptor-ligando migra hacia una toseta recubierta de clatrina.

La vesícula de transporte y la membrana celular se fusionan (reciclado de membrana}.

Feseta recubierta de clatrina

Receptor Clatrina

41,' ,, ~

La vesícula de transporte con sus receptores se desplaza hacia la membrana celular.

-'

La vesícula se desprende de su cubierta de clatrina.

Los receptores

Hacia un lisosorna o hacia el complejo de Golgi

y los ligandos se separan.

Los ligandos se dirigen a lisosomas o al Golgi para su procesamiento.

la de clalrina, la membrana se pliega hacia adentro o se invagina @; luego, se separa de la membrana cel ular y se convierte en una vesícula cito plasmática. Las moléculas de daLrina son liberadas y regresan a la membrana @ . En la vesícul a, el receptor y el ligando se separan, quedando el ligando dentro de un endosomn @ . Este se mueve hacia un lisosoma si el ligan do debe ser destruido, o hacia el complejo de Golgi si el Jjgando debe ser procesado ® . Mientras tanto, los receptores de membra na pueden ser reutili2-ados gracias a un proceso conocido como reciclado de meml>rana. La vesícula con los receptores se desplaza hacia la membrana celula r (J) y se fusiona con ella @. Luego, la membrana de la vesícula se incorpora nuevamente a la membrana celuhtr por exoci tosis ®. Nótese, en

1S6

Endocitosis

Endosoma Uquido intracelular

1~ Eig,m1 5- 19. que el lado citoplasmático de la membrana permanece en contacto con el interio r celular a lo largo de Lodo el proceso de endocitos is y de reciclado. La superficie extracelu la r de la membrana celular íorma la superficie in terna de la membrana de la vesícula. La endocitosis mediada por recepto r Lranspo rta una variedad de sustancias den tro de la célula, incluyendo hormonas proteicas, facto res de crecim iento, anticuerpos y proteínas plasmáLicas que actúan como transportadores de h ierro y colesterol. Los niveles elevados de colesterol plasmático y la enfermedad cardiovascular están asociados a anormalidades en la el iminación del colesterol med iada po r recepto r de la sangre (véase el recuadro Aplicación clínica LiLulado "LDL: la lipopro teína letal" ).

LDL: la lipoproteína letal "¡limite la cantidad de colesterol en su dieta!" ha sido la recomendación por muchos años. ¿Por qué mucho colesterol resulta malo para la sa lud? Después de todo, las moléculas de colesterol son esenciales para la estructura de la membrana y para la síntesis de hormonas esteroideas (como las hormonas sexuales). Sin embargo, también es cierto q ue nive les elevados de colesterol en la sangre conducen a e nfermedades cardiovasculares. Una razón por la cual algu nas personas tienen demasiado colesterol en su sangre (hipercolesterolemia) no es la dieta, sino un problema en la captación celular de colesterol. En la sangre, el colesterol hidrófobo se transporta unido a una molécula de lipoproteína para hacerse hidrosoluble. El transportador más común es la lipoproteína de baja densidad (LDL, por sus siglas e n inglés). Cuando el complejo LDL-colesterol (LDL-C) se une a receptores de LDL en caveolas puede penetrar en la célula mediante el uso de una vesícula. Cuando una persona no posee una cantidad adecuada de receptores de LDL en sus membranas celulares, el LDL·C permanece en la sa ngre. l a hipercolesterolemia debida a altos niveles de LDL-C predispone a las personas a desarrollar ateroesclerosis, e l endurecimiento de las arterias {atheroma, tumor, + skleros, du ro,+ -sis, condición). En este trastorno, la acumulación de colesterol e n los vasos sa nguíneos obstruye el flujo sanguíneo y contribuye a que se produzca n ataq ues cardíacos.

moléculas lipófobas, como las proteínas sintetizadas en la célula, y para deshacerse de los desechos que quedan en los lisosomas tras la digestión intracelular. El proceso por el cual la célula y las vesículas de membrana se fusionan es similar en distintos tipos celulares, desde neuronas hasta células endocrinas. La exocitosis involucra dos familias de proteínas: las Rabs, que ayudan a las vesiculas a anclarse a la membrana, y las SNAREs, que facilitan su fusión con la membrana. En la exocitosis regulada, el proceso habitualmente comienza con un aumento de la concenLración intracelular de Ca 2• que actúa como una señal. El Ca'· intente• túa con una proteí.na sensible a su concentración, la cual, a su vez, promueve el anclaje y la fusión de la vesícula secretora. Cuando el área de membrana fusionada se abre, los contenidos de la vesícula difunden hacia el líquido exLracelLJ ar mientras que la membrana de la vesícula queda atrás y pasa a formru· parte de la membrana celular. La exocitosis, al igual que la endocitosis, requiere energía en forma de ATP. la exocitosis tie ne lugar continuamen te en algunas células, lo que la conviene en un proceso co11sfituti110. Por ejemplo, las células caliciales del intest ino liberan constantemente moco por exocitos is y los fibroblastos del tejido conectivo liberan coh\geno. En otros tipos celulares, la exocitos is es un proceso inte rmitente desencadenado por una señal. En muchas células endocrinas, las hormonas son almacenadas en vesículas secretoras en el citoplasma y liberadas en respuesta a una seflal proveniente del exterior celular. Las células también utiliwn la exocitosis para insertar proteínas en la membrana celular, como se muestra en la Figura 5- 19. Usted irá encont rando muchos ejemplos de exocitosis en su estudio de la fisiología. Revisión

27. ¿Enqué se distingue la fagocitosisde la endocitosis? 28. Nombre las dosfamilias de proteínas demembrana asedadas a la endocitosís.

Cnveohis Algunas endocitosis utilizan unas pequeñas hendiduras en fonna de matraz denominadas caveofas ("cuevas pequeñas") en lugar de fosetas recubiertas de dalrina para concentrar moléculas un idas a recepLOr e incorpo rarlas a la célula. Las caveolas son regiones de la membrana con balsas lipídicas, receptores proteicos de membrana y, habitualmente., una cub ierta de proteí.nas llamadas caveolinas. Los recepto res en las caveolas son proteínas ancladas a lípidos. En m uchas células, las caveolas aparecen como pequeñas depresiones de la mem brana celular, de allí su nombre. Las caveolas tienen muchas funciones: concentra r e interiorizar pequeñas moléculas, arudar en la transferencia de macromoléculas a través del endotelio capi lar}' participar en la seüalizaci1Sn celular. Las caveolas parecen estar involucradas en algunas enfermedades, incluyendo infecciones virales y parasitarias. Dos formas de la distrofia muscular están asociadas a anormal idades en la caveolina. Actualmente, los científicos están intentando descubrir más detalles sobre el papel de las caveolas en la fis iología normal y en la úsiopatología.

La exocitosis libera moléculas demasiado grandes para las proteínas transportadoras La exocitosis es lo opuesto de la endocitosis. En la exocitosis, vesículas intracelulares se mueven hacia la membrana celular, se fusionan con ella ( Fig. 5- l 9 @) y, luego, liberan Hts contenidos hacia el líquido extracelular ®. Las células utilizan la exocitosis para expo rtar grandes

29. ¿Cómo hacen las células para introducir proteínasgrande-; ensu citoplasma? ¡Ypara expulsarlas?

Transporte transepitelial Todos los procesos de transpor te descritos en las secciones previas se encargan del desplazamien to de moléculas a través de una (tnica membrana, la de la cél ula. Sin embargo, las moléculas que entran y sa.len del cuerpo o q ue se mueven entre ciertos compartimentos den tro del cuerpo deben atravesar tu1a capa de células epiteliales que est,\n conectadas entre sí mediante uniones adheren tes y un iones estrechas. las uniones estrechas de los epitelios separan la membrana celular en dos regiones o polos. La superficie de la célula epitelial en con tacto con la luz de un órgano se llama membrana apical (apex, el punto m,\s alto) <• Fil!. 5- 20). Frecuentemente está plegada, formando microvellosidades que aumentan su área superficial. Por debajo de las uniones estrechas, las tres superficies de la célula en contaclO con el líquido exlracelular constituyen colectivamente la membrana basolnteml (basal, base, + 111111s, lado). La membrana apical también se llama membrana mucosa. El término correspondiente parn la mem brana basolateral es membrana serosa. Se d ice que las células de los epitelios de transporte están polarizadas debido a q ue su.~ membranas apical y basolateral tienen propie-

A

Luz intestinal o renal

• • •• • 1~ 111\ V

La membrana apical con microvellosidades ----¡r-r-~ u• se enfrenta a la luz.

La unión estrecha limita el desplazamiento de sustancias entre las células. Proteínas transporta- -----< doras La membrana basolateral se e nfrenta al LEC.

••

• • • • ,J Célula de un epitelio de transporte

4

4

1----+T ___

Secreción Absorción (transcelular)

1- -+- - -+ - - - Absorción (paraoelular)

---,\

• •

• • • • • Uquido extrace/ular

• •

Los epitelios polarizados tienen diferentes proteínas t ransportadoras en sus membranas apical y basolateral . Esto permite un transporte direccional selectivo a través del epitelio. El transporte desde la luz hacia el LEC se llama absorción. El transporte en sentido inverso se llama secreción. • FIGURA 5-20 Células polarizadas de los epitelios de transporte. La membrana apical y la membrana basolateral

forman los dos polos de la célula.

dades diferentes. Ciertas proteínas de transporte, como la Na~-K+ATPasa, habitualmente se encuentran solo en la membrana basolaleral. Otras, como el simportador Na·-gl ucosa (SGLT), están localizadas de manera restringida en la membrana apical. Esta distr ibución polarizada de transportadores perm ite el movimiento de ciertas moléculas en una sola dirección a través del epitelio. El transporte de sustancias desde la luz de un ó rgano hacia el líquido ext racelular se llama absorción (Fig. 5-20); por ejemplo, el epitel io intestinal absorbe los nutrientes digeridos. Cuando las sustancias se movilizan desde el LEC hacia la luz, el proceso se llama secreción; por ejemplo, las glándulas salivales secretan saliva que ª)'uda a humedecer el alimen to ingerido. Nótese que el término secreci6n también se utiliza más ampliamente para referirse a la l iberación de una sustancia desde una célula.

El transporte transepitelial puede ser paracelular otranscelular

La prueba del sudor que se le rea lizará a Da niel determina los nive les de NaCI en e l sudor. El sudor (una mezcla de iones y agua) es secretado dentro de los conductos sudoríparos por las células epiteliales de las glándulas sudoríparas. A medida que el sudor fluye hacia la superficie de la piel a través de los conductos, los canales CFTR y de Na· transportan e l· y Na· dentro y fuera del cue rpo. Esta parte del epitel io de las glándulas sudoríparas no es permeable al agua, por lo q ue la reabsorción norma l de NaCI forma sudor con poco contenido de sal. Sin embargo, en ausencia de CFTR, la sal no se reabsorbe. 'Normalmente, e l sudor contiene al rededor de 120 milimoles de sal por litro·, dice Beryl Rosenstein, doctora en Medicina del Centro de Fibrosis Quística del Instituto Médico Johns Hopkins. ' En la fibrosis q uística, las concentraciones de sal en el sudor pueden estar aum entadas hasta cuatro veces con respecto al valor normal: P3:

El movimiento a través de un epi telio o transporte transepitelial puede ocurrir como transporte paracelular (pam, al lado), atrave$ando de las un iones entre células adyacentes, o como transporte transcelular, directamente a través de las células epiteliales {Fjg S- 20). En los epitelios "estrechos': las uniones célula-célula actúan como barreras que minimizan la difusión no regulada de sustancias entre las células, por lo que el transporte paracelular es mínimo. Sin embargo, últimamente los cien tíficos han descub ierto que algunos epitelios tienen la capacidad de modificar la "estrechez" de sus un io nes. Parece que algunas proteínas de un ión, como las daudim:is, pueden formar grandes o rificios o poros que permiten el paso del agua, iones y algLL· nos pequeños solutos si n carga por la vía paracelular. En ciertos estados patológicos, el movim iento aumentado a través de la ruta paracelular constituye una característica distintiva de la enfermedad.

Basándose en la información dada, ¿el CFTR se encue ntra en la superficie ap ical o en la superficie basolatera l del epitel io de las glándulas sudoríparas?

130

141

148 •

161

168

Por el contrario, las sustancias que se des plazan por la vía transcelular deben cruzar dos membranas celulares. Las mo léculas atraviesan la primera membrana al incorporarse al in terior de la célula epitelial desde un compartimento; luego, cruzan la segunda membrana al sal ir de la célula epitelial para entrar en el segundo compartimen -

to. El transporte Lranscelular utiliza una combinación de mecanismos de transporte activo y pas ivo. El transporte transcelttlar med iado por proteínas es habitualmente un proceso de dos pasos, uno "cuesta arriba': que requiere energía,)' otro "cuesta abajo': en el cual la molfrula se desplaza pasivamente a favor de su gradiente. Usted comprobará estos pasos en el ejemplo del transporte de gl ucosa que describiremos a continuación. Las moléculas demasiado grandes para ser transportadas mediante proteínas de membrana pueden hacerlo a través de la célula en forma de vesículas. Las célu las de los epitelios de transporte pueden modificar su permeabilidad insertando o el im inan do proteínas de membrana de una forma selectiva. Los transportadores eliminados de la membrana pueden ser destruidos en lisosomas o almacenados en vesículas dentro de la célula, listos para ser reinsertados en la membrana en respuesta a una señal (otro ejemplo de reciclado de membrana). La mayo r parte del transporte transepitel ial que usted estudiará en este libro corresponde los ep itelios de transporte del in testino y del riñón, que se especializan en el transporte selectivo de moléculas dentro y fuera del cuerpo.

El transporte transcelular de glucosa utiliza proteínas de membrana La absorción de glucosa desde la luz del túbulo renal o del intestino hacia el líquido extracelular es un ejemplo importante de desplaza-

Luz renal

Baja [glucosa) ~

o intestinal

r

Membrana apical

Na"

m iento direccional a través de un epitelio de transpo rte. El transporte transepitelial de glucosa invol ucra tres sistemas de transporte: el transporte activo secundario de glucosa y Na· , mediado por el transportador SGLT ubicado en la membrana apical, desde la luz hacia adentro de la cél ula, seguido del desplazamiento de Na~ y glucosa fuera de la célula hacia el liq uido extracelular mediante transportadores d iferentes. El sod io sale por transporte activo prima rio a través de una Na--K--ATPasa, y la glucosa lo hace por difusión facilitada a Lravés de transportado res e; LUT. La a Figura 5-2 1 muestra el proceso detalladamente. La concentración de glucosa dentro de la célula epi telial transportadora es más alta que la concen trac ión tanto en el líquido extracelular como en la luz renal o intestinal. Por esta razón, el desplazam iento de la glucosa desde la luz hacia dentro la cél ula requiere el aporte de energía (en este caso, se utiliza la energía almacenada en el gradiente de concen tración del Na+). Los iones sodio de la luz se unen al transportador SGLT, como se describió prev iamente (véase la Fig. 5- 16), y trasladan la glucosa dentro de la céluht. l a energía necesaria para desplazar la glucosa en contra de su grad iente de concentración proviene de la energía cinética del movimiento del Na· a favor de su gradiente de concentración (Ejg 5-? 1 CD). Una vez que la glucosa está dentro de la célula ep itel ial, la abandona desplazándose a favor de su gradiente de concen tración po r d ifusión facilitada a través del transpo rtado r GLUT ubicado en la membrana basolateral ( Fi g. 5-21 @). El Na- es bombeado fuera de la célula hacia el lado basolateral po r medio de la :--ia•- K"-ATPasa @.

Alta [Na+] El simportador Na+-glucosa introduce glucosa a la célula en contra de su gradiente de concentración utilizando la energía almacenada en el gradiente de concentración del Na+.

o

t

Alta [glucosa)

@

Na+ Baja [Na+)

Célula epitelial

El transportador GLUT transfiere glucosa hacia el LEC por difusión facilitada.

La Na+-K+·ATPasa bombea Na+ fuera de la célula, manteniendo una baja concentración de Na+ en el LIC.

Membrana basolateral

!'

o f)

Liquido exrrace/u/ar

Baja [glucosa) ~

Alt a (Na+]

N• +

• FIGURA 5-21 Transporte transepitelial de glucosa. Este proceso incl uye e l trans-

porte activo indirecto (secunda rio) de glucosa a través de la memb rana apical y a la difusió n de g lucosa a través de la membrana basolate ral.

• Una cada transportador con su ubicación. 1. GLUT (a) membrana apical 2. simportador (b) membrana basolateral Na+-glucosa 3. Na+- K+-ATPasa • El movimiento de glucosa a través de la mem brana basolatera~ ¿es activo o pasivo? ExpliquE • ¿Por qué el desplazamiento de Na+ en la m embrana apical requiere ATP?

Este paso requ iere ene rgía swninistrada por el ATP, ya que el soclio está más concenlrado en el líq uido exlracelula r que den tro de la célula. La el im inación del Na- de la célula resulta esencial s i la glucosa debe conti nuar absorbiéndose desde la l uz. La energía po tencial pa.ra hacer funcionar el simportado r SGLT proviene del grad ien te de concentración del sod io, el cua l depende de la baja concentración intracelular de Na-. Si la Na•- K+·ATPasa es inl1ib ida con ouabaína (un compuesto relacionado con los medicamentos digitálicos), el Na- que enlra en la célula no puede se r bombeado hacia afuera. La concentració n de Na- dentro de la cél ula au menta gradualmente hasta que iguala la concen tració n en la luz. Si n el gradiente de sodio, no hay fuente de energía para hacer funcionar el simportador SG LT y el movim iento de glucosa a través del epitelio se detiene. El transporte transepitelia l puede utilizar el mov imien to de io nes a través de canales ade rm\s del transpor te mecliado por transportado res. Po r ejemplo, la memb ra na apical de un epitel io de transporte p uede u tilizar el simportador Na-- K--2C]· (NKCC) para incorporar K- en la cél ula en con tra de su gradiente de co ncen tración, utilizando la energía del gradiente de N,i-. Debido a que la concentración de K· dentro de la célula es mayor que en el liquido extracelular, el K" puede desplazarse fuera de la célula por el lado basolateral a través de canales de K' abier tos. El Na- debe ser bombeado hacia a fuera po r la Na+- K•-ATPasa. Mediante este simple mecanismo, el cuerpo puede absorber Na+ y K- al m ismo tiempo desde las luces intestinal o renal.

• • •

rojo

• Proteínas plasmática s \

• •

• Caveolas

• •

Endotelio capilar

O

• • • • • • • . Endooitosis •

. . -~.. l· . .

• •

e:..

'01 Transporte vesicular

·i . e :·.·: • Líq uido intersticial

Exocitosis

Las proteínas Q Las vesículas plasmáticas se atraviesan la célula con ayuda del concentran en las caveolas, las cuales citoesqueleto. se someten al proceso de endocitosis y forman vesículas.

E) Los contenidos vesiculares son liberados en el líquido intersticial por exocitosis.

• FIGURA 5-22 Transcitosis a través del endo telio capilar

Revisión 30. ¿Por qué el movimiento de Na· desde el citoplasma hacia el líquidoextracelular requiere energía? 31. la ouabaína, un inhibidorde laNa" ·K' ·ATPa;a, no puedeatravesar las membranas celulare~ ¡Quéle sucedería altransporte tramepitefialdegluco;a mostrado enlaFigura 5· 21 sise apli· cara ouabaina en el ladoapicaldel epiteüo? ¡Ysi se aplicara sobre el lado basolateral? 32. ¿Qué transportador GLUT~ ilustra enla Figum 5-2F

La transcitosis utiliza vesículas para atravesar un epitelio Algunas moléculas, como las proteínas, son demasiado grande,s para atravesar los epitelios mediante transpo rtadores de membrana. En lugar de eso, son transportadas a lravés de los epitel ios po r medio de la lranscitosis, q ue e$ una combinación enu e endocitosis, transporte vesicular a través de la célula)' exoci tosis {a Fjg 'i -??). En este p roceso, la molécula en tra en la cél ula epitelial por endocitosis mediada por receptor. La vesícula resultante se adhiere a microtúbulos del citoesqueleto celular y se desplaza a través de la célula por un proceso conocido como transporte ,•es icular. En el lado opuesto del epitelio, los contenidos de la vesícula son expulsados hacia el líq uido intersticial por exoci tos is. La tra nscitosis hace posible el mov imiento de proteínas gran des a lravés de un epi telio, manten iéndolas intactas. Este es el medio por el cual los niños pequeños absorben los an ticuerpos presen tes en la lech e materna. Los an ticuerpos se abso rben en la superfic ie

apica l del epitelio in testinal y, luego, son liberados h acia el liqu ido extracelu lar.

Revisión 33. Si se aplica un venenoque desenszmbla los microtúbulos de una célula de endotelio capilar, ¿qué lesucede a la transcitosis?

Ah ora que hemos analizado cómo se mueven los solutos a través de los compartimentos corporales, exami naremos cómo el lranspor· le de io nes genera un desequi lib rio en lre los compartimentos intracelular y extracelular.

El potencial de membrana de reposo Muchos de los solutos cor porales, incluyendo compuestos orgánicos como el piruva10 y el lactato, son iones que poseen carga eléctrica neta. El potasio (K·) es el principal catión intracelular y el sodio (Na+) predom ina en el líqtúdo extracelular ( véase la Fig. 5- l ). En cuan lo a los an iones, los iones cloruro (CI- J permanecen principalmen te en el líquido exlracelular junto con el Na-. Los iones fosfato y las proteínas cargadas negat ivamen te son los anio nes p rincipales del líquido intracelular.

El potencial de membrana de reposo

Tres días d espués d e la prueba d el sudor d e Daniel, el informe de laboratorio muestra resultad os desale ntad o res: los niveles d e sal en su sud or se han incre mentado más d e d os veces por encima de la concentración no rma l. Se le diagnostica a Dan iel una fibrosis quística. Entonces, junto con los antibióticos pa ra evitar infeccio nes p ulmonares y la terapia para fl uidificar el moco d e sus vías aéreas, Daniel debe comenzar un régimen de enzimas pa ncreáticas, q ue d ebe to mar cad a vez q ue coma, por e l resto de su vid a. En la fibrosis q uística, el moco espeso de los conductos pa ncreáticos bloq uea la secreción d e e nzimas d igestivas d entro d el intesti no. Sin las enzimas artificiales, Daniel mo riría por ina nición. P4: ¿Por q ué ocurriría esto si Da niel no tomara las enzimas pancreát icas?

men te ubicado dentro de un io n negativo. Por ejemplo, cuando el Nase incorpora al cuerpo en forma de NaCI, el electrón "faltan te" del Na· se puede encon trar en el Cl·. Recuerde los siguien tes principios impo rtantes sobre la electricidad de los sistemas fisiológicos:

2

3

-+ 130

141

148

158 •

168

161

La ley de la conser vación de la carga eléctrica establece que la cantidad neta de carga eléctrica producida en cualqu ier proceso es igual a cero. Esto significa que por cada carga positiva en un ion hay un electrón en o tro ion. En su totalidad, el cuerpo humano es eléctricamen te neutro. Las cargas opuestas (+y-) se atraen entre sí, pero dos cargas del mismo tipo (+y + o - y-) se repelen. Los protones y los electrones en un ,\tomo muestran esta atracción. Separar las ca rgas positivas de las negativas requiere energía. Po r ejemplo, se necesita ene rgía para separar los p rotones y los elec trones de un átomo. Cuando las ca rgas positiva y negativa sepa radas p ueden moverse libremente una hacia la o tra, el material por el cual se desplazan se denom ina conductor. El agua es un buen conductor de cargas eléctricas. Cuando las cargas separadas no pueden moverse por el material que las separa, este se denomina a islante. La bicapa fosfolipidica de la membrana celular es un b uen a islan te, al igual que el revestim ien to plástico de los cables eléctricos.

Sin embargo, el compartimen to intracel ular no es eléctricamente neutro: hay algunas pro teínas anión icas dentro de la célula que no cuentan con catio nes q ue las contrarresten eléctricamente, lo que hace que las cél ulas tengan una carga neta negativa. Al mismo tiem po, el compartimen to extracel ular tiene una carga neta positiva: algunos cationes del liquido extracelula r no cuentan con sus an iones correspondientes. Una consecuencia de esta d istribución desigual de iones supone q ue los compa.rtimentos intracelular y extracelular no se encuentren en equ ilibrio eléctrico. En lugar de eso, los dos comparti-

La palabra eleltricidad proviene del griego e/e.ctrum, que signifi ca 'ámbar; la resina fosi lizada de los árboles. Los griegos descubrieron que frotando una vari.Ila de ámbar contra un pedazo de tela, aquella adquiría la capacidad de atraer cabellos y polvo. F.sta atracción (llamada electricidad estática) surge de la separación de las cargas eléc-

nos cauones ue1 11qu1uo exLract:"1urn r no cut'nLan con sus an 1one~

ca amuar, ta resina 1us111zaua ue tos arou1es. Los gnegu~ uescuune ron

correspondientes. Una consecuencia de esta d istribución desigual de iones supone q ue los compa.rtimentos intracelular y extracelular no se encuentren en equ ilibrio eléctrico. En lugar de eso, los dos compartimen tos se encuentran en un e$tado de desequilibrio eléctrico. El concepto de desequilibrio eléctrico ha sido tradicionalmen te estudiado en los capítulos sobre la función nerviosa y muscular debido a que esos tejidos generan señales eléctricas conocidas corno potenciales de acción. Si n embargo, uno de los descubrimientos recientes más asombrosos en fisiología es que o tros tipos celulares también uti lizan seña les eléct ricas para la com u nicación. De hecho, ¡todos los o rganismos vivos, incluyendo las plantas, ut il iza n señales e léct ricas! En es ta se cc ión repasa remos los princ ip ios básicos de la elect ric idad )' analizaremos cómo se genera el desequ il ibrio eléct rico del cuerpo. Final izaremos el capít ulo est udia ndo cómo las célu las panc reáticas beta ut il izan los cambios en la d istr ib uc ión de iones a través de las memb ranas ce lu lares para desencadenar la secreción de insulina.

que frotando una vari.Ila de ámbar contra un pedazo de tela, aquella adquiría la capacidad de atraer cabellos y polvo. F.sta atracción (llamada electricidad estática) surge de la separación de las cargas eléctricas q ue se produce cuando los electrones se desplazan desde los átomos del ámb,tr de la varilla hac ia la tela. Para separar las partículas con ca rga se debe aportar energía (trabajo) al sistema. En el ejemplo anterior, se hace trabajo al frota r la varilla. En el caso de los sistemas biológicos, la energía es aportada habitualmen te por el AT P y o tros enlaces químicos.

Repaso sobre laelectricidad Los átomos son eléctricamente neutros. Están compuestos por p rotones con carga positiva, electrones con carga negativa )' neutro nes s in carga, pero en proporciones balanceadas, por lo que un átomo no es posi tivo n i negativo. La el iminación o adición de electrones a un átomo genera las partículas cargadas que conocemos como iones. Hemos anal i:1.ado muchos iones importan tes para el cuerpo humano, tales como Na+, K· y H · . Para cada uno de estos iones positivos existe un electrón co rrespondiente en algún lugar del cuerpo, habitual-

la membrana celular permite la separación de las cargas eléctricas en el cuerpo En el cuerpo, la separación de las cargas eléctricas tiene lugar a ambos lados de la membrana celular. Este proceso se muestra en la • Figura 5-23. El d iagrama muestra una célula artificial llena de moléculas q ue se d isocian en iones positivos y negativos, rep resentados por los signos más y menos. Debido a que estas mo léculas eran eléctricamen te neuLras al in icio, hay un mimero igual de iones positivos y negativos dentro de la célula. Esta se encuentra en una solución acuosa, tamb ién eléctricamente neutra, que con tiene los m ismos cationes)' aniones. La bicapa fosfol ipídica de la cél ula artificial, al igual que la bicapa de una célula real, no es permeable a los iones. En la Figura 5-23a, el sistema se encuentra en equilib rio químico y elénrico. En la Figura 5-23b, un transportador activo se inserta en la membrana. El transpo rtador uti liza energía para movilizar iones positivos hacia fuera de la célula en contra de su grad ien te de concentració n. los iones negativos dentro de la célula in ten tan seguirlos debido

(a) La célula y la solución están en equilibrio eléctrico y químico.

(b) La energía es utilizada para bombear un catión fuera de la célula, generando una carga neta de -1 dentro de la célula y de +1 fuera de ella. La célula y la solución están entonces en desequilibrio químico y eléctrico.

G 0

La membrana celular actúa como un aislante que evita el líbre movimiento de iones entre los compartimentos intra y extracelular. +

G

+

+

..

+

+

G

+

Liquido intracelular

t

(c) En una escala absoluta, el líquido intracelular (LIC) se ubicaría en -1 y el extracelular (LEC), en+1.

-2

Sin embargo, las mediciones fisiológicas siempre se realizan en una escala relativa, en la cual al líquido extracelular se le asigna un valor de O. Esto desplaza la escala hacia la izquierda y da un valor de carga relativa en el interior celular de-2.

,, ,,

,-1

,, ,, Liquido intracelular

+1

+2

+1

+2

,,

Liquido éxtracelular

t

1

-2

o

,, Escala de carga , , , , absoluta , , ,

f -1

o

Escala de carga relativa: el líquido extracelular se establece en O (condición de base).

(d) En el laboratorio, el potencial de membrana de una célula se mide colocando un electrodo dentro de la célula y un segundo electrodo en el líquido extracelular. Un electrodo _______, de registro se coloca dentro de la célula.

Liquido extracelular

,L.=======:::;i

,,----,,--__::_::_::_:_---,~--~-Entrada ~\~O~~~ ': -:J_J ::-::--

.30

u -_,_-.,_

8 voltímetro mide la diferencia de cargas eléctricas entre elseinterior celular y la solución en laesque la célula encuentra inmersa. Este valor la diferencia de potencial de membrana o Vm.

Salida

r-----1-1- La toma de tierra, o electrodo de referencia, se coloca en el baño y se le asigna el valor Baño salino ._ de O milivoltios (m\/)

____________

_,

El potencial de membrana puede variar con el tiempo.

• FIGURA 5-23 Separación de las cargas eléctricas: la diferencia de potencial de la membrana

a la atracción existente entre las cargas. Pero, debido a que la membra na es impermeable a los iones negativos, permanecen atrapados dentro de la célula. Los iones positivos fuera de la célula pueden intentar en trar en el in ter ior de la célula, atraídos por la carga neta negativa del líquido intrace lular, pero la membrana no se los permite. Desde el momento en que el primer ion positivo sale de la célula, el equilib rio eléctrico entre los líquidos extracelular e intracelular se altera: el interior celular ha desarrollado una carga neta de -1,

mientras que el exterior tiene una carga neta de + J. El aporte de energía para el transpone de iones a través de la membrana ha generado w1 gradiente eléctrico; es decir, una diferencia en la carga neta entre dos regiones. En este ejemplo, el interior de la célula se vuelve negati vo con respecto al exterior. El transporte activo de iones positivos hacia fuera de la célula también genera un gradiente de concentración: ahora hay más iones positivos fuera de ella que en su interior. La combinación de los gra-

dientes eléctrico y químico se llama gradiente electroqtúmico. La cél ula permanece en equ ilib rio isosmótico, y-a que el agua puede !luir libremente a través de la membrana en respuesta al desplazamiento de los so lutos. El gradiente eléctrico entre los Líquidos intracelular)' extracelular se conoce como diferencia de potencial de membrana de reposo o, simplemente, potencial de membrana. Aunque el nombre suena inlimidante, podemos analizarlo por partes para entender su significado. l

2

3

La palabra reposo se refiere al hecho de que este gradiente eléctrico ocurre en todas las cél ulas vivas, indtL~O en las que parecen no tener actividad eléctrica. En estas células en "reposo", el potencial de membrana ha alcanzado un estado estacionario )' no es cambiante. La palabra potencial se refiere al hecho de q ue el gradiente eléctrico generado por el transporte activo de iones a través de la membrana celular es ttna fo rma de ene rgía almacenada, o poten cial, al igual que los gradientes de concen trac ión. Cuando las moléculas con cargas opuestas se vuelven a unir, liberan energía q ue puede ser utilizada para realizar trabajo, de la misma manera en que las moléculas que íl uyen a favor de sus gradientes de concentración pueden realizar trabajo. El trabajo real izado a partir de la energía eléctrica incluye la apertura de canales de membrana regulados por voltaje y el envío de señales eléctricas. La palabra diferencia nos recuerda que el potential de membrana representa una diferencia en la ca ntidad de cargas eléctricas entre el interior y el exterior celular. Po r lo general, no se utiliza esta palabra al nombrar el potencial de membrana.

En los sistemas vivos, medimos los gradien tes eléctricos en una escala relativa en lugar de utilizar ttna escala absoluta. La Figura 5-23c compara ambas escalas. En la absol uta, el líquido e.xtracelular de nuestro ejemplo tiene una carga neta de+ 1 debido al ion positivo que ganó, y el líquido intracelular tiene una carga neta de - 1 debido a la carga negativa no apareada que q uedó dentro de la célula. Sin embargo, en la vida real no podemos medir la carga eléct rica como el número de electrones ganados o perdidos. En lugar de eso, utilizamos tlíl d ispos itivo que mide la diferencia de las cargas eléCLricas entre los dos puntos. Este dispositivo establece artificialmente que la ca rga neta de uno de los lados de la membrana es igual a cero y mide la carga neta del segundo lado con respecto al primero. En nuestro ejemplo, llevando la carga neta del líquido extracelular a O, obtenemos q ue la carga del líquido intracelular es igual a - 2; éste es el valor que llamamos potencial de membrana de reposo. El equ ipamiento utilizado para medi r el po tencial de membrana de una célula se ilustra en la Figura 5-23. Los electrodos están formados por tubos huecos de vidrio que terminan en puntas m uy fi nas. Estas micropipetas están llenas de ttn líquido que conduce la electricidad y se encuentran co nectadas a un voltímetro, que mide la diferen cia eléctrica en tre dos p untos en voltios (V) o en mil ivoltios (mV). Un electrodo de registro se inserta en el citoplasma celular a través de la membrana. Un electrodo de referencia se coloca en el baño externo, q ue representa el líquido extracelular. En los sistemas vivos, por convención, el líquido extracelula r se designa como la tierra y se le asigna una carga de O mV (fjg 5-Z}r ).

Cuando el electrodo de registro se coloca den tro de la célula viva, el voltímetro mide el potencial de membrana; en otras palabras, la diferencia eléctrica entre los líquidos intracelular y extrac.el ular. Un grabador conectado al voltímetro puede registrar el potencial de membrana en función del tiempo. Para las cél ulas nerviosas y musculares, el voltímetro mide un potencial de membrana de reposo de entre -40 y-90 mV, indicando que el líquido intrace lular es negativo con respecto al líquido extracelular t0 mV). ( Recuerde que el líquido extracel ular no es verdaderamente neutro, ya q ue tiene tlíl exceso de cargas pos itivas que se con trarrestan exactamente con el exceso de cargas negativas dentro de la célula, como se muestra en la Eig11rn 5-23c. El cuerpo en su totalidad permanece eléctr icamente neutro en todo momento. )

El potencial de membrana de reposo se debe principalmente al potasio ¿Qué iones generan el po tencial de membrana de reposo en las células a nimales? La célula artiíicial mostrada en la Figura 5-23b u til iza un transportador activo para movilizar u n ion pos itivo inespecífico a través de una membrana impermeable a los iones, pero ¿qué procesos ocur ren en las células vivas para generar un gradiente eléctrico? Las células reales no son completamente impermeables a todos los iones. Cuentan con canales abiertos )' proteínas transportado ras que perm iten el desplazamiento de iones en tre el citoplasma )' el líquido extracel ular. Podernos utilizar una célula artificial d iJerente pa ra mostrar cómo surge el potencial de membrana de reposo en una célula típica. La célula a rtificial de la • Figura 5- 24 tiene una memb rana que es impermeable a los iones. La cél ula contiene K- y grandes proteínas con cargas negativas, represen tadas como Pr-. Esta célula se coloca en una solución de Na- y CI·. Tanto ella como la solución son eléctricamen te neutras, y el sistema se encuentra en equilibrio eléctrico. .Sin embargo, no hay un equil ibr io quím ico. Hay gradientes de concentración para los cuatro tipos de iones de este sistema, y todos ellos llui rían a favo r de sus gradientes de concentración si pudiesen atravesar la membrana celula r. En la Figura S-24b se inserta un ,anal de K~ en la membrana, haciéndola permeable solo al K· . Debido a que inicialmente noJ1ay K· extracelula1·, parte del K· sa le de la célula mov iéndose a favor de su gradiente de concentración. A medida que el K + abandona la célula, las pro teínas con cargas negativas (Pr·) son incapaces de segui rlo debido a que la membrana es impermeable a ellas. Gradualmente, las proteínas generan una carga negativa en el interior cel ular a medida que más y más KTsale de la cél ula. .Si la única fuerza actua ndo sobre el K- fuese su gradiente de concentración, el K- saldría de la célula hasta que sus concen traciones intracelular y extracelular fuesen iguales. Sin embargo, la pérdida de iones positivos po r pa.rte de la célula genera un gradien te eléctrico. Debido a q ue las cargas opuestas se atraen entre sí, las proteínas negativas den tro de la célula intentan atraer el K· nuevamente hacia el interior celular. En algún momento de este proceso, la iuerza eléctrica que atrae el K- iguala en magni tud el gradiente de concentración q uímico que impulsa al K- a salir de la célula. En ese momento, el movim iento neto de KT a través de la membrana se

(a) Una célula artificial cuya membrana es impermeable a los iones contiene K+ y grandes proteínas aniónicas. Se la coloca en una solución de Na+ y CI-. Tanto la célula como la solución son eléctricamente neutras.

Célula artificial

@ Se inserta un canal de K+ en la membrana. Canal de K' (b) El K+ sale de la célula debido a que hay un gradiente de concentración. Na•

-

~

Na·

º

Escriba en los cuadrados blancos la carga eléctrica neta de los compartimentos intracelular y extracelular como se muestra en la figura siguiente.

~D , c 1· Na~

Na•

(c1-

(._C'J

(c) El potencial de membrana negativo atrae K+ de vuelta hacia el interior celular. Cuando el gradiente eléctrico contrarresta exactamente el gradiente de concentración del K+, el potencial de reposo de la membrana es el potencial de equilibrio del K +.

PREGUNTA

~

Na• Gradiente de fc1concentración' Gradiente eléctrico

º Na·

0~ B Na·

Na~

r-

~ Ahora reemplazamos el canal de K+ por un canal de Na+. Potencial de equilibno del Na+ (ENal : +60 mV. (d) El gradiente de concentración de Na+ en esta célula artificial es contrarrestado exactamente por un potencial de membrana de +60 mV. - -- - 150mM

- -- - omv

• FIGURA 5-24 Potenciales de equilibrio. El potencial de equilibrio de un ion, o E;.,0 , es el potencial

de membrana en el cual los gradi entes químico y eléctrico son de igual magnitud y tienen sentidos o puestos. Una célula que alcanza el E.,on no tiene flujo neto de iones a t ravés de su m embrana.

PREGUNTA ¿Por qué el Na+, el C, y las proteínas (Pr í no atraviesan la membrana?

detiene (Ejoe 5-?4r). La velocidad a la cual los iones K· salen de la célula a favor de su gradiente de concentración es exactamente igual a la velocidad a la cual los iones K+ penetran a la célula a favor de su gradiente eléctrico. En una célula que solo es permeable a un ion, como la célula artificial recién descrita, el potencial de membrana que contrarresta exactamente al gradiente de concentración del ion se conoce como potencial de equilibrio o E;•• (en el que el subíndice ío11 se reemplaza por el símbolo del ion que se esté analizando). Por ejemplo, cuando el gradiente de concentración para el K- es 150 mM dentro de la célula y 5 mM en el exterior celular, el potencial de equilibrio para el pota sio, o EK' es de - 90 m V. El potencial de equilibrio para cualquier ion a 37 ºC: (temperatura corporal humana) se puede calcular utilizando la ecuación de Nernst:

Las células en reposo son permeables tanto al K+ como al Na+.

Liquido intracelular -70mV

..... Liquido extraoelular OmV

61 ( ion )Jeritio E. = - - loe. - - - ion ..., (' ) z ron Íút1a

G

donde: 6 l es el resultado de 2,303 RT/F a 37 ºC*, z es la carga del ion ( + l para el K+), (ion)

l Capí111lo 8. \ La célula real ilustrada en la • Figura 5-25 tiene un potencial de membrana de reposo de -70 mV. La mayoría de las células son aproximadamente 40 veces más permeables al K- que al Na-. Como resultado, el potencial de membrana de reposo de una célula está más cerca del El< de - 90 m V que del ~ " de +60 m Y. Una pequeña cant idad de Na" difunde hacia dentro de la célula, haciendo el interior celular menos negativo que lo que sería si el Na-

;,; Res la constante de los gases ideales, T es la tempe ratura absoluta y F es la constante

de Faraday. Para información adicional, véase el Apéndice B.

.. •

PREGUNTAS

t ¿Qué fuerza/s provooa/n el movimiento de entrada de Na+ a la célula? t ¿Qué fuerza/s provoca/o la salida de K+ de la célula?

• FIGURA 5-25 Potencial de membrana de reposo en una célula

real. La mayoría de las cé lulas d el cuerpo human o son a lrededor de 40 veces más permea bles al K• que al Na•, y e l potencial d e me mbrana d e reposo es cercano a - 70 mV.

fuese totalmente exchLido. El Na+ adicional que entra es rápidamente bombeado hacia afuera por la Na+- K+-ATPasa, como se describió previamente. Al mismo tiempo, los iones K- que salen de la célula son bombeados de vuelta hacia el interior. La bomba contribuye al poten cial de membrana al sacar 3 Na- por c:ada 2 K- que introduce. Debido a que la Na+- K+·ATPasa ayuda a mantener el gradiente eléctrico, tam bién se la llama bomba electrógima. No lodo trnnsporte iónico genera un gradiente eléctrico. Muchos transpo rtadores, como el simporlador Na+- K+-2CJ· ( NKCC), son eléctricamente neutros. Algunos reaüzan un intercambio parejo: por cada carga que entre en la célula, sale la misma carga. Un ejemplo es el antiportador HC:o,--CJ- de los glóbulos rojos, que transporta estos iones uno a uno, de forma eléct ricamente neutra. Los transportadores eléctricamente neutros tienen poco electo sobre el potencial de membrana de reposo de la célula.

Revisión 34. Incorpore un onal decl· enla membrana de la célula artificial de 1, Figura í·24a yirate

de determin.r enquédirección se desplazará el (I· de acuerdo con susgradientes de concentración yeléctrico. ¡El potencial de equilibrio del CI· será negativo o po;itivo? 35. ¡Qué sucedería con el potencial de membrana de reposo de una célula ala que se admi· nistrase ouabaína (un inhibidor de la Na--K··ATPasa)?

Cambios en la permeabilidad a los iones modifican el potencial de membrana Como ha aprendido recientemente, dos facLores iníluyen en el polencial de membrana de u na célula: t l ) los gradienLes de concentración de diferen Les iones a Lravés de la membrana y (2) la permeabilidad de la memb rana a dichos iones. Si la permeabilidad de una célula a un ion cambia, también lo hace el potencial de membrana. Para monitorizar los camb ios en el potencial de membrana utilizamos los mismos electrodos que s irven para registra r el potencial de membrana de reposo ( Fig. 5-23d). La a Figura 5-26 muestra un registro de poLencial de memb rana en función del tiempo. Al elecLrodo extracelular se le asigna un valo r O mV, y el electrodo intracelular registra la diferencia de poLencial de membrana. El poLencial de membrana ( V ) comienza en un '" se mueve hacia valo r estable de reposo de -70 mV. Cuando la línea a rriba (se vuelve menos negativa), la diferencia de potencial ent re el interior celular y el exterior (O mV) d ism inuye, y se dice que la célula se ha despoúirizado. El retorno al valor de potencial de membra na de reposo se denom ina repolarizaci6n. Si el potencial de membrana se vuelve más negativo, la di ferencia de potencial aumenta, y la célula se h a hiperpolarizado. Una fuente importan te de con fusión que surge cuando hablamos sob re los cambios en el potencial de membrana es la utilización de frases como "el potencial de membrana ha d ism inu ido" o "el potencial de membrana ha aumenLado". Normalmente, asociamos la palabra aumento con volverse más positivo y la palabra disminución con volverse más negativo ( que es lo opuesLo a lo que sucede en la cél ula que estamos analizando). Una manera de evitar esLa confusión es aiíadiendo la palabra diferenda al concepLO de potencial de membrana. Si la diferencia de polencial de membrana está en aumento, el valor de v,. se está alejando del valor de referencia de O mV y se está volv iendo más negativo. Si la diferencia de potencial de membra11a está dismim,yendo, el valor de V.,, se está aproximando al valor de O mV y se esLá vo lviendo menos negativo. ;,Qué provoca camb ios en el polencial de membrana? En la mayoría de los casos, el potencial de membrana cambia en respuesta al movimiento de uno de los siguientes cuatro iones: Na•, Ca'·, CI· y

+40~- - - - - - - - - - - - - - - - - - - - - ~

I +20 "'

Diferencia de potencial de membrana (Vm)

o

~

EIVm aumenta

~ -20

~ -40

~

-~ -60 e

., -80

&

-100

Despolarización

Repolarización

Hiperpolarización

-120

Tiempo (ms) • FIGURA 5-26 Terminología referida al potencial de membrana.

Si e l potencial de me mbrana se vuelve menos negativo q ue e l potencial de re poso, la célula se despolari za. Si e l potencial de membrana se vuelve más negativo, la célula se hiperpolariza.

K-. Los primeros Lres están más concen trados en el líquido extracelular que en el citosol, y la cél ula en reposo es muy poco permeable a ellos. Si una célula se vuelve repentinamente más permeable a alguno de esLos iones, ellos se desplazarán a favor de sus grad ientes de concen tración dentro de la célula. La entrada de Ca'+ o de Na• despolariza la célula (hace q ue el potencial de membrana sea más posiLivo). La en trada de CI· hiperpolariza la célula (hace que el potencial de mem brana sea más negat ivo). La mayoría de las células so n muy permeables al K· , pero, si se vuelven aun más permeables, permiten una salida mayo r de K· . La célula se hiper polariza hasta que alcanza el potencial de equilibrio del K-. Si la célula se vuelve menos permeable al K· hay una menor salida del ion de la célula. Cuando la célula retiene al K·, se vuelve más positiva y se despolariza. Usted encon Lranl ejemplos de Lodos estos cambios en la permeabilidad en su estudio de la fisio logía. Es importante saber que un cambio s ignificativo en el polencial de memb rana requiere el fl ujo de muy pocos iones. No es necesario que el gradiente de concentración se invierta para modificar el pote11ci11/ de membmna. Por ejemplo, para lograr un cambio de LOO mV en el potencial de membrana (la magni llld de una señal eléctr ica Lípica que viaja por una neurona) es suficien le con q ue solo uno de cada 100 000 K + peneLre en la célula. ÉsLa es una fracció n Lan pequeña del número toLal de iones K- dentro de la célula que el gradiente de concentración de esLe ion permanece prácticamente igual.

Procesos de membrana integrados: la secreción de insulina Se sabe hace muchos años que el movimienLo de Na· y K· a Lravés de

las mem branas celulares cumple un papel impo rtante en la generación de señales eléctricas en los Lej idos excitables. Usted esLUdiará estos procesos detalladamente cuando analicemos los sistemas nervioso)' muscular. Sin emba rgo, recientemente hemos descubierto que pequeños camb ios en el poLencial de membrana actúan como señales en los tejidos no excitables, La les como las células endocrinas. Uno de los ejemplos mejor esLudiados de este proceso involucra las cél ulas beta del ptíncreas. La liberación de la ho rmona insulina por estas cél ulas demuestra cómo los procesos de membrana (como la difusión facilitada, la exocitosis )' la apertura )' el cierre de canales iónicos med iados por ligandos o por el poLencial de membrana) trabajan en conj unto para regular el funcionamiento celular. Las cél ulas beta del páncreas sintetizan insulina ( LU1a hormona proteica) )' la almacenan en vesículas secreLO ras ci Lop lasmáticas. Cuando los n iveles de glucosa en sangre aumen Lan -po r ejemplo, tras una comida-, las cél ulas beta liberan insulina por exocitosis. La insulina se dirige hacia otras células del cuerpo para favo recer la captación )' la utilización de glucosa, haciendo que la concentración sanguínea de glucosa vuelva a los niveles previos a la ingesla. Una pregun ta clave sob re este proceso, que no tuvo resp uesta hasta hace pocos alios, era: ";,cómo hace una célula beta para 'saber' que los niveles de glucosa han aumenLado )' que es necesar io secretar insulina?''. La respuesla, que ahora conocemos, relaciona el metabolismo de la célula beta con su actividad eléctrica. La • Figura 5- 27a muestra una célula beta en reposo. Recuerde de las secciones anLeriores de este capítulo que los e.anales de membrana tipo compuerta pueden ser abierLos o cerrados por señales q ui-

• FIGURA 5-27 Secreción de insulina y transporte de membrana

(a) Célula beta en reposo. El canal KATP está abierto y la célula presenta un potencial de membrana de reposo.

Bajos niveles de glucosa en sangre.

El metabofismo se lentifica.

La célula presenta un El ATP Los canales disminuye. KATP se abren. potencial de membrana de reposo. No hay liberación de insulina. Canal de ca2+

t Glucosa· ·

- +Metabolismo +ATP

Transportador GLUT

No hay secreción de insulina

Insulina en vesículas .c....---t secretoras

(b) La célula beta secreta insulina. El cierre del canal KATP despolariza a la célula, desencadenando la exocitosis de la insulina. Altos niveles de glucosa en sangre.

lísmo se acelera.

aumenta.

La célula se despola• riza y los canales de calcio se abren.

(b) La célula beta secreta insulina. El cierre del canal KATP despolariza a la célula, desencadenando la exocitos1s de la insulina. Altos niveles de glucosa en sangre.

La célula se despola· riza y los canales de calcio se abren.

I t Glucosa

El movimiento de entrada de ca2+ actúa

--- t Glucólisis y

cíclodel ácido cítrico

Transportador GLUT

•••••• • •• • La señal ••

ºde ca2+

•••• • •desencadena ~a exocitosis y se secreta insulina.

micas o eléctr icas. La cél ula beta tiene dos canales de este tipo que le permiten controlar la liberación de insulina. Uno es un canal de Ca 2• regulado por voltaje. Este canal está cerrado cuando el potencial de membra na está en reposo (® en la Fig. 5-27a) . El o tro es un canal de K· (que se encuen tra habitualmente ab ierto), que se cierra cuando se le une ATP. Se llama canal de K+ regulado por ATP o canal K ATP· En la cél ula en reposo, cuando las concentraciones de glucosa son bajas, la cél ula produce menos ATP O).@. H ay poco ATI' para unirse al canal

KATP' por lo que este permanece ab ierto, permitiendo la sal.ida de K· de la célula ©. Como el potencial de membrana está en reposo, los canales de Ca2 • regulados por voltaje están cerrados y no ha)' secreció n de insul ina ~). La Figura 5-27b muestra una célula beta secreta ndo insulina. Después de una comida, los n iveles de glucosa en plasma aumentan a medida que el carbohidrato se absorbe en el intesli no O)_ La glucosa que llega a la célula beta d ifunde hacia su interio r con la ayuda del

168

Capitulo 5 Dinámica de la membrana

transportador GLUT. El aumento de glucosa dentro de la célul a esti· mula las vías metabólicas de la glucól isis y del cido del ácido cítrico, por lo que se incrementa la producción de ATP ® , ®.Cuando este se une al canal KATI' la compuerta del canal se cierra, evitando la salida de K· de la célula ©. La retención de K· despolariza la célula @, lo que genera a su vez la apertura de los canales de Ca" regulados por voltaje ®. Los iones calcio se mueven hacia el interio r de la célula desde el líquido extracelular a favor de su gradiente de concentración. El Ca'+

se une a proteínas que in ician la exocitosis de las vesículas que contienen la insulina, por lo que esta es liberada hacia el espacio extracelular CD. El descubrimiento de que o tras cél ulas, aparte de las nerviosas y las musculares, utilizan cambios en el potencial de membrana como señales para sus procesos fisiológicos modificó nuestra forma tradicional de pensar sobre el papel del potencial de membrana de reposo. A con tinuación estudiaremos o tros tipos de señales que utiliza el cuerpo para comun ica rse y para coo rd inar sus funciones.

Fibrosis quística En este tema relacionado, usted aprendió algunas cuestiones sobre la fibrosis quística (FQ), una de las enfermedades heredita· rias más com unes en los Estados Unidos. Según algunas estima· ciones, más de 10 mi llones de personas son portadoras asintomá· ticas del gen de la FQ. Una persona debe heredar dos copias del gen - una de cada progenitor- pa ra desarrollar la enfermedad. Aunque no hay una cu ra para la enfermedad, los tratamientos han mejorado y la expectativa de vida de los pacientes con FQ conti· núa aume ntando. Hoy en día, la expectativa media de vida es de alrededor de 37 años. La fibrosis quística es ca usada por un déficit en el canal proteico CFTR, el cual regula el transporte de el· dentro y fuera de las cél u-

las epiteliales. Debido a que los canales CFTR se encuentran e n las membranas de las cél ulas epiteliales de muchos órganos (glándu· las sudoríparas, pulmones y páncreas), la fibrosis quística puede afect ar diversos procesos corporales. Algunos experimentos sobre fibrosis quística con animales utilizan ratones modificados genéti· camente, llamados ratones FQ; estos modelos animales pueden obtenerse con canales CFTR totalmente no funcionales o con canales CFTR con funciones alteradas simi lares a las mutaciones genéticas que se encuentran en los seres humanos. Para conocer más sobre las investigaciones actuales sobre esta e nfermedad, diríjase al sitio web de la Fundación Contra la Fibrosis Quística (www.cff.org)

Pregunta

Hechos

Integración yanálisis

1. ¿Por qué.la dificultad de mover

Si el NaCI es secretado hacia la lu z de las vías aéreas, la concentración de solutos del líquido en ellas aumenta. El ag ua flt1ye hacia los com· partimentos con mayor osmolaridad. ~, el Nall es secretado hacia la lu z de las vias aéreas, la concentración de solutos del líquido en ellas aumenta. El ag ua flt1ye hacia los com· partimentos con mayor osmolaridad.

Normalmente, el movimiento de NaCI crea un gradiente osmótico que hace que el agua tambié n fluya hacia la luz de las vías aéreas, creando una solución sa lina que hace que el Normalmente, el mov1m1e·rito de Nall crea un gradiente osmótico que hace que el agua tambié n fluya hacia la luz de las vías aéreas, creando una solución sa lina que hace que el moco sea menos espeso. Si no se puede ~ecretar NaCI hacia las vías aéreas, no habrá flujo de líquido para diluir el moco.

2. El CFTR, ¿es un canal proteico regulado químicamente, por voltaje o mecánicam ente?

Los canales reg ulados por compuertas se abren cuando un ligando se une a ellos. Los canales regulados por voltaje se abren tras un cambio en el potencial de membrana de la célula. Los canales con compuerta mecánica se abren en respuesta a una fuerza física. El CFTR se abre cuando el ATP se une al canal proteico.

EJ ATP es un ligando q uímico, lo que sig nifica que el CFTR es un canal proteico regulado q uímicamente.

3. Basándose en la información dada, ¿el CFTR se encuentra en la superficie apical o en la superficie ba;olateral del epitelio de las glán· d ulas sudoríparas?

En las personas normales, los canales CFTR movilizan et· desde el sudor hacia el interior de las células epiteliales.

La superficie epitelial en contacto con la luz de las glándulas sudoríparas, la cual contiene sudor, es la membrana apica l. Por lo tanto, la proteína CFTR se encuentra sobre la superfi cie apical.

4. ¿Por qué Daniel moriría de ham·

El páncreas secreta moco y enzimas digestivas dentro de los conductos que se vacían en el intestino delgado. En la fíbrosis quístka, el moco de los conductos es espeso debido a la falta de e l· y de secreción de líquido. Este moco espeso bloquea los conductos y evita que las enzimas digestivas lleguen al intestino delgado.

Sin enzimas digestivas, Daniel no puede digerir los alimentos que come. Su pérdida de peso en los últimos seis meses sugiere que esto ya es un problema: la toma de enzi· mas artificiales le permitirá digerlr su comida.

NaCI dentro de las vías aéreas gene· ra un moco espeso? l. ¿l'or que.la d1t1cultad de mover

NaCI dentro de las vías aéreas gene· ra un moco espeso?

bre si no tomara las enzi mas pancre· áticas ?

133

145

156

161

165 .

Resu men del capítulo

169

Resumen del capítulo Muchos temas importantes se combinan en este capitulo. Usted ha aprendido cómo la membrana celular actúa como una barrera para crear un compartimento intracelular distfato del extracelular (un eiemplo de la c0111parti11Jenració11). Aunque los contenidos de los compartimentos intracelular y extracelular difieren, la homeostasis los mantiene en un estado de equilibrio dinámico. El movimiento de sustancias entre los compar timentos y dentro de ellos es necesario para la c.om1micació11 y se consigue gracias al Jlu,io glabal y al transporte biológico. El flujo de solutos y de agua a

través de las membranas celulares ocurre en respuesta a grndientes osmóticos, qui micos (de concentración ) o eléctricos. La membrana celular selectivamente permeable crea un resistencia al flujo que puede ser superada modificando su composición lipidica o insertando proteínas que actúan como canales o nansportadores. El transporte biológico del cuerpo requiere eriergia de diferentes fuentes: movimiento molecular, gradientes de concentrnción o enlaces químicos. Finalmente, la unión de los sush·atos a los transportadores es un ejemplo de iuteracciones proteicas.

ósmosis y tonicidad

14. La velocidad de difusión depende de la magnitud del gradiente de

líquidos y e lectrolitos: introducción a los fluidos corporales

J. La mayoría de los solutos están concentrados en un compartimento o en el otrn, creando un estado de desequilibrio qtúmico. (p. 131; Fig. 5-1 )

2. Los cationes y los aniones no están distiibuidos equitativamente entre los compartimentos celulares, lo que genera un estado de desequilibrio eléctrico. (p. 130) 3. El agua fluye libremente enh·e el interior celular y el líquido extracelular, lo que resulta en un estado de equilibrio osmótico. (p. 130) 4. El flujo de agua a través de la membrana en respuesta a un gradiente de concentración se llama ósmosis. (p. 132) 5. Para comparar las concentraciones de las soluciones expresamos la concentración en términos de osmolaridad, que se refiere al número de partículas (iones o moléculas intactas) por litro de solución, expresada como milimoles por lino (mOsM ). (p. 133) 6. La tonicidad de una solución describe el cambio del volumen celular que ocurre en el equilibrio si la célula se coloca en die.ha solución. Las células se hinchan en las soluciones hipotónicas y se encogen en las sada como milimoles por lino (mOsM ). (p. 133) 6. La tonicidad de una solución describe el cambio del volumen celular que ocurre en el equilibrio si la célula se coloca en die.ha solución. Las células se hinchan en las soluciones hipotónicas y se encogen en las soluciones hipertónicas. Si el tamaño celular no se modifica en el equilibrio, la solución es isotónfra. (p. 134) 7. La osmolaridad de una solución no puede ser utilizada para determinar la tonicidad de la solución. Las concentraciones relativas de solutos no pene.trantes en la célula y en la solución determinan la tonicidad. Los solutos penetrantes contribuyen a la osmolal'idad de una solución pero no a su tonicidad. (p. 136; fjg 'i-4)

Difusión 8. En las corrientes por convección, un gradiente de presión moviliza un fluido jw1to con sus elementos disueltos y suspendidos. (p. 139) 9. La membrana celular es una barrera selectivamente permeable que restringe el libre intercambio entre la célula y el liquido intersticial. El movimiento de una sustancia a través de la membrana depende de la permeabilidad de esta a dicha sustancia. (p. 1-10) JO. El despla7,amiento de moléculas a través de las membranas se puede clasificar según los requerimientos energéticos o según los medios fisicos que utilizan las moléculas para atravesar la membrana. ( p. 140; fig, 5-51 1J. Las sustancias liposolubles pueden difundir a h·avés de la bicapa fosfolipidica. las moléculas menos liposolubles necesitan la ayuda de una proteina de membrana para atravesar la membrana. (p. 140) 12. El transporte pasivo no requiere el aporte de energía. (p. 140) 13. La difusión es el movimiento pasivo de moléculas a favor de un gradiente quimieo (de concentración) desde un área de mayor concentración hacia un área de menor concenh·ación. El flujo neto se detiene cuando el sistema alcanza el eqtúlibrio. aunque el mov;miento molecular continúa. (p. 143; Cuadro S-6 l

concentración. La difusión es lenta en grandes distancias, está directamente relacionada con la temperatura y es inversamente proporcional al tamaño molecular. (p. 144) 15. La difusión simple a través de una membrana es directamente proporcional al área superficial, al gradiente de concentración y a la permeabilidad de la membrana e inversamente proporcional a su espesor. (p. 144; Fig. 5-7 )

Transporte mediado por proteínas 16. La mayona de las moléculas atraviesan las membranas con ayuda de proteínas de membrana. (p. 14 5) 17. Las proteinas de membrana tienen cuau·o funciones: las proteínas estructurales mantienen la forma celular y crean uniones celulares, las enzimas unidas a la membrana catalizan reacciones quimicas y ayudan en la transferencia de señales a través de la membrana, las proteínas receptoras forman parte del sistema de señalización del cuerpo y las proteínas transportadoras movilizan muchas moléculas dentro y fuera de la célula. (p. 145· fig 'i-8) 18. los canales proteicos forman túneles rellenos de agua que unen los proteínas receptoras forman parte del sistema de señalización del cuerpo y las proteínas transportadoras movilizan muchas moléculas dentro y fuera de la célula. (p. 145· fig 'i-8) 18. los canales proteicos forman túneles rellenos de agua que unen los compartimentos intrncelular y extracelular. Los canales tipo compuerta regulan el desplazamiento de sustancias en su interior, abriéndose o cerrándose. Los canales tipo compuerta pueden ser regulados por ligandos. por el estado eléctrico de la célula o por cambios físicos como la presión. (p. 147; f ig. 5-10) 19. Las proteínas t ransportadoras nunca forman una conexión continua entre los liquidos intracelular y extracelular. Primero se unen a sus sustratos y, luego, cambian su conformación. (p. 149; Fig. 5-12) 20. La difusión mediada por proteínas se llama difusión facilitada. Tiene las mismas propiedades que la difusión simple. (pp. 143. 150; Cuadro 5-6: Eig s- 13) 21. El transporte activo moviliza moléculas en conh·a de sus gradiente.s de concentración y requiere una fuente externa de energía. En el transporte activo primario (directo), la energía proviene directamente del ATP. El transporte activo secundario (indirecto) utili7,a la energía potencial almacenada en un gradiente de concentración generado con energía proveniente del ATP. (pp. 150-151) 22. El h·ansportador activo primario más importante es la sodio-potasioATPasa (Na' -K -ATPasa), que bombea Na- fuera de la célula y K º dentro de ella. (p. 151; Fig. 5- 14) 23. La mayoría de los sistemas de transporte activo secundario son impulsados por el gradiente de concentración del sodio. (pp. 151, 153; Cuadro 5-8; Eig 'i- 16) 24. El transporte mediado por transportadores presenta especificidad, competición y satnración. La especificidad se refiere a la capacidad de un transportador de movili1,1r solo una molécula o un gn1po estrechamente relacionado de moléculas. Las moléculas relacionadas pue-

den competir por un transportador individual. La saturación ocurre cuando un grupo de transportadores de membrana están trabajando a su velocidad má>dma. (p. 154; Fig. 5- l 7)

Transporte mediado por vesículas 25. Las macromoléculas y las partículas grandes son introducidas a las células por fagocitosis o endocitosis. Las sustancias salen de las células por exocitosis. Cuando las vesículas que penetran en el citoplasma por endocitosis regresan a la membrana celular, el proceso se llama reciclado de membrana. (pp. 155-156· Figs 5-1 8, 5-19) 26. En la endocitosis mediada por receptor, los ligandos se unen a receptores de membrana que se concentran en fosetas recubiertas de datrina o en caveolas. (p. 156; Fjg. 5-19) 27. En la exocitosis, la membrana vesicular se fusiona con la membrana celular antes de liberar sus contenidos hacia el espacio extracelular. La exocitosis requiere ATP. (p. 157)

El potencial de membrana de reposo Sistema nervioso 1: el potencial de membrana

31. Aunque el cuerpo en su totalidad es eléctricamente neutro, la difusión

32. 33. 34.

35.

Transporte transepitelial 28. Los epitelios de transporte tienen diferentes proteínas de membrana en sus superficies apical y basolateral. Esta polarización pennite el movimiento de moléculas a través del epitelio en una dü-ección. (pp. 158-159; Figs. 5-20, 5-2 l ) 29. Las moléculas atraviesan los epitelios desplazandose entre las células por la vía paracelular o atravesando las células por la vía transcelular. (pp. 158-159; Fig. 5-20) 30. Las moléculas más grandes pasan a través de los epitelios por transcitosis, que incluye el transpo rte vesicular. (p. 160; Fig. 5-22)

-- --

Preguntas Nivel 1: revisión de hechos y términos l. Liste las cuatro funciones de las proteínas de membrana y dé un ejemplo de cada una. "2. Distinga entre transporte activo )' transporte pasivo. 3. ¿Cuáles de los siguientes procesos son ejemplos de transporte activo y cuáles son ejemplos de transporte pasivo? Difusión simple, fagocitosis, difusión facilitada, exocitosis, ósmosis, endocitosis. 4. Liste cuatro factores que aumentan la velocidad de difusión. 5. Liste los tres métodos físicos por los que las smtancias se incorporan a las células. 6. Un cotransportador es una proteína que moviliza más de una molécula por vez. Si las moléculas son desplazadas en la misma dirección, los transportadores se llaman ____ ; si las moléculas son transportadas en direcciones opuestas, los transportadores se llaman _ _ _ _ Una proteína transportadora que solo moviliza un sustrato se llama ____ 7. Los dos tipos de transporte activo son e l - - -- , que obtiene energia directamente del ATP, y el _ _ __ , que acopla la energía cinética del flujo de una molécula a favor de su gradiente de concentración con el movimiento de otra molécula en contra de su gradiente de concentración. 8. Una molécula que se mueve libremente entre los compartimentos intracelular y extracelular se denomina soluto ____ . Una molécula que no es capaz de penetrar en el interior de las células se llama soluto _ _ __ 9. Ordene los siguientes individuos de mayor a menor según su contenido de agua corporal: (a) un hombre de 25 años de edad y 70 kg de

36.

y el transporte activo de iones a través de la membrana celular crean un gradien te eléctrico, siendo el interior celular negativo con respecto al líquido extracelular. (p. 162; Fig. 5-23) El gradiente eléctrico entre los líquidos intracelular y extracelular se conoce como diferencia de potencial de membran a de reposo. (p. 163) El desplazamiento de un ion a través de la membrana celular está controlado por el gradiente electroquímico de dicho ion. (pp. 162-163) El potencial de membrana que contrarresta exactamente el gradiente de concentración de un ion se conoce como potencial de equilibrio (E.IOU ). El potencial de equilibrio de cualquier ion se calcula utilizando la ecuación de Nernst. (p. 164; Eig ,-J4) En la mayoría de las células vivas, el K· es el principal ion que determina el potencial de membrana de reposo. (pp. 163-165) Cambios en la permeabilidad de la membrana a iones como K-, Na " Ca'• o CI- modifican el potencial de membrana y generan sei\ales eléctt·icas. ( p. 166)

Procesos de membrana integrados: la secreción de insulina 37. La utilización de se11ales eléctricas para desencadenar una respuesta celular es una propiedad universal de las células vivas. Las células pancreáticas beta liberan insulina en respuesta a un cambio en el potencial de membrana. (p. 167; 1-'i g. 5-27)

Véanse la$ respuestas en el apéndice A

peso, (h) una mujer de 25 años de edad y 50 kg de peso, (c) una mujer de 65 años de edad y 50 kg de peso l' (d) un bebé de sexo masculino de l año de edad. 10. ¿Qué determina la osmolaridad de una solucion? ¿En qué unidades se expresa habitualmente la osmolaridad corporal? 11. ¿Qué significa que una solución sea hipotónica con respecto a una célula? ¿Y que sea hipertónica con respecto a la misma célula? ¿Qué determina la tonicidad de una solución con respecto a una celula? 12. Una los canales de membrana con su..s descripciones correspondien tes. Las respuestas pueden ser utili1..adas una vez, más de una vez o no utilizarse. (a) canal tipo compuerta (b) poro abierto (c) canal regulado por voltaje (d ) canal regulado por compuerta mecánica

1. canal que permanece abierto la mayor parte del tiempo 2. canal que permanece cerrado la mayor parte del tiempo 3. canal que se abre cuando cambia el potencial de membrana 4. canal que se abre cuando se Je une tm ligando 5. canal que se abre en respuesta al estiramiento de la membrana 6. canal a través del cual puede desplazarse el agua

13. Con sus propias palabras, mencione los cuatro principios de la elec-

tricidad importantes para la fisiología. 14. Una cada uno de los items de la izquierda con la opción correcta de la

lista de la derecha.

(al Na•-K· -ATPasa (b ) proteína (c) unidad de medida de potencial de membrana (d ) K· (e) c1-

en 1ffP (g) Na•

l. canal iónico

2. catión extracelular 3. fuente de energía 4. anión intracelular 5. catión intracelular 6. milivoltios 7. bomba electrógena 8. anión extracelular 9. miliosmoles

J 5. El potencial de membrana en el cual el gradiente eléctrico contrarres-

ta exactamente al gradiente de concentración de un ion se llama 16. Un material que permite el movimiento libre de cargas eléctricas se

llama ____, mientras que uno que impide este movimiento se llama _ _ __

Nivel 2: revisión de conceptos 17. Realice un mapa conceptual sobre el trnnsporte a través de las membranas celulares utilizando los siguientes términos. Puede añadir términos adicionales si lo prefiere. • • • • • • • • • •

transporte activo transportador caveola caaal fosita recubierta de clatrina gradiente de concentración gradiente electroquímico exocitosis difusión fu.cilitada transportador GLUT

• ligando • Na' -K· -ATPasa

10n

• vesíc.uJa

• molécula polar grande

• ósn1osis

• transporte pasivo • bicapa fosfolipidica • endocitosis mediada por receptor • transporte activo secundario • difusión simple • molécula polar pequeña • transporte vesicu.lar • agua

18. Dibuje un rectángulo grande para representar el volumen corporal total. Utilizando la información de la figura 5-1 b, divida el rectángulo proporcionalmente para representar los compartimentos corporales. Utilice la información de la Figura 5- Id y añada soluros a los compartimentos. Utilice letras de mayor tamai'lo para los solutos con las concentrnciones más altas)' letras pequeñas para los solutos con concentraciones más bajas. Etiquete las membranas celulares y la membrana endotelial. 19. ¡Qué factores influyen en la velocidad de difusión a través de una membrana? Explique cada uno brevemente. 20. Defina los siguientes términos y explique cómo difieren entre si: especificidad, competición, saturación. Aplíquelos para e:q,licaT bre,•emente la difusión facilitada de glucosa. 21. Los glóbulos rojos se encuentran suspendidos en una solución de NaCI. Las células tienen una osmolaridad de 300 mOs.M r la solución, una osmolaridad de 250 mOsM. (a) La solución es (hipertónica, isotónica, hipotónica) con respecto a las células. (b) El agua (fluirá dentro de las células, fluirá fuera de las células, no fluirá).

22. Dos compartimentos están separados por una membrana permeable a la glucosa. Cada compartimento contiene tma solución de glucosa I M. Después de 6 horas, el compartimento A contiene glucosa I M y el B, glucosa 0,5 M. ¿Qué tipo de transporte tuvo lugar? Explique. 23. Se coloca wrn solución de NaCl 2 ,'vi en el compartimento A y una solución de glucosa 2 /vi en el B. Los compartimentos están separados por una permeable al agua, pero impermeable al NaCI y a la glucosa. Complete las siguientes oraciones. Justifique sus respuestas. (a) La solución salina es ____ con respecto a la solución de glucosa.

(b) ¿Verdadero o falso? Habrá desplazamiento de agua desde un compartimento hacia el otro. Si el agua fluye, lo hará desde el compartimento ____ hacia el _ _ __ 24. Explique las diferencias entre un gradiente químico, un gradiente eléctrico y un gradiente electroquímico.

Nivel 3: resolución de problemas 25. Las glándulas sudoríparas secretan hacia la luz un liquido que es idéntico al liquido intersticial. A medida que el líquido se desplaza por la luz en di.recci6n a la superficie de la piel, las células epiteliales de las glándulas sudoríparas lo vuelven hipotónico reabsorbiendo Na ' sin reabsorber agua. Ubique los poros de agua, los canales de Na·, los canales de K y la Na ' -K' -ATPasa en la membrana apical, en la membrana basolateral o en ambas, según corresponda. 26. La insulina es una hormona que promueve la incorporación de glucosa dentro de muchos tipos celulares, por lo cual disminuye la concentración de glucosa en sangre. Utilizando su conocimiento sobre el transporte de membrana, proponga un mecanismo que explique cómo ocurre esto. 27. Los siguientes términos han sido aplicados a los transportadores de membrana: especificidad, competición, saturación. ¡Porqué también se puede aplicar estos términos a las enzimas? ¿Cuál es la principal diferencia en la forma en que las enzimas y los transportadores reali7.an su trabajo? 28. El NaCI es un soluto no penetrante, la urea es un soluto penetrante. Se colocan glóbulos rojos en cada una de las soluciones de más abajo. La concentración inh·acelular de solutos no penetrantes es de 300 mOsM. ;,Qué sucederá con el volumen celular en cada una de las soluciones? Describa cada solución con todos los términos que correspondan: hipertónica. isotónica, hipotónica, hiperosmótica, hiposmótica, isosmótica. ¡Tenga cuidado con las unidades! Asuma que NaCI 1 M = 2 Os.M, para mayor simplicidad. (a) Na(] 150 mi'v1 más urea 150 mM (b) NaCl 100 m.M más urea 50 mM (e) NaCI 100 m.M más urea 100 mM (d) NaCl 150 m.M más urea 100 mM (e) Na(] 100 mM más urea 150 mM 29. A las glucoproteínas integrales de membrana se les a1\aden carbohidratos a medida que pasan por la luz del retículo endoplasmático y del complejo de Golgi (p. 77). Basándose en esta información, ¿dónde espera encontrar las "colas" de carbohidratos de las proteínas: sobre el lado citoplasmático de la membrana, el lado exh·acelular o ambos? Explique su razonamiento. Nivel 4: problemas analíticos 30. La adición de solutos disueltos al agua disminuye el punto de congelamiento de esta. Una solución I OsM reduce el punto de congelamiento del agua en 1,86 ºC. Si el plasma de una paciente muestra una disminución de su punto de congelamiento de 0,550 ºC, ¿cuál es la osmolaridad del plasma? (Amma que I kg de agua = l L. )

172

Capit ulo 5 Dinámica de la membrana

31. La paciente de la pregunta anterior tiene un volumen de agua corporal to tal de 42 L, un volumen de LEC de 12,5 L y un volumen plasmático de 2,7 L. (a) ¿Cuál es el volumen de su líquido intracelular (LlC)? ¿Y el volumen de su líquido intersticial? {b) ¿Cuánto so luto (osmoles) hay en todo su cuerpo? ¿En el LEC? ¿En el LIC? ¿En el plasma? (Sugerencia: concentración = cantidad de solutoívolumen de la solución.) 32. ¿Cuál es la osmolaridad de una solución salina a la mitad de su concentración normal {= NaCI 0,45% )? (p. 139) Suponga que todas las moléculas de NaCI se disodan en dos iones. 33. Si se administra 1 L de solución salina a la mitad de su concentración normal (véase la pregunta 32) a la paciente de la pregunta 31, ¿qué le sucede a cada w10 de los siguientes parámetros en el equilibrio? /S11gere11cia: el NaCI es un soluto no penetrante.) (a) volumen corporal total (b) osmolaridad corporal total (c) volumen del LEC y del LlC (d) osmolaridad del LEC y del LlC 34. El siguiente gráfico muestra los resultados de un experimento en el cual se colocó una célula en una solución de glucosa. La célula no tenía glucosa en su interior en un principio, pero su membrana podía

trnnsportar glucosa. ¿Cuál/es de los siguientes procesos está/n ilustrado/sen este experimento?

.!l! ro 1.5 :::,

:, :aj

o :aj ro o .!l! (1)

D

(1)

e D.,~ .,e :,

--

1.

D

ro "' o o :::,

'


(a) difusión simple (b) saturación ( e) competición ( d) transporte activo

Respuestas

1

8. Predicción: la solución de glucosa 260 mOsM es hiposmótka e hipotónica. Tras la adición de 260 mosmoles de glucosa y un volumen de 1 L, obtenemos:

Respuestas a las preguntas de revisión

Página 132 J. La raiz que precede al sufijo - asa es el nombre del sustrato sobre el cual

• . --~.-'----·-- - ·-.J. ,... -·::,-'·",:¡:,: ~ --'· - . ,. .. _.. _.\ Página 132 J. La raiz que precede al sufijo - asa es el nombre del sustrato sobre el cual actúa la enzima; por lo tanto, el ATP es el sustrato de esta enzima. 2. El líquido intracelular tiene una alta concentración de K' y bajas concentraciones de Na-, CJ- y Ca" . 3. _El plasma es una parte del LEC, por lo que conocer la concentración plasmática de (a) Na- y de (b) K- nos indica la concentración de estos iones en el LEC. Las c.oncentraciones iónicas en el LJC son difeTentes de las concentraciones en el LEC, por lo que la concentración plasmática no nos indica los valores en el LIC. (c) El cuerpo está en equilibrio osmótico, por lo que la concentración de agua es la misma en todos los compartimentos. (d) Las proteínas se encuentran en el plasma pero no en el líquido intersticial, por lo que la concentración de proteinas plasmáticas no nos indicará las concentraciones de proteínas en el LEC o en el LIC. 4. (a) Agua corporal total = 29 L; (b) LEC = 19, 1 L; LIC 28,9 L; (c) plasma = 4,8 L

1 Total corporal I LEC I LIC 1 tomca. J ras ,a aa1oon ae Lt>U mosmo1es cte glucosa y un vommen ae 1 L, obtenemos:

1

Total corporal

Página 139 6. NaCI I M = NaCI 1 OsM. La glucosa I M (= 1 OsM ) y la NaCl I OsM tienen más agua. 7. (a) El agua fluye hacia A,)'ª que este compartimento es 2 OsM; (b ) no hay flujo neto, debido a que la urea difunde a través de la membrana hasta alcanzar el equilibrio; (c) el agua fluye hacia A debido a que este compartimento tiene una mayor concentración de solutos no penetrantes.

LIC

S (ruosmol)

900+260 = 1160

300

600 + 260 = 860

V (L)

3+1 = 4

1,034

2,966

C (mOsM )

1160/4 = 290 mOsM ~

290 - >

290

9. {a) La pérdida de sudor es hiposmótica. La osmolaridad corporal aumentará. (b) El volumen celular disminuirá. (c) Hay una pérdida de 0,5 L y 65 mosmoles de NaCl. Sí, el yolumen celular disminuyó )' la osmolaridad aumentó. Total corporal

=

Página 134 5. _El bebé ha perdido 0,91 kg de agua; es decir, 0,91 litrns.

LEC

LJC

300 - 65 = 235

600

3 - 0,5 = 2,5

1,034

1,796

334 mOsM - >

290 ~

334

S (mosmol)

900 - 65

V ( L)

C (mOsM )

= 835

LEC

1O. (a) La solucion de NaCI es mejor, aunque ambas soluciones sean isosmóticas con respecto al cuerpo (Cuadro 5-8 ). Debido a que la sangre perdida corresponde al compartimento extracelular, la mejor solución para reponer volumen debería permanecer en el LEC. Por esta razón la glucosa no es una opcion tan buena, ya que lentamente penetrn en las células, llevándose el agua con ella. (b) Si se ha perdido I L, se debería administrar el menos 1 L

Resp uestas Página 142 1J. Si la distancia se triplica, la difusión tarda nueve veces más. Página 144 12. La energía para la difusión proviene del movimiento molecular. 13. Debido a que es lípofílica, la molécula de ácido graso tiene más probabilidades de atravesar por difusión simple. 14. f.l flujo: (a) disminuye, (b) aumenta, (c) disminuye. J 5. El compartimento A pennanece amarillo y el comparti mento B se vuelve verde. 16. La gruesa matriz extracelular de la piel es generalmente impermeable al oxígeno. Además, el oxígeno necesita una superficie húmeda para difundir efectivamente a través de las membranas de un tejido. Página 148 17. Los iones positivos son cationes y los negativos son aniones. Página 149 18. Las proteínas de membrana actúan como proteínas estructurales, como receptores, como e1ujmas y como transportadores. 19. Los iones y las moléculas de agua fluyen a través de canales abiertos. 20. Los canales proteicos forman conexiones continuas entre los dos lados de una membrana y t ransportan moléculas más rápidamente. 21. Un canal recubierto por aminoácidos con carga neta positiva atrae aniones, lo cual, en este ejemplo, significa que el Cl-tiene más probabilidades de atravesar libremente el canal. 22. La glucosa es demasiado grande como para pasar a través de canales. Página 150 23. L1 dirección de la difusión facilitada de la glucosa se invierte )' esta sale de la célula.

º"'"'";_ ...

"I e:")

19. Los iones y las moléculas de agua fluyen a través de canales abiertos. 20. Los canales proteicos forman conexiones continuas entre los dos lados de una membrana y t ransportan moléculas más rápidamente. 21. Un canal recubierto por aminoácidos con carga neta positiva atrae aniones, lo cual, en este ejemplo, significa que el Cl-tiene más probabilidades de atravesar libremente el canal. 22. La glucosa es demasiado grande como para pasar a través de canales. Página 150 23. L1 dirección de la difusión facilitada de la glucosa se invierte )' esta sale de la célula. Página 152 24. L1 ATPasa es un antiportador, mientras que el SGLT es un simportador. La ATPasa reqtúere energía del ATP para cambiar de conformación, mientras que el SGLT util iza la energía almacenada en el gradiente de concentración del Na •. Página 154 25. Un antiportador moviliza sustratos en direcciones opuestas. 26. Puertas más grandes podrían petmitir el paso de una mayor cantidad de personas. Esto sería análogo a que la célula sintetizara una nueva isofonna del transportador que pudiera movilizar más cantidad sustrato por segundo. Página 157 27. En la fagocitosis, el citoesqueleto hace protruir a la membrana para envolver una partícula dentro de una gran vesícula. 1:n la endocitosis, la superficie se invagina y forma una vesícula mucho más pequeña. 28. Las proteínas asociadas a la endocitosis son la datrina y la caveolina. 29. Las proteínas penetran en las células por endocitosis y salen por exocitosis. Página 160 30. El movimiento de sodio fuera de la célula requiere energía debido a que la dirección del flujo del ion es rnntraria a su gradiente de concentración. 3 1. La ouabaína aplicada sobre el lado apical no tendría ningún efecto, ya que no existen moléculas de Na "-K"-ATPasa en ese lado. La ouabaína

173

aplicada sobre el lado basolateral detendría la bomba. El transporte de glucosa continuaría por un tiempo hasta que el gradiente de Na · entre el interior celular y la luz desapareciese debido al incorporación de Na+en la célula. 32. Se ilustrn el transportador GLUT2. 33. La transcitosis se detendrá debido a que el transporte vesicular realizado por el citoesqueleto depende de microtúbulos funcionales. Página 166 34. El c1- se desplazará dentro de la célula a favor de su gradiente de concentración, lo cual hará que el interior celular sea negativo. Las cargas positivas que queden en el exterior atraerán el o- de vuelta hacia afuera. El potencial de equilibrio será negativo. 35. Con el transcurso del tiempo, el Na ' penetraría dentro de la célula y el potencial de membrana de reposo se haría más positivo.

~ Respuestas a las preguntas de las figuras Página 131 Figura 5-1 : 1. El plasma es 25% de 14 L = 3,5 L. El líquido intersticial es 75% = J 0,5 L. 2. Agua corporal total = 42 L. 3. El plasma es 3,5 U42 L = 8,3% del agua corporal total;el volumen intersticial es 10,5 L/42 L = 25%. 4-. El peso corporal total es 12 lb x J kg/2,2 lb = 55 kg. Si el agua corporal = 50% del peso corporal, el agua corporal total = 27,5 L. El LIC es el 67% de 27,5 L =- 18,425 L. El LEC es el 33% de 27,5 L = 9,0 75 L. El plasma es el 25% del LEC = 2,269 l. 5. El plasma contiene proteínas y grandes aniones que no se encuentran en el líquido intersticial. 6. El compartimento extracelular tiene más Na -, Cl- y bicarbonato que el intracelular y menos K". P;\nin;\ 1 ~7

Página 131 Figura 5-1 : 1. El plasma es 25% de 14 L = 3,5 L. El líquido intersticial es 75% = J 0,5 L. 2. Agua corporal total = 42 L. 3. El plasma es 3,5 U42 L = 8,3% del agua corporal total;el volumen intersticial es 10,5 L/42 L = 25%. 4-. El peso corporal total es 12 lb x J kg/2,2 lb = 55 kg. Si el agua corporal = 50% del peso corporal, el agua corporal total = 27,5 L. El LIC es el 67% de 27,5 L =- 18,425 L. El LEC es el 33% de 27,5 L = 9,0 75 L. El plasma es el 25% del LEC = 2,269 l. 5. El plasma contiene proteínas y grandes aniones que no se encuentran en el líquido intersticial. 6. El compartimento extracelular tiene más Na -, Cl- y bicarbonato que el intracelular y menos K". Página 137 Figura 5-4: ejemplo 2: (a) hiperosmótica; (b) 250 mOsM; (c) 300 mOsM; (d ) sí, dentro de las células; (e) hipotónica; (f) aumentó; hiperosmótica; (g) aumentó; hipotónica. Página 154 Figura 5-17: (c) no se puede decir si hay transporte de galactosa, ya que las curvas solo muestran el transporte de glucosa. (d ) La célula pocb-ía aumentar la velocidad de transporte añadiendo más transportadores a la membrana. Página 159 Figura 5-21: 1 = b, 2 a, 3 b. El transporte basolateral de glucosa es pasivo debido a que aquella se mueve a favor de su gradiente de concentnción. El Aujo de Na· a través de la membrana apical no reqtúere ATP, ya que el ion se está moviendo a favor de su gradiente de ccrncentración.

=

=

Página 164 Figma 5- ?4· (b) LJC = -1 y LEC = +l. (c) Porque la membrana celular no es permeable al Na , al c1- ni a las proteínas. Página 165 Figura :;_J5: el movimiento de Na+ hacia el interior de la célula se origina por sus gradientes de concentración y eléctrico. La salida de K- de la célula está provocada por su gradiente de concentración.

Comunicación, integración y homeostasis Comunicación intercelular 17S Las uniones en hendidura forman puentes citoplasmáticos

177 177

Las señales dependientes del contacto requieren contacto intercelular Las señales paracrinas yautocrinas llevan acabo la comunicación local La comunicación alarga distancia puede ser eléctrica o química Las citodnas pueden actuar como señales locales ocomo señales alarga distancia

Vías de señalización 178 Losreceptores proteicos están ubicados dentro de lacélula o en la membrana

180 181 183 183 183 183 18S

celular Las proteínas de membrana facilitan la transducción de señales Losreceptores enzimáticos tienen actividad proteincinasa oguanililcidasa La transducción deseñales utiliza principalmente proteínas G Muchas hormonas lipófobas utilizan vías GPCR-AMPc Losreceptores asociados aproteínaGtambién utilizan segundos mensajeros derivados de lípidos Los receptores tipo integrinatransfieren información desdela matriz extracelular Las vías de señalización más rápidas modifican el flujo de iones através de canales

Moléculas de señalización novedosas 187 El calcio es una señal intracelular importante 187 Los gases son moléculas de señalización efímeras 188 Algunos lípidos son señales paracrinas importantes Modulación de las vías de señalización 189 Un ligando puede tener múltiples receptores 190 Los receptores presentan saturación, especificidad ycompetición 191 La regulación por incremento yla regulación por disminución permiten alas

191 191

células modular las respuestas las células deben ser capaces de detener las. vías de señalización Muchas enfermedades yfármacos tienen como objetivo las proteínas de transducción de señales

• FIGURA6-1 FUNDAMENTOS

• •

Comunicación en el cuerpo La comunicación intercelular utiliza señales químicas y eléctricas para coordinar las funciones y mantener la homeostasis.

COMUNICACIÓN LOCAL

(a) Las uniones en hendidura forman conexiones citoplasmáticas directas entre células adyacentes.

(b) Las señales dependientes del (c) Las señales autocrinas actúan sobre la misma célula contacto requieren interacción entre que las secretó. Las señales paracrinas son secretadas moléculas de membrana de dos células. por una cél ula y difunden hacia las células adyacentes.

COMUNICACIÓN A LARGA DISTANCIA La señalización a larga distancia puede estar constituida por señales eléctricas que viajan por neuronas o por señales químicas que viajan por el sistema circulatorio.

Sistema endocrino

Sistema nervioso Señal

Sangre~• •

t./· Célula endocrina

Célula ~ diana ~

lo • • • Jo, • •\

.

• •

-

Célula sin receptor

o

~

No hay respuesta

·:1Célula con receptor

Neurona

Célula -.. diana

{@

e

(d) Las hormonas son secretadas por glándulas o células endocrinas en la sangre. Solo las células diana que tienen receptores para la hormona responden a la señal.

icapanamericana.comNisorEbookV2/Ebook/9786079356224#

(e) Los neurotransmisores son sustancias químicas secretadas por las neuronas que difunden por un pequeño espacio hacia la célula diana.

~

,,,>:••

~ = =~ C +X

•~

Sangre

Neurona

(f) Las neurohormonas son sustancias químicas liberadas por las neuronas en la sangre para actuar sobre dianas distantes.

• ----- ••

~1

Célula sin receptor

w

No hay respuesta

\1· ...

---...

; Célula

con receptor

dient.e del co11tacto tiene lugar en el sistema inmune y durante el crecimiento y desarrollo, como cuando las células nerviosas em iten largas extensiones que deben crecer desde el eje centra l del cuerpo hacia los extremos distales (d istantes) de las extremidades en desarrollo. Con respecto a las moléculas de adhesión celular (MAC), conocidas inicialmente por su papel en la adhesión intercelular, ahora se sabe que actúan como receptores en la se11alización in tercelular. Las lvlAC están adheridas al citoesqueleto y a enzimas intracelulares. Gracias a estas conexiones, h1s MAC transfieren se11ales en ambas direcciones a trnvés de las membranas cel ulares.

Si una molécula neurocrina difunde desde la neurona a través de un espacio extracelular estrecho hasta una célula di,ma )' posee un efecto rápido, se llama neurotransmisor (fjg 6- 1f) Si actúa más lentamen te, como una señal autocrina o panicrina, se llama neuromodulador. Si una sustancia nemocrina liberada por una neurona difunde hacia la sangre para su distribución, se llama neurohormona ( Fíe.. 6- l ). Las similitudes entre las neurohormonas y las hormonas clásicas secretadas por el sistema endocri no desvanecen la distinción entre los sistemas nervioso y endocrino, volviéndolos un continuo funcional en lugar de dos sistemas diferentes.

Las señales paracrinas y autocrinas llevan a cabo la comunicación local

Las citocinas pueden actuar como señales locales ocomo señales a larga distancia

La comun icación local tiene lugar gracias a la se11alización paracrina y autocrina. Una señal paracrina \para-, al lado,+ kri11e11, secretar} es una sustancia quím ica que actúa sobre células en las inmediaciones de la célula que secretó la señal. Una señal química que actúa sob re la célula q ue la secretó se llama señal autocrina {auto-, sí mismo}. En algunos casos, una molécula puede actuar como señal autocrina )' paracrina. Las moléculas paracrinas y autocrinas llegan a sus cél ulas d iana por d ifusión a través del líquido intersticial ( Fig. 6-JcJ. Debido a que la d istancia es un facto r limitante para la difusión, el ale.anee efectivo de las se11ales paracrinas está restringido a las cél ulas ad)racentes. Un buen ejemplo de molécula paracr ina es la hista111i11a, una sustancia q uím ica liberada por las células da11adas. Cuando usted se lastima con un elemento punzante, la hinchazón resultante se debe en parte a la liberación local de histam ina desde el tejido da11ado. La histamina actúa como una sefial paracrina, d ifundiendo hacia los cap ilares contiguos a la lesión )' volviéndolos más permeables a los glóbulos blancos y a los anticuerpos p lasmát icos. Tamb ién hay extravasación de líq uido desde los vasos sangtúneos, el cual se acumula en el espacio intersticial, ocasionando Lumefacción alrededor del área lesionada. Muchas clases imponan tes de moléculas actúan como se11ales locales. Las citocinas son péptidos reguladores y los eicosa11oides son moléculas de señalización paracrina )' autocrina derivadas de los lípidos. Estudiaremos las citocinas y los eicosanoides en rm\s detalle más adelante.

Las citocinas se encuentran entre las 111oléculas de la comunicación más recientemente iden tificadas. Inicialmente, el Lérm in o citocina solo se refería a las proteínas que modulan las respuestas inmunes, pero en los últimos a11os se ha ampliado la definición para incluir una variedad de péptidos reguladores. Todas las células n ucleadas sintetizan y secretan citocinas en respues ta a un estímulo. Las citocinas controlan el desa rrollo celular, la diferenciación cel ular )' la respuesta inmune. En el desarrollo y la diferenciación, las citocinas funcionan habitualmente como sefiales auLocrinas o paracrinas. En el estrés y la inflamación, algunas citoc inas pueden acLuar sob re dianas relativamente distantes y ser transpo rtadas po r la ci rculación, al igual que las hormonas. ¿Cómo se diferencian las citocinas de las ho rmonas? En general, las citocinas actúan sobre un espectro más amplio de células diana. Además, las citoci nas no se sintetizan por células especializadas como las hormonas, y son creadas bajo demanda. Por el contrario, la mayoría de las hormonas proteicas o peptídicas son producidas con anticipación y se alm acenan denlro de las célu las endocrinas hasta que son requeridas. Además, las vías de se11ali2ación para las citocinas son habitualmente diferentes de las de las ho rmo nas. Sin embargo, la distinción entre c.itocinas y hormonas es, a vece,;, di fusa. Po r ejemplo, la eritropoyet ina, la molécula que con trola la sín tesis de glóbulos rojos, es considerada tradicionalmente una hormona, pero coincide funcionalmente. con la defin ición de citocina.

La comunicación alarga distancia puede ser eléctrica oquímica

Revisión

Todas las células del cuerpo pueden libera r sefütles paracrinas, pero la ma)'O r parle de la comw1icación a larga distancia entre células se lleva a cabo a través de los sistemas nerv ioso y endocrino. El sistema endocrino se comun ica mediante la utilización de hormonas \hormon, excitar}, señales químicas que son secreladas en la sangre y distrib uidas por todo el cuerpo mediante la circulación. Las hormonas entran en contacto con la mayo ría de las células del cuerpo, pero solo aquellas que poseen receptores para la ho rmona son las células diana ( Fig.

1. Una el método decomunicación de@ lista a la izquierda con su; piopiedades de la lista a laderecha. (a) autocrina la comunicación ocurre por: (b) citocina (c) unión en hendidura 1. señales eléctñcas (d) hormona 2. señales químicas (e) neurohormona 3. senales eléctricas y químicas (ij neU1otransmisor (g) paraaina

6- Jd).

2. ¿Cuáles de las moléculas de señ.liz.;ción listadas en@ pregunta anterior son transporta· das por el aparato circulatorio? ¿Cuáles son liberadas por neuronas?

El sistema nervioso utiliza una combinació n de señales químicas y eléctr icas para com un icarse a largas distancias. Una se11al eléctrica viaja a lo largo de una célula nerv iosa ( neurona) hasta llegar al extremo de esta, donde se conv iene en una señal química sec rernda por la neurona. Esta se11al qlúmica se llama neurocrina.

3. Un gato ve un ratón yse abalanza sobre él. ¿Usted piensa quela señal interna para abalan· zarse podría h.bersido transmitirla por una senal paracñna? Dé dos razones para explicar por qué sio por qué no.

Vías de señalización Las señales químicas en íorma de mo lfrulas y hormonas paracrinas y autocrinas son liberadas desde las células hacia el compartimento extracelular. Esta no es una forma específica median te la cual esas señales encuentran sus dianas, ya que las sustancias que viajan por la sangre llegan a casi todas las células del cuerpo. Aun así, las células no responden a cada una de las seña les que les llegan. ¿Por qué algunas células responden a una señal química m ientras q ue otras células la igno ran? la respuesta yace en las p roteínas receptoras en la célula diana a las cuales se unen las señales qui micas. Una célula puede responder 11 111111 seiir1I química solo si tiene l11s proceínas receptoms rorrespo11die11tes p11m esa se,lnl (Fig. 6-1). Si una célula diru ia tiene un receptor para una molécula de señalización, la un ión de esta a la proteína receptora inicia una respuesta. Todas las vías de sei'ialización oompru·ten las siguientes características <• .Fig. 6-2):

ligando que se une a una proteína receptora. El ligando también se llama primer mensajero

La molécula de señalización es un

1 3 4

debido a que trae información a la célula diana. La un ión ligando-receptor activa el receptor. El receptor activa, a su vez, una o más moléculas que actúan como señal intracelulares. La última molécula de señalización de la vfa inicia la síntesis de proteínas diana o modifica las proteínas d iana existentes para generar una respuesta.

En las sigu ien tes secciones describimos algunas vías de señalización básicas. Estas pueden parecer complejas en un principio, pero

siguen patrones que usted encontrará una y otra vez en su esLUdio de los s istemas corpo rales. La mayo ría de los procesos fisiológicos, desde el latido del corazón hasta el ap rendizaje)' la memoria, utilizan alguna variación de estas vías. Una de las maravillas de la fisiología es la importancia fundamental de estas vías de sefütlización y la fo rma en que estas han sido conservadas en los animales, desde los gusanos hasta los humanos.

Los receptores proteicos están ubicados dentro de la célula oen la membrana celular Los receptores proteicos de las moléculas de señal cumplen un papel importante en la fisiología)' en la medicina. En la actualidad, aproximadamente la mitad de los fármacos en uso actúan sobre recepto res proteicos. Los receptores proteicos de las células diana pueden encontrarse en el núcleo, en el citosol o en la membrana celular como pro teínas integrales. El lugar donde se une una señal q uím ica a su receptor depende en gran medida de si la molécula de señalización es lipófila o lipófoba Fig. 6-3 ). Las moléculas de seiiali:wció11 lipófilas pueden difundir a través de la bicapa fosfol ipídica de la membrana celular y se unen a receptores citosólicos o a receptores nucleares ( Fig. 6-3a). En estos casos, la activación del receptor frecuentemente acliva un gen y promueve la producción de ARN m n uevo en el núcleo (transcripción). El ARNm si rve luego como una plantilla para la síntesis de nuevas proteínas ( traducción). F.ste proceso es relativamente lento, y la respuesta celular puede no ser evidente hasta después de una hora o más. En algunos casos, el recepto r activado también puede apagar o reprimir la actividad géni ca. Muchas moléculas de señalización lipófilas q ue siguen este patrón son hormonas.

<•

Vías de señalización La mayoría de las vías de señalización consisten en estos cinco pasos. Utilice las formas y los colores de los pasos mostrados aquí para identificar el patrón en ilustraciones posteriores .

Molécula de señalización

se une a

Receptor de membrana 1

activa

+ Moléculas de señalización Intracelulares

'

modifican

+ Proteínas diana

generan

~

a FIGURA 6-2

Más tarde ese mismo día, en el consultorio médico, la enfermera explica a Marvin q ué es la diabetes. La diabetes mellitus comprende una familia de trastornos metabólicos ocasionados por defectos en las vías metabólicas que regulan el metabol ismo de la glucosa. Existen muchas formas de d iabetes, y algu nas pueden ser hereditarias. Una forma, llamada diabetes mellitus tipo 1, ocurre cuando las células e ndocri nas de l páncreas son destruidas y dejan de prod ucir insulina, una hormona proteica involucrada en la homeostasis de la glucemia. En o tra forma, la diabetes m ellitus tipo 2, la insulina puede estar presente en niveles normales o por encima de lo no rmal, pero las células sensibles a insulina del cuer· po no responden normalmente a la hormo na. P1: ¿En q ué tipo de diabetes es más probable que haya un defecto en la vía de señalización de la in sulina en la célula diana? P2 : l a insulina es una hormona proteica. ¿ Usted esperaría enco ntrar su receptor sobre la superficie cel ular o dentro del citoplasma de las células diana?

175 .

191

194

196

198

202

Vías de señalización

(a) Receptores de señal intracelulares

(b) Receptores de la membrana celular

Receptor en el citosol Receptor en el núcleo

J---

Las moléculas { de señalización lipófilas difunden a través de la membrana celular.

179

La molécula de señalización extracelular se une a un receptor de membrana.

º~

O

La unión desencadena

o La unión a

Respuestas celulares rápidas

receptores citosólicos o nucleaes desencadena Respuestas más lentas relacionadas con modificaciones en la actividad génica

(c) Cuatro categorías de receptores de membrana

LEC

Canal

/

o

( ) Receptor

)

Moléculas de se1ialización - - - - -- -extracelulares

Receptor

lntegrina

! Membrana celular Proteína de anclaje Enzima

L/C

Proteína G Citoesqueleto

Receptor-canal La unión del ligando abre o ,..; ,.._ ,.,.,...J ,.,.... ...... 1

Receptor-canal La unión del ligando abre o cierra el canal.

Receptor enzimático La unión del ligando a un receptor enzimático ,. : ,....... ........: ...... .... Receptor enzimático La unión del ligando a un receptor enzimático activa una enzima intracelular.

. .. .... . .

Receptor asociado a proteína G La unión del ligando a un receptor asociado a proteína G abre un ...............1 ;,.;,...;,...,.,...,.,,.., ... 1..,.......... 1.... ........... :, ,: ..............

Receptor asociado a proteína G La unión del ligando a un receptor asociado a proteína G abre un canal iónico o altera la actividad de una enzima.

Receptor tipo integrina La unión del ligando a los receptores tipo : ............. ..: ........... , . ........... .... 1 ....:+...

Receptor tipo integrina La unión del ligando a los receptores tipo integri na altera el citoesqueleto.

• FIGURA 6-3 Los receptores de la célula diana pueden estar ubicados en la superficie celular o dentro de la célula

Las moléculas de se11alimció11 lipófobas son incapaces de difundir a través de la h impa fosfol ipídica de la membrana cel ular. En su lugar, estas moléculas de señalización permanecen en el líquido extracel ular y se unen a receptores pro teicos en la membrana celular (Fig. 6-3b) ( algunas moléculas de señalizació n lipófi las tamb ién se unen a receptores de membrana, además de a sus receptores in tracelulare.s). En general, el tiempo de respuesta de las vías med iadas por receptores de membrana es mu)' rápido: las respuestas se pueden d etectar en mi lisegundos a mi nutos.

Podemos agrupar los receptores de membrana en cuatro categorías, ilustradas en la Figura 6 -3c. Los receptores más sencillos son canales iónicos regulados por compuerta q uím ica (activados por ligando), llamados receptores-canales. La unión del liga ndo abre ocierra el canal y mod ifica el llujo iónico a través de la membrana. En la Figura 6-3c se muestran olros tres tipos de receptores: receptores e11zimáticos, receptores asociados a proteína G y receptores tipo integri11a. Para estos tres tipos, la información de la molécula de señal ización debe ser transmi tida a través de la memb ra na para ini-

180

Capitulo 6 Comunicación, integraci ón y homeostasis

ciar una respuesta intracelular. La transmisión de información de un lado de la membra na al o tro utiliza ndo proteínas de membrana se conoce como trrmsducción de se11ales. Observaremos más de cerca la transducción de señales antes de describir los cuatro tipos de receptores q ue participan en ella.

sis temas b iológicos, las pro teínas de membrana actúan como transductores. Ellas convierten el mensaje de las señales extrace\ulares en moléculas mensajeras in tracelu lares que desencadenan u na res puesta. En la • Figura 6-5a se muestra el patrón básico de una vía bio lógica de transducción de se1iales, la cual puede ser descompuesta en los siguien tes eventos.

Revisión

1

4. Cite cuatro componentes de les vías de señ.lizaóórt S. Nombretre; lcolim iones celulares delosreceptores.

2

Las proteínas de membrana facilitan la transducción de señales La transd ucción de s eñales es el proceso por el cual una molécula de señal ización e.xtracelular activa un receptor de membrana que, a su vez, modifica moléculas intracel ulares para generar una respuesta. La molécula de señalización extracelular es el primer mensajero y las moléculas intracelulares forman un sistema de segundos mensajeros. El término transducción de señales viene del verbo transducir, que significa "guiar a través" {1m11s, a través,+ ducere, guiar). Un transductor es un dispositivo que convierte una señal de una forma en o tra diferente. Por ejemplo, el transducto r de una radio conviene las ondas de radio en o ndas de sonido Fig. 6-4). En los

3

En la Figura 6-5b se muestra una versión más detallada de la vía básica de transducción de señales. 1

<•

2 La transducción de señales convierte una fom1a de s eñal en otra diferente.

Señal externa

l

Ondas de radio 1

La transducción de señales convierte una forma de s eñal e n otra

diferente.

Señal externa

• } !

r--,

1

Ondas de radio

-

Receptor

f

l

-

ransductor

J -~ Radio

Amplifícador

Una radio posee una ante na para recibir s eñales , un transductor para convertir las ondas de radio en ondas de sonido y un amplificador para aumentar la fuerza de la señal.

-

"' Respuesta • FIGURA 6-4 Transducción de señales

Una molécula de señal ización extracelular (el primer mensajero) se une a un receptor de membrana y Jo activa. El recepto r de membrana activado pone en marcha sus proteínas asociadas e inicia una e.aseada intracel ular de segun dos mensajeros. El último de los segundos mensajeros de la cascada actúa sobre las dianas intracelula res para generar una respuesta.

3

Los receptores de membrana y sus proteínas asociadas habitual mente: (a ) activan proteincinasas, que son enzimas que transfieren un grupo fosfato del ATP a una proteína. La fosforilación es un método bioquímico importante para la regulación de los procesos ce)uhtres. (b) activan enzimas ampl ificado ras que p roducen segundos mensajeros intracelula res. Los segundos mensajeros, a su vez: ( a) alteran las compuertas de canales ión icos. La apertura o el cierre de canales ión icos generan señales eléctricas por alteración del potencial de membrana de la célula. (b) aumentan el calcio intracelular. La un ió n del calcio a las proteínas altera su función, produciendo una respuesta celular. (e) mod ifican la acti vidad enzimática,especialmente de proteincinasas o de proteinfosfatasas, enzimas que eliminan un grupo fosfato. La fosforilación o la desfo,forilaci6n de una proteína pueden cambiar su configuración y generar una \a¡ ,11ceran 1as compuercas ae canaies 1'un1cos. La apertura o e1 cierre de canales ión icos generan señale.s eléctricas por alteración del potencial de membrana de la célula . (b) aumen tan el calcio intracelular. La unión del calcio a las pro teínas altera su func ión, produciendo una respuesta celular. ( c) modifican la actividad enzi rnát ica, especial mente de protei ncinasas o de proteinfosfatasas, enzimas que eliminan un grupo fosfato. La fosforilación o la de,fosforilaci611 de una proteína pueden camb ia r su configuración y generar una respuesta. Ejemplos de cambios que ocurren tras la fosforilació n Lncluyen el aumento o la disminución de la actividad enzimática y la apertura o el cierre de los canales iónicos regulados por compuer ta. Las proteínas modificadas por la unión de calcio y por fosfori lacü5n contro lan uno o m,\s de los siguientes: (a) enzimas metabó licas (b) proteínas motoras para la contracción muscular y el movim iento ci toesquelético (c) proteínas que regulan la actividad génica y la síntesis de pro teínas (d) transportado res y receptores de membrana

Si usted piensa que la lista incluye casi todas las funciones celulares, ¡tiene razón! La a f igura 6-6a muestra cómo los pasos de una vía de transducción de señales forman una cascada. Una cascada de se1ial ización comienza cuando un estím ulo (la molécula de sef1alizació n) convier-

Vías de señalización

(a) Transducción de señales básfca

(b) Vías de transducción

Primer mensajero

Molécula de señalización

~

Transductor

Receptor de membrana

Proteínas diana 1 generan

p

¡

-------r v

1

Transducción de señales mediante proteínas

1

¡

. - - - Receptor de membrana

inicia

activa

modifican

extrace/ular

seuneta

1

1

Liq uido

Molécula de señalización

se une a

Molécula de señalización intracelulares

181

Canal iónico

Enzlmas amplificadoras

o

/\

o o

Sistema de segundos mensajeros

D D

._

.

~

1

l

__J

/

- - - - . - - - -alteran

/

n~os meñsa¡eros

Liquido

intracelular Proteincinasas

Aumento del Ca2+ intracelular

Proteínas fosforiladas

Proteínas llgadoras de calcio

Dianas

l j

r-:ta

• FIGURA 6-5 Transducción de señales biológicas

te la molécula A inacLiva (el receptor) en su fo rma activa. luego, la molécula A activa co nvierte la molécula B inact iva en su forma activa, la cual hace lo mismo con la moléettla C, y así sucesivamente hasta

Recuerde q ue estos recepto res pueden responder a cua lquiera de los diferentes tipos de moléculas de señal: hormonas, neurohormonas, neurotransmisores, citocinas, paracrinas o autocrinas.

Le la molécula A inactiva (el receplor) en su forma acLiva. l uego, la molécula A acLiva convierLe la molécula B inactiva en su forma activa, la cual hace lo mismo con la mo lécula C:, y así sucesivamente hasta q ue, en el último paso, se conviene un sustrato en un prod ucto. M uchas vías de señalizació n in Lracelular so n cascadas. La coagulación sanguínea es un ejemplo importan Le de cascada extracelular. En las vías de Lransd ucción de señales, la señal o riginal no solo es transformada sino Lambién ampl iíicada {amplificare, hacer más grande} . En una radio, también las ondas son am plificadas. En las células, la amplificación de la señal convier te una molécula de señalización en múlLiples segundos mensajeros ( Eig 6-6b ) El proceso comienza cuando el prime r mensajero se combi na co n su recepto r. El complejo recepwr-ligando acti va una enz im a amplificadora. Esta activa muchas moléculas, las cua les, a su vez, acLivan muchas más molécu las a lo largo de la cascada. Al final del proceso, los efectos del ligando han sido amp lificados mudw más q ue si hub iese hab ido una relación l: 1 entre cada paso. La ampl iíicación propo rciona un beneficio al perrnitir que una peq uefia cantidad de ligando genere un gran efecto. Las enzimas ampl ificadoras y los segundos mensajeros más comunes se listan en la Figura 6-6c. En las secciones siguientes, examinaremos en más detal le los cuatro tipos principales de receptores de membrana ( véase la Fjg 6-1c).

Recue rde q ue estos recepLores pueden responder a cua lquiera de los diferentes Lipos de moléculas de señal: hormonas, neurohormonas, neuroLransm isores, citocinas, paracrinas o autocrinas.

Revisión 6, ¿Cuáles son los cuatro pasos de la transducciónde señales?

7. ¿Qté sucede durante la amp!ifim ión? 8, ¿Por qué las hormonas esleroideas no requieren la transducción de señales yde segun· dos mensajeros para ejercer suacción? (Sugm ncia: los esteroides, ¿son lipófobos o lipó-

filos?)

Los receptores enzimáticostienen actividad proteincinasa o guanililciclasa l os receptores enzimMicos poseen dos regiones: una región receptora, del lado extracelula r de la membrana plasmática, y otra enzimática, del lado ci toplasmático (véase la Fjg 6-3<:L En algunos casos, la región recepLora y la región en:limática son parte de la misma molécula pro teica. l a unión del ligando y el recepto r acLiva la enzima. Las enzimas de los receptores enLimát icos son proteincinasas, como la

Transducción de señales (b) La amplificación de la señal permite que una pequeña cantidad de señal tenga un gran efecto.

(a) Las vías de transducción de señales forman una cascada.

Señal El complejo receptor-ligado activa una enzima amplificadora (EA).

Uquido extracelular Molécula A inactiva

~~ -

Molécula A activa

+

~ Molécula B activa

Molécula B inactiva

R

Membrana celular

~

-

• EA

+

~ Molécula C inactiva Molécula C activa

+

Uquido intracelular

e

~

Sustrato

La conversión del sustrato en un producto es el paso final de la cascada.

Producto

Un ligando es amplificado a muchas moléculas intracelulares.

(c) Vías de segundos mensajeros SEGUNDO MENSAJERO FORMADO A PARTIR DE

ENZIMA AMPLIFICADORA

UNIDO A

ACCIÓN

EFECTOS

Nucleótidos

Adenililciclasa (membrana)

ATP

AMPc --,

GMPc

t---

Guanililciclasa (membrana)

GTP

GPCR·

--

Guanililciclasa (citosol)

1 Derivados de lipidos*

1

·1 Guanililciclasa (citosol)

1

Activa proteincinasas, especialmente PKA. Se une a canales iónicos.

Fosforila proteínas. Altera la apertura de canales.

Receptor enzimático

Activa proteincinasas, especialmente PKG.

Fosforila proteínas.

Óxido nítrico

Se une a canales iónicos. Altera la apertura de

-

canales.

(NO}

----

Óxido nítrico

. ..

-

-

. ..

. .

..

Se une a canales iónicos. Altera la apertura de canales.

(NO)

Derivados de lipidos• IP3 1

1

Fosfolípidos de membrana

Fosfolipasa e (membrana)

GPCR

DAG

.

Libera Ca2+ de depósitos intracelulares.

Véase los efectos del Ca2• más abajo.

Activa la proteincinasa C.

Fosforila proteínas.

Se une a calmodulina. Se une a otras proteínas.

Altera la actividad enzimátíca. Exocitosis, contracción muscular, movímiento citoesquelético, apertura de canales.

1 Iones C32.

'GPCR = receptor asociado a proteína G. IP3 = inositol trifosfato. DAG = diacilglicerol

Receptor tirosincinasa

La tirosíncinasa (TK) transfiere un grupo fosfato de una ATP a una tirosína (un aminoácido) de una proteína.

~------~ La molécula de

LEC

señalización se une al receptor de superficie R

activa

¡

Membrana celular

TK

Tirosincinasa del lado citoplasmático

Sitio de unión activo

..-----:-./\

Proteína ATP +!Proteína¡ ~ fosforilada +ADP

uc • FIGURA6-7

e•

1irosinci11nsa Pig. 6-7), o gua11ililciclnsas, la enzima amplificadora que convierte GT P en GMP cíclico (GMPc). El grupo de ligandos de los receptores enzimáticos incluye la hormona insulina, así como muchas citocinas y factores de crecimiento. El receptor proteico de la insul ina tiene su propia actividad tirosincinasa intrí nseca. Por el contrario, la mayoría de los receptore.s proteicos de citocinas no posee actividad enzimática intrínseca. En su lugar, la unión de las citocinas activa una enzima citosólica llamada tirosi11cinasa de la familia Ja,rns, habitualmente abreviada cinasa /AK.

La transducción de señales utiliza principalmente proteínas G Los receptores asociados a pro teína G (GPCR) integran una familia grande y compleja de proteínas transmembrana que atrav iesan la bicapa fosfolipídica siete veces (véase la Fig. 6-3c). La cola citoplasmática del receptor proteico está unida a un transd uctor de membrana que consta de tres partes llamado proteína G. Se han identiucado cientos de receptores asociados a proteínas G, y la lista sigue creciendo. Los tipos de ligandos que se unen a los receptores asociados a proteína G incluyen hormonas, factore.s de crecimiento, moléculas olfativas, pigmentos visuales )' neurotransmisores. En 1994, Alfred G. Gilman y Martín Rodbell recibieron el premio Nobel por el descubrimiento de las proteínas G y su papel en la señalización cel ular (véase h1tp:l/110belprize.org/11obel_prizes/111edici,,e). Las proteínas G reciben su nombre del hecho de que son nucleó tidos de guanosina. Las proteínas G inactivas están unidas a difosfato de guanosina (GDP). El intercambio de GDP por trifosfato de guanosina (GTP) activa la proteína G. Cuando las proteínas <,; están activadas, ( _I ) abren un can.al iónico de la membrana o ( 2) cientos de receptores asociados a proteínas G, y la lista sigue crecie ndo. Los tipos de ligandos que se unen a los receptores asociados a proteína G incluyen hormonas, factores de crecimiento, moléculas olfativas, pigmentos visuales y neurotransmisores. En 1994, Alfred G. Gi lman y Martín Rodbell recibieron el premio Nobel por el descubrimiento de las proteínas G y su papel en la señalización celular (véase http://1,obelprize.org/1 ,obel_prizesln ,ediL'i11e). Las proteínas e; reciben su nombre del hecho de que son nucleótidos de guanosina. Las pro teí:nas G inactivas están unidas a di fosfato de guanos ina (GDP ). El intercambio de GDP por trifosfato de guanosina (GTP) activa la proteína G. Cuando las proteínas G están activadas, ( 1) ab ren un canal iónico dt> la membrana o (2 ) alteran la actividad enzimática en el lado citoplasmático de la membrana.

Las proteínas G unidas a enzimas amplificado ras representan la mayor pa rte de todos los mecanismos de transducción de señales. Las dos enzimas amplificadoras más comunes de los receptores asociados a proteína G son la adenili.lcidasa y la fosfol ipasa C. Las vías parn estas enzimas ampl ificadoras se describen a contin uación.

Muchas hormonas lipófobas utilizan vías GPCR-AMPc El sistema adenililciclasa-AMPc asociado a proteína G fue la primera vía de transducción de señales identificada Fi~. 6-8a). Fue descubierto t>n la década de l 950 por Earl Sutherland cua ndo estudiaba los efectos de las ho rmonas sobre el metabol ismo de los carbohidratos. Este descubr imiento demostró ser tan signiucativo para nuestra comprensión de la transducción de señales que, en 197 1, Sutherlan d fue galardonado con un premio Nobel por su trabajo. El sistema adenililcidasa-AMPc asociado a pro teí na Ges el sistema de transducción de señales de muchas hormonas proteicas. En este sistema, la ade11ililciclasa es la enzima amplificadora que convierte ATP en AMP cíclico (AMPc), que actúa como segundo mensa_iero. Luego, el AMP cíclico activa la protei11cinasa A (PKA), la cual, a su vez, fosforila otras proteínas intracelulares como parte de la e.aseada de señales.

<•

Los receptores asociados a proteína Gtambién utilizan segundos mensajeros derivados de lípidos Algunos recepto res asociados a proteína G están un idos a una enzima ampli ucadora diferente: la fosfol ipasa C (Fig. 6-Sb). Cuando una molécula de señalización activa esta vía asoc iada a proteína (;, la fosfolipasa C (PLC) convierte un fosfolípido de membrana (fosfatidili110sitol bifosfato) en dos segundos mensajeros derivados de lípidos: diacilglicerol e inositol trifosfato. El diacilglicerol (DAG) es un diglicérido no polar que permanece en la porción lipídica de la membrana e interactúa con la proteincinasa C (PKC), una enzima activada por Ca'~ asociada al lado citoplasmático de la membrana celular. La PKC fosforila proteínas citosólic.as que continúan la cascada de señales. El inositol trifosfato (IP,) es un mensajero hidrosoluble que abandona la membrana moviéndose por el citoplasma, donde se une a tlll canal de calcio en el retículo endoplasmático (RE). Esta unión del l P.1 ab re el canal de Ca'+, permitiendo la difusión del ion desde el RE hacia el citosol. El calcio es, en sí mismo, una importante molécula de señalización, como veremos a continuación.

Los receptores tipo integrina transfieren información desde la matriz extracelular Las i11tegri11as, proteínas que atrav iesan la membrana, participan de la coagulación sanguínea, la reparación de heridas, la adhesión y el reconocimiento celular de la respuesta inmune y del desplazamiento cel ular dw-an te el desarrollo. Del lado ~xtracelular de la membnu1a, los receptores tipo integrina se unen a proteínas de la matriz extracelular o a ligandos como anticuerpos ., . o moléCL1las involucradas en la coagu. RE hacia el citosol. El calcio es, en sí mismo, una importante molécula de señalización, como veremos a continuación.

Los receptores tipo integrina transfieren información desde la matriz extracelular Las i11tegri1ws, proteínas que atraviesan la membrana, participan de la coagulación sanguínea, la reparación de heridas, la adhesión y el reconocimiento cel ular de la respuesta inmune y del desplazamiento cel ular duran te el desarrollo. Del lado extracelular de la membrana, los receptores tipo integrina se unen a proteínas de la matriz extracelular o a ligandos como anticuerpos o moléculas involucradas en la coagulació n de la sangre. En el interior de la célula, las integrinas se adhieren al citoesqueleto a través de proteínas de a11chije (Fig. 6-3c). La

184

Capit ulo 6 Comunicación, integración y homeostasis

Transducción de señal asociada a proteína G (a) Transducción y amplificación de señales del sistema GPCR-adenililciclasa La molécula de señalización se une a un receptor asociado a proteína G (GPCR). el cual activa la proteina G.

Molécula de señalización Adenililciclasa

---.e_;

GPCR

Proteína G

11

~

ATP

La proteína G pone en marcha la adenililciclasa, una enzima amplificadora.

E)

La adenililciclasa convierte ATP en AMP cíclico.

( \

OOCr AMPc Prote~cinasa

_j ÁJO

¡fj \~

- -


Proteína fosforilada

OO O

¡¡~

!~~

00 0 0

La proteincinasa A fosforila otras proteínas, conduciendo en última instancia a una respuesta celular.

OO O

¡.¡,.¡,

G

0 0

o o oo.fo o o cfoQoºo':> Respuesta celular

El AMPc activa la proteincinasa A

/}~~ ~/}/} •••••••••••••••• •• ••• •• •• ••• ••. ""º .............

PREGUNTA Ut ilizando el patrón mostrado en la Figura 6-6a, dibuje una cascada que incluya el A l P, el AMPc, la adenililciclasa, la proteína fosforilada y la proteincinasa A.

•• ••• •• ••• •• ••• •• ••• •• ••• •• ••• (b) Transducción de señales del sistema GPCR-fosfolipasa C

o

Uquido extrace/ular

Molécula de seriaJización

u {

Fosfolípido de membrana

e

Receptor

DAG

PLC

Membrana celular

---..O ~

KC

(

PLC

Uquido

PKC ~ Receptor

IP3)

o/ depósito RE

e

La molécula de señalización activa el receptor asociado a la proteína G. • FIGURA 6-8

rProtóoa,~

Proteína fosforilada

Uquido intracelular

LEYENDA PLC = fosfolipasa e DAG = diacilglicerol PCK = proteincinasa C IP3 = inositol trifosfato RE = retículo endoplasmático

t)

La proteína G activa la fosfollpasa e (PLC), una enzima amplificadora.

La PLC convierte lípidos de m embra- C) El DAG activa la proteinna en diacllglicerol (DAG), el cual cinasa C (PKC), que permanece en la membrana, y en IP3, fosforila proteínas. el cual difunde hacia el citoplasma.

Ci) El IP3 produce la liberación de ca2+ desde ciertos orgánulos, generando una señal de ca2+.

Vías de señalización

un ión del ligando al receptor hace que las integrinas activen enzimas in tracelulares o alteren la orga nización del citoesqueleto. La importancia de los recepto res Lipo integ ri na se il ustra en liertos trastornos hereditarios en los que el receptor está ausente. En uno de ellos, por ejemplo, las plaquetas (fragmentos cel ulares que cumplen un papel fundamen tal en la hemostasia) carecen de una integrina; e.orno resultado, en esos individuos la coagulación de la sa ngre es defectuosa.

hallados en nervios y músculos. La activación de los receptores-canales inicia las respuestas in tracel ulares más rápidas entre todos los receptores. Cuando un ligando se une a la proteina que constitu)'e el receptor-canal, una compuerta del canal se al)l·e o se cierra, alterando la permeabilidad cel ular a ese ion. El aumento o la disminución de la permeab ilidad iónica modifican rápidamen te el po tencial de membrana de la célula, generando una sefial eléctrica que altera proteínas sensibles al voltaje (a Pig. 6-9). Un ejemplo de receptor-canal es el canal de ca tiones monovalentes ("de una carga") regulado por acelikolina del músculo esq uelético. El neurotransm isor acetilcolina liberado por una neurona ad)'ª · cen te se une al recepto r de acetikolina y abre el canal. Tanto el Na" como el K• ílU)'en a través del canal a1J ierro, saliendo el K• y entrando el Na• en la cél ula según sus gradien tes electroquímic.os. El gradiente

Las vías de señalización más rápidas modifican el flujo de iones através de canales Los recep tores más sencillos son canales ió nicos regulados por compuerta, y la mayoría de ellos son recepto res de neurotransmisores

Transducción de señales utilizando canales iónicos Moléculas de señalización O extracelulares

<)

Iones

o

Iones )

Receptorcanal

Re~ ptor ) asociado a proteína

---------1

Canal iónico

G

___,e_../

Iones

Í Los receptores-canales se abren o cierran en respuesta a la unión rtP. 11n,1 mnhk1Jfa rtP. sP.ñ,ilí7ar.ión.

Los receptores-canales se abren o cierran en respuesta a la unión de una molécula de señalización.

18S

de~~~!~i~~:ión intracelulares

Cambio en la permeabilidad al Na+, K+, CI· Cambio en la permeabilidad al Na+, K+, CI·

Genera una señal eléctrica

Proteína sensible al voltaje

• FIGURA 6-9 Transducción de señales mediante canales iónicos

loo~ /

r-A - lg_u_n_o_s_c a _n _a _l-e_s_e_s_t_á_ n_d_i-re_c_t_a-, mente unidos a proteínas G. Algunos canales están directamente unidos a proteínas G.

Otros canales responden a segundos mensajeros intracelulares.

Mapa conceptual de la transducción de señales

Molecula de señahzacion liquido exttacelular

Ione s Receptor de membrana

Membrana celular

Canal iónico +-- - - altera - - - Activa una - - - -• regulado por protelna G , - - - - - - . compuerta

~ alteran

Segundos mensajeros

t

j

í

Desencadena la liberación deea2 ~desde cie.1os orgánulos

)

Altera el crtoesqueleto

fosforila

t

aclivan

l

genera

Señal eléctrica

Activa una tiros,ncinasa

l

1

1

t

Activa o inhíbe una enzima ampllñcadora produce

Los iones se desplazan hacia dentro o hacia fuera dela célula

Cambio en la concentración iónica

¡

¡

Proteincmasas se unena ~

J

r-

----~ ~---·---

, -_ _ _ _ _ _ _ _ _ _

fosforilan

Proteínas alteradas

Respuestas celulares

liquido intracelular

son cambios en

motoras

se-mu e1ectnca--..r_ _ _ _ _ _ _ _ __

...,._

Respuestas celulares

liquido intracelular

son cambios en

de sodio es más fuerte, po r lo que la entrada neta de Na- co n carga positiva despolariza la célula. En el músculo esq uelético, esta cascada de eventos intracelulares resulta en la contracción muscular. No toda la transducción de señales en la que participan canales iónicos está mediada po r receptores-canales. Algunos canales ión icos regulados por ligando son controlados por segundos mensajeros intracelulares, ta les como AM!'c o ATP. Los canales de K· regulados por ATP de las células beta pancreáticas so n un ejemplo !Fig. 5-27].

Otros canales iónicos se abren o se cierra n en respuesta a señales exLracelulares, pero el ligando no se une directamen te al canal pro teico sino a un receptor asociado a proteína G q ue está tm ido a un cana l iónico. La • Eig110J 6- l OPS un mapa conceptual del mecanismo básico de la transducción de señales que muestra las relaciones generales en tre pri meros mensajeros, receptores de membrana, segundos mensajeros)' respuestas celulares.

Revisión

El calcio como mensajero intracelular

9. Nombre las cuatro categorías de receptores demembrana.

1O, ¿Cuál es la difeiencia entre un primer mensajeroy un segundo mensajero?

Uquído extrace/ular

11. Orde~ los siguientes términos en lasecuencia correcra deuna vía de transducción de señales: (a) respuesta celular, receptor, segundo mensajero, ligando (b) enzimaamplificadora, respuesta celular, proteína fo,-forilada, proteincinasa, segundo mensajero

Señal eléctrica

El canal de Ca2+ regulado por voltaje se abre.

12. En cada una delas siguientes situaciones, la célula, ¿sedespolariza o se hiperpolariza? (a) se abre el canal de a· (b) se abreel canal de K" (c) seabre el canal de Na' ~ liberado desde

~ depósitos intracelulares Moléculas de señalización novedosas

de Ca2+_

t

En las secciones siguien tes se presentan algunas moléculas de señalización inusuales q ue son importan tes en la fisiología y la medicina; incluyen un ion (Ca 2•) , Lre.s gases)' una familia de mensajeros derivados de lípidos. Los procesos contro lados por estas moléculas de señalización se conocen desde hace años, sin embargo las señales de conLrol han sido descubiertas recientemente.

I ( Uquído intracelular

J

2

3

El Ca'· se une a la proteina calmodulina, hallada en todas las células. La Ltnión del calcio altera la actividad enzimática o transportadora o morufica las compuertas de los canales iónicos. El calcio se une a otras proteínas reguladoras y altera el movimiento de proteínas contráctiles o citoesqueléticas como los microtúbulos; por ejemplo, la unió n del Ca1 • a la proteína reguladora tropmzina inicia la contracción muscular en una célula de músculo esquelético. El Ca2• se une a proteínas reguladoras para desencadenar la exocitosis de vesículas secretoras; po r ejemplo, la liberación de insulina desde las células beta pancreát icas ocurre en respuesta a una señal de calcio.

2

El Ca + cítoplasmático aumenta,

El Ca2+ se une a proteínas.

Señal química

Calmodulina )

\ Otras proteíhas ligadoras de Ca2+

...---::.1 Altera la

El calcio es una señal intracelular importante Los iones calcio son los mensajeros ión icos más versátiles (a Eig 6-11). El calcio se incorpora a la célula a Lravés de ca nales de Ca,. regulados por voltaje o bien median te canales regulados po r ljgando o con comp uerta mecánica. El calcio tamb ién puede ser libe rado desde compartimen tos intracelulares po r segundos mensajeros, como el IP,. La mayo r parte del Ca'· intracelular está almacenado en el retículo endoplasmático, donde se concen tra mediante un mecanismo de transporte activo. La liberación de Ca2• hacia el cito.sol (desde cualquiera de las fuentes recién mencionadas) genera una señal de Ca'·, o "chispa" de Ca'+, que puede ser registrada ulilizando técnicas de análisis de imágenes especiales para detectar Ca'· ( véase el recuadro 13iotec11ología sobre las señales de calcio ). Los iones calcio se comb inan con p roteínas citoplasmáticas ligadoras de calcio para ejerce r sus d iversas funciones. Muchos tipos de mecan ismos dependien tes de calcio ocurren en la cél ula:

------1'

• FIGURA 6-11

4

5

El Ca'· se une d irectamente a canales iónicos para alterar el estado de su compuerta. Un ejemplo de esto es un canal de K+ activado por Ca'• hallado en células nerviosas. La entrada de Ca2• al óvulo fertilizado in icia el desarrollo del embrión. Revisión

13. la concentlación deCa" enel líquido extracelular promedialos 2,5 mmol/L la concen· tración de c;J• libre es de alrededor de 0,001 mmoVL Si una céluladebe moveriones cal· cio desde sucitosol haciael líquido extracelular, ¿utilizará transporte pasivo oactivo? Explique.

Los gases son moléculas de señalización efímeras Los gases solubles son moléculas de señalización paracrinas/autocrinas de acción corla que actúan cerca de do nde son producidas. La molécula de señal gaseosa que m,\s conocemos es el óxido nítrico (NO), pero el monóxido de carbono y el sulfuro de h idrógeno, dos gases más conocidos po r sus efectos nocivos, también pueden actuar como señales locales. DLLran te afios, los investigadores supieron de una molécula de señafüación de corla duración producida por las células endoteliales de los vasos sanguíneos. In icialmente, la llamaron factor de relajaciá11 derivado del e11dote/io (EDRF, por sus siglas en inglés). Esta molécula

188

Capit ulo 6 Comunicación, integración y homeostasis

Las señales de calcio brillan en la oscuridad Si alguna vez metió su mano en el interior del agu a de un océa no tropical de noche y observó el brillo de las medu sas bioluminiscentes, usted lo qu e ha visto una señal de calcio. La aequorina, un complejo proteico obtenido de la med usa, es una de las moléculas que los científicos utilizan para detectar la presencia de iones calcio d urante la respuesta celular. Cuando la aequorina se combina con el calcio, emite una luz q ue puede ser medida por sistemas electrónicos de d etección. Desde la primera vez que se utilizó la aequorina, en 1967, los investigadores han diseñado indicadores cada vez más sofisticados que les permiten seg uir las se ñales de calcio dentro de las célu las. Con la ayuda de moléculas denominadas fura, verde Oregón, BAPTA y camaleones podemos observar los iones calcio difundir a través de las uniones en hendidura y salir de los orgánulos intracelulares.

diíunde desde el endotelio hacia las células de músculo liso adyacentes, ocasionando la relajación muscular y la dilatación de los vasos sanguíneos. Los cienLífícos tardaron años en identificar el EDRF como óxido nítrico a causa de su rápida degradación, con una vida media de solo 2 a 30 segundos ( vida media es el tiempo necesario para que la sefial pierda la mitad de su actividad). Como resultado de este arduo trabajo sobre el NO en el aparato cardiovascular, Robert Furchgott, Louis Ignarro y Ferid Murad recibieron en 1998 el premio Nobel de fisiolo gía y medicina. En los tejidos, el NO es sintetizado por la acción de la enzima óxido rlÍtrico si11tasa (NOS, por sus siglas en inglés) sobre el aminoácido arginina:

oxido nilrk o s,masa arginina + O, - - - --ll~ NO+ citrulina ( un aminoácido)

aíd1ñirl'a + U., - ·- ·- - --ll~

l\i(J +'ciLrul,ria ( un áininoiíc,do)'

El NO producido en esta reacción d ifunde hacia el interior de las células diana, donde se une a un receptor que activa la forma citosólica de la guanililciclasa y provoca la formación del segundo mensajero GMPc. Además de la relajación de los vasos sanguineos, en el encéfalo, el NO actúa como neurotransmisor)' como neuromodldador. El monóx:ido de carbon o (CO}, un gas conocido principalmente por sus efectos tóxicos, también es una molécula de señalización producida en mínimas cantidades por ciertas células. Como el NO, el Cü acLiva la guanilikicla~ (formación de GMl'c), pero también puede actuar independientemente para ejercer sus efectos. El monóxido de carbono tiene como dianas el m(L~culo liso y el tejido nervioso. La molécula de señalización más recientemente descripta e,s el s ulfu ro de hidrógeno (H2S). El sulfuro de h idrógeno también actúa sobre el aparato cardiovascular relajando los vasos sanguíneos. El ajo es una fuente dieLaria importante de precursores que contienen azufre, lo que puede explicar los resulLados de los estudios que sugieren que comer a_jo tiene un efecto protector sobre el corazón.

La ortiga de mar Chrysaora fuscescens.

De la dinamita ala medicina ¿Quién habría pensado que un componente del esmog y un derivado de la dinamita resultarían ser un mensajero biológ ico? Ciertamente, no lo pensaron así los revisores que rechazaron en un principio los intentos de Louis lgnarro por publicar los resultados de su investigación sobre el gas escurridizo. Sin e mbargo, la capacidad de los compuestos q ue contienen nitrógeno para relajar los vasos sanguíneos ha sido conocida desde más de 100 años, cuando los trabajadores de la fábrica de d inamita de Alfred Nobel comenzaron a quejarse de dolores de cabeza, ocasionados por la vasod ilatación inducida por nit ratos. Desde 1860, los médicos han utilizado nitroglicerina para al iviar la angi na de pecho, dolor cardíaco que resulta de la constricción 9.~.lilJUtrJ~[¡¡s ~qr_q11¡¡rJ;i.~~~.l!lJ. l:\oyL l.9~P¡Kientei ~;,rdía.i:J¿s_l le1860, los médicos han utilizado nitroglicerina para aliviar la angina de pecho, dolor cardíaco que resulta de la constricción de las arterias corona rias. Aun hoy, los pacientes ca rdíacos llevan pequeñas pastillas de nitrog licerina que colocan debajo de su lengua cuando el dolor aparece. Supuso años de trabajo conseg uir aislar el óxido nítrico (N O), gas de corta duración que constituye la molécu la activa derivada de la nitrog licerina. Pese a toda nuestra tecnol ogía del siglo veintiuno, la investigación di recta sobre el NO todavía plantea dificultades. Muchos estudios evalúan su influencia de una forma indirecta estudiando la ubicación y la actividad de la óxido nítrico sintasa (NOS), la enzima que sintetiza el NO.

Algunos lípidos son señales paracrinas importantes Uno de los desarrollos interesantes provenientes de la secuenciación del genoma humano )' dela utilización de genes para encontrar proteínas ha sido la identificación de los receptores huérfanos, receptores

Mod ulación de las vfas de señali zación

La cascada del ácido araquidónico Uquido extrace/ular

2 Fosfolípidos de membrana 1

PLA2

Uquido intracelular

i

Actividad de segundo mensajero

Ácido

/ipoxigenasa

I ( Leucotrienos )

cic/oxigenasa (COX 1, COX2)

Paracrinas liposolubles

\

Prostaglandinas

Tromboxanos LEYENDA PLA2 = fosfolipasa A2

a FIGURA 6- 12 q ue no tienen un ligando conocido. Los c.ien Lificos intentan trabajar en sentido inverso a través de las vías de señalización para encontrar los ligandos que se unen a estos receptores huérfanos. Gracias a este tipo de investigaciones los científicos reconocieron la importancia y la universalidad de los eicosanoides, señales paracrinas derivadas de lípidos que cumplen papeles importantes en muchos procesos füio lógicos. Todas las moléculas de señalización de tipo eicosanoides derivan del ácido araqtLidónico, un ácido graso de 20 carbonos. El proceso de sintesis es una red llamada cascada del ácido araquidónico Eig 6.12). Para mayor simpl icidad, d ivid iremos la cascada en pasos. El ácido araqLLidónico es producido a partir de fosfolípidos de

<•

sn 11.-1.~.,.

l...>

·u1·1ct , 1-.\.l -;,&.., , ,d...1<1 1.,t.i,.·.H.-t-«.c~· au.-, ,\<,,-1,;c, · f.1 l.;. ,l , 1fl.fvll t?.J\'tl-"0€;

l ,..

.12). Para mayor simpl icidad, dividiremos la cascada en pasos. El ácido araqu idón ico es producido a partir de fosfolípidos de membrana por acción de u na enzima, la fosfolipasa A2 (PLA2). La actividad de la PLA2 es controlada po r ho rmonas y otras señales. El ácido araquidónico, por sí mismo, puede actuar d irectamente como segundo mensajero, alterando la actividad de canales iónicos y de enzimas inlracelulares. También puede ser convertido en varias clases de eicosano ides paracrinos. Estas moléculas liposolubles pueden difundir hacia fuera de la célula y c.ombinarse con recepto res de células veci nas para ejercer su acción. Existen dos grupos principales de moléculas derivadas del ácido araquidónico que hay que conocer: l

Los leucotrienos son moléculas producidas por la acción de la enzima lipoxigenasa sobre el ácido araquidónico {leuko-, blanco,+ triene, una molécula con tres enlaces dobles entre átomos de carbono}. Los leucotrienos son secretados por ciertos tipos de glóbulos blancos. Estas moléculas cumplen un papel significativo en el asma, una enlennedad pulmonar en la cual el músculo liso de las

189

vías aéreas se constriñe dificultando la respiración, y en la severa reacción alérgica conocida como anafili1xia. Por esta razón, las empresas farmacéulirns han estado desarrollando activamente fármacos para bloquear la síntesis o la acció n de los leucotrienos. Los prostanoides son moléculas producidas cuando la enzinm cicloxigenasa (COX) actúa sobre el ácido araquidónico. Los prostanoides incluyen las prostaglandinas y los tromboxanos. Estos eicosanoides actúan sobre muchos tej idos del cuerpo, inclui dos el músculo liso de varios tejidos, las plaquetas, los riñones y el hueso. Además, las prostaglandinas están involucradas en el suef10, la inflamación, el dolo r y la fiebre.

Los fármacos antiníl amatorias no esteroideas (AJNE ), como la aspirina y el ibuprofeno, ayudan a prevenir la in flamación inh ibiendo las enzi mas COX )' dismi nurendo la síntesis de prostaglandinas. Sin embargo, las AINE no son específicas )' pueden tener serios efectos adversos indeseables, como hemorragias gástricas. El descubrimiento de dos isoenzimas COX, COX I y COX2, permitió el diseño de fárm acos que tienen como objetivo llíla isoenzima COX específica. Al inhibir solo la COX2, enzima que produce las prostaglandinas inflamatorias, los médicos esperaban tratar la inflamación con menos efectos adversos. Sin embargo, varios estudios han demostrado que algunos pacientes que toman inhibidores ele la COX2 y o Lras AfNE tienen mayor riesgo de ataques cardíacos y apoplejias, por lo que estas larmacos no se recom iendan para su uso prolongado. Los eicosanoides no son las únicas moléculas de señalización lipídicas conocidas. Los lípidos llamados esftngolfpidcs también actúan como señales extracelulares para ayudar a regular la inflamación, la adhesión y migración celular y el crecimiento y muerte de las células. Al igual que los eic.osanoides, los esfingolípidos se combi nan con receptores asociados a la proteína Gen las membranas de sus células diana. Revisión

14. Una droga bloquea laacción de los leucotrienos enstJS células diana. Unadroga diferente bloquea la síntesis de leucotrienos. Utilice lo quehaaprendido sobre leucotrienos, moléculas


.,,Modulación de las vías Modulación de las vías de señalización Como usted ha aprendido, las vías de señalizació n de la célula pueden ser muy complejas. Para complicar las cosas, células diferen tes pueden responder diferenlemen te a un mismo tipo de molécula de señal ización. ¿Cómo puede una molécula desencadenar la respuesta A en el tejido I y la respuesta B en el tej ido 2? En fa mayoría de las moléculas de selinlizació11, la respuesta de la célula dinnn depende de su receptor o sus v/as intmce/11/nres asociadas)' no del ligando.

Un ligando puede tener múltiples receptores Durante muchos años, los fisiólogos fueron incapaces de expl icar que una molécula de señalización individual pudiera tener d iferentes efectos en tejidos diferentes. Por ejemplo, la neurohormona adrenalina dilala los vasos sanguíneos del músculo esq uelético pero contrae los vasos sanguíneos intestinales. ¿Cómo puede una sustancia tener efec.-

La respuesta de la diana depende del receptor diana. En este ejemplo, los vasos sanguíneos se dilatan o contraen según su tipo de receptor.

Respuesta del receptor o: Receptor ,x

La adrenalina puede unir0-, se a diferentes isoformas del receptor adrenérgico.

El ligando principal activa un recep tor.

Un agonista también activa el receptor.

<>

Q i Q

¿

Respuesta del receptor 132

Un antagonista bloquea la actividad del receptor.

--- ~,___

Receptor 132

8

Adrenalina + receptor o:

No hay respuesta

• FIGURA6-14

El vaso se contrae. El vaso se d ilata.

• FIGURA6-13

tos opuestos? l a respuesta resultó evidente cuando los cienúficos descubrieron que los recepto res, al igual que otras p ro teínas, pueden existir e.orno fami lias de isoformas relacionadas. La respuesta celular que sigue a la un ió n de una molécula de señal con su recepto r depende de la isoforma del receptor que esté involucrada. Po r ejemplo, los receptores adrenérgicos a y~, para la adrenalina son isofo rrnas entre sí. Cuando la adrenal ina se une a los recepto res a del músculo liso de los vasos sanguíneos intest inales, las vías de señalitación in ician una cascada que ocasio na la constricció n de los vasos (a Fig. 6-13). Cuando la adrenalina se une a los receptores ~1 de los vasos sa nguíneos de ciertos músculos esqueléticos, las vías de transducción de señales asociadas ge11eran la dilatación de los vasos. En o tras palabras, la respuesta de un vaso sangtúneo a la adrenalina depende de la isoforma del recepto r y su vía de cransd ucción de señales y no del ligando que activa al receptor. Hoy en día, muchas fármacos son diseñadas específicamente para una isoforrna de un determ inado receptor.

Los receptores presentan saturación, especificidad y competición Deb ido a que los receptores son proteínas, la unión en1 re un receptor y su ligando exhibe las características generales de la un ión proteínaligando, como son la especificidad, la competición )' la saturación [analizadas en el Capítulo 2). Reacciones de u nión a proteínas similares ocurren en las enzimas [Capítulo 4) y en los transportadores !Capítulo 5 1.

Especificidad y competición: múltiples ligandos para 1111 receptor Los receptores tienen si Lios de un ión para sus ligandos, al igual que las enzimas y los transportadores. Como resultado, diferentes ligandos

con estructuras similares pueden ser capaces de uni rse al mismo receptor. Un ejemplo clásico de este pri ncipio corresponde a dos neurocrinas responsables de la respuesta fren te al peligro: el neurotransmisor ,zoradrenalina y su p1;ma, la neurohormona adrenalina (también llan,ada epínefrina). Ambas moléculas se unen a receptores adrenérgicos (11dre11érgico es el adjetivo que se refiere a la adrenalina). La capacidad de los receptores adrenérgicos para unirse a estas neu rocrinas, pero no a o tras, demuestra su especificidad. La adrenalina y la noradrenalina también compilen po r un mismo tipo de recepto r. Ambas neurocr inas se unen a subtipos de receptores adrenérgicos denominados alfa (O'. ) y beta (~). Sin embargo, los recepto res a tienen una mayor afinidad por la noradrenalina, mientras que los receptores~ la tienen por la adrenali na.

Agonistas y ,m tagonistas Cuando un ligando se combina con un receptor ocurre w10 de estos eventos: el ligando act iva el recepto r y desencadena una respuesta o b ien ocupa el s itio de unión )' evita que el receptor genere una re.spuesta (a Fig. 6- 14 ). Los ligandos que activan recepto res se conocen como agonistas. l os ligandos que bloquean la activ idad de los receptores se llaman a ntagonistas. Los fa rmacólogos utilizan el principio de agonistas competido res para diseñar medicamentos que actúan de forma más prolongada y q ue son más resistentes a la degradación enzirnáLica que los ligandos endógenos producidos por el cuerpo {endo-, den tro de,+ -ge11011s, desar rollo}. Un ejemplo es la familia de estrógenos (hormonas sexuales femeninas) modificados de las pastillas ant iconceptivas. Estos fármacos son agon istas de los receptores de estrógenos natura les, pero poseen grupos quím icos a11adidos q ue las protegen de la degradación )' prolongan su vida activa. Revisión

1S. ¿Quétienenen común recept0r5, enzimas y tran;portadore; queexplique por qué todos presentan saturación, especificidad ycompetición? 16. la1nsurinaaumenta el número de transportadores de glucosa en la membrana de una

célula de músculo esquelético, pero noenla membrana deunaci lula hepática. liste dos posibles mecanismos que puedanexplicarcómodicha hormona puede generar estos dos efectosdifurentes.

Modulación de las vfas de señali zación

La regulación por incremento y la regulación por disminución permiten a las células modular las respuestas La sat uración de las proteínas se refiere al hecho de que la activ idad de la pro teína alcanza una velocidad máxi ma a causa de q ue las células poseen cantidades limitadas de moléculas proteicas. La saturación puede ser observada en enzimas, transportadores y receptores; por lo tanto, la capacidad de una cél ula para responder a u na señal q uím ica puede ser limi tada po r el n(Lmero de receptores para esa señal. Una célula individual posee entre 500 y LOO 000 recepto res en la superficie de su membrana ce lular, con recepto res adicionales en el ci tosol y en el núcleo. En una cél ula determ inada, el número de receptores cambia en el tiempo. Los recepto res viejos son el im inados de la membrana por endoci tosis y degradados en lisosornas. Receptores nuevos se insertan en la membrana por exocitosis. Los recepto res in tracelulares también son sin tetizados y degradados. Esta flex ibilidad permite que una cél ula modifique sus respuestas frente a las señales q uím icas dependiendo de las condiciones extracelulares y de sus necesidades in ternas. ¿Qué sucede cuando una molécula de señalización está presente en el cuerpo en concentracio nes anormalmen te altas por un período de tiempo sostenido? In icialmente, el nivel de señal aumentado genera una mayor respuesta. Mientras continúe esta respuesta aumentada, las células d iana pueden inten tar devolver s u respuesta a la no rmalidad mediante la regulación po r d isminución o por desensibil ización de los recepto res de dicha señal. La regulación por disminució n ("down- regulation") es una reducción del número de receptores. La célula p uede elim inar físicamen te los receptores de la membrana celular {Fig . 5- 19]. Una manera más rápida y más fácilmente reversible de disminui r la respuesta celular es la desensibilizaci6n, que puede lograrse mediante la unión de un modulador químico a la pro teína receptora; por ejemplo, los recepto res adrenérgicos ~ descr iptos en la sección ante rior pueden ser desensib ilizados por fosforilación. El resultado de la reducción del n(Lmero de recepto res o de su desensibilización es una respuesta disminuida por parte de la célula d iana incluso si la concenLración de la molécula de señalización permanece alta. La regulación por disminución y la

TEMA RELACIONADO

"Mi padre se inyecta insulina para su diabetes - dice Marvin- . ¿Qué hace la insulina?" La enfermera contesta que, normalmente, la insu lina ayuda a la mayoría de la·S células a incorporar y uti lizar glucosa. Sin e mbargo, en ambos tipos de diabetes las concentraciones de glucosa en ayunas están elevados debido a que las células no puede n incorporar y utilizar la glucosa normalmente. Si las personas con diabetes tipo 1 reciben inyecciones de insulina, sus niveles de glucosa en sangre disminuyen. Si las personas con diabetes tipo 2 reciben insulina, los niveles de glucemia pueden variar muy poco. P3:

¿En qué tipo de diabetes es más probable que los receptores de insulina estén sometidos a reg ulación por incremento?

175

178 •

194

196

198

202

191

desensib ilización son una explicación para el desarrollo de tolem11cii1 a /osfármams, una situación en la cual la respuesta a una dosis determ inada d isminuye a pesar de la expos ición conti nua al fármaco. En la situación opuesta, cuando la concentració n de tm ligando disminuye, la célula diana p uede utilizar la regulación por incremento (" up- regulalion") para intentar man tener s u respuesta en niveles normales. En este caso, la célula diana inserta m,\s receptores en la membrana; por ejemplo, si una neurona está dai1ada )' es incapaz de liberar cantidades no rmales de un neurotransmisor, la cél ula diana puede aumentar el número de receptores. Más receptores vuelven la célula diana m,\s sensible a los neurotransm isores que estén presentes. La regul ación po r incremen to también es programada d urante el desarrollo como un mecanismo q ue perm ite a las células variar su respuesta a facto res de crecimiento y otras moléculas de señal ización. Revisión 17. Para disminuir la afinidadde unión de un receptor, una célula puede (elija todas las que correspondan): {a) sintetizar una nueva isoforma del receptor (bj eüminar receptores de la membrana (c) insertar nuevos 1eceptores en la membrana (d) utilizar un modulador covalente [Sugerenda: p. 54]

las células deben ser capaces de detener las vías de señalización En el cuerpo, las señales se activan)' se desactivan, po r lo q ue las células deben ser capaces de reconocer el fin de una señal. Esto requiere que los procesos de señalización cuenten con mecanismos de termi nació n; por ejemplo, para detener la respuesta a una señal de calcio, una célula elimine el Ca1 - del citosol bombeándolo de vuelta hacia el retículo endoplasmálico o hacia el líquido extracelular. La actividad del receptor puede ser deten ida de var ias formas. El ligando extracel ular puede ser degradado por enzimas del espacio extracelular ( un ejemplo es la degradació n del neurotransmisor acelilcol ina). O tros mensajeros quím icos, particularmente los neurotransmiso res, pueden ser elim inados del líquido extracel ular median te el transporte hacia el in terior de cél ulas veci nas. Ciertas antidepresivos ampl iamente utilizados, llamadas iuhibidr,res selectivos de la te el transporte hacia el in terior de cél ulas veci nas. Ciertas antidepresivos ampl iamente ut ili:z.ados, llamadas inhibidores selectivos de la recaptaci611 de serotonina o JSRS, prolongan la vida activa del neurotransmisor sero tonina al disminui r la velocidad de elim inació n del líquido extracelular. Una vez que el ligando está un ido a su recepto r, la actividad también puede ser final izada por endocirosis del complejo ligando-receptor [ilustrado en la Fig. 5-19). Después de la entrada de la vesícula en la célula, el liga ndo es elimi nado )' los recep tores pueden ser devueltos a la membrana por exocitosis.

Muchas enfermedades yfármacos tienen como objetivo las proteínas de transducción de señales A medida q ue los investigadores aprenden más sobre la señalización cel ular entienden cómo muchas enfermedades están relacionadas con problemas en las vías de señal.izació n. Las enfermedades pueden ser causadas po r alterac iones en los receptores o por prob lemas con las proteínas G o con las vías de segundos mensajeros ( véanse algunos

192

Capitulo 6 Comunicación, integración y homeostasis

Vías reflejas homeostáticas Algunas enfermedades otrastornos relacionados con mecanismos de señalización anormales

Receptores anormales heredados genéticamente

Alteración fisiológica

Enfermedad o trastorno resultante

Receptor d e vasopresina (defecto ligado al cromosoma X)

Acorta la vida media del receptor

Diabetes insíp ida congénita

Sensor de calcio de la glándula parati roidea

No responde a un aumento en la concentración plasmática de Ca 2•

Hipercalcemia fam iliar

Receptor

Receptor d e rodopsina de la retina

Plegamiento proteico inadecuado

Retinit is pigmentosa

l os mecan ismos de señal ización celular descritos son habitualmente solo un pequeño compo nente de los sis1emas de señal ización corporal que mantienen la homeosiasis. En los mecanismos de control locales, se prod ucen cambios relativamente aislados en una célula o tejido y las señales quím icas paracr inas o au1ocrinas q ue se liberan cons1iluyen la vía en su to tal idad. Pero en las vías de control reflejas, que son más complejas, la información debe ser transm iLida po r el cuerpo median te la utilización de señales q uím icas o una combinación de señales eléctricas y químicas. En la última sección de este capítulo estudiaremos algunos de los patrones de las vías de conl ro l reflejas que us1ed enconlrará en su estud io de los diversos sistemas y aparatos del cuerpo.

Los postulados de Cannon describen las variables reguladas y los sistemas de control Walter Cannon, el padre de la fisio logía estadoun idense, describ ió muchas propiedades de los sis1emas de control homeostáticos du ran te la década de 1920 basá ndose en sus observaciones del cuerpo sano y ante d iversos estados patológicos.* Los cua1 ro postulados de Canno n son:

Toxinas que afectan las vías de señalización Trastorno resultante

Toxina

Efecto fisiológico

Toxina de

Bloquea la inhib ición de la adeni lilciclasa (es decir, la mantiene act iva)

Tos ferina o tos convulsa

Bloquea la actividad enzimática de las proteínas G; mantiene la célula produciendo AM f'c

Secreción d e iones hacia la luz intest inal, causando diarrea masiva

Bordetel/a pertussis

Toxina colérica

ejemplos en el • Cuadro 6- l ). Un único camb io en la secuencia de am inoácidos de un receplo r proLeico puede alLerar la forma del sitio de unión del receptor, des1ruyendo o modificando de esa manera SLL activ idad. aminoácidos de un receptor proteico puede allerar la forma del si tio de unión del receptor, destru)'endo o modificando de esa manera su activ idad. Los fa rmacólogos utilizan la in formación sobre los mecanismos de señalización diseñando fármacos para curar enfermedades. Algunos fármacos de ampl ia uti lización son los an tagon is1as de los recep lo res de angiotensina (AR!3, por stis siglas en inglés), los bloquean tes del recep1o r ~-adrenérgico ("beta-bloquean les") y los bloqueanles allcicos para el tratamien10 de la p resión arterial elevada; los moduladores selectivos de los receptores de es1rógenos (SERM, po r sus siglas en inglés) para tralar ciertos cánceres dependientes de estró genos; y los an1agonis1as del receptor de his1amina tipo 2 (recep1o r H1 ) para dismin uir la secreción de ácido en el estómago. Volve rá a encontrar muchos de estos fármacos cuando es1udie los sistemas y aparaLOs en los cuales actúan.

2

3

El sistema nervioso cumple un papel en el mantenimiento del "buen estado" del medio interno. En este con texto, buen estado signi fica "condiciones que son compatibles con la función no rmal''. El sistema nervioso coordina e integra la información acerca del vol umen de sangre, la osmolaridad sanguínea, la p resión a rterial y la Lemperatura corporal, en tre 01ras variables reguladas (en fisiología, una variable regulada tamb ién se conoce como parámetro !para-, al lado, + meter, medida}). Algunos sislemas corporales se encuentran bajo control tónico !tonos, tono}. Citando a Cannon: "Puede existir un agente con una actividad moderada q ue pueda ser aumentada o dism in uida''. El contro l tón ico es como el con1ro l del volumen de una radio: la radio puede estar siempre encendida, y girar un bo1ón puede hacer que el n ivel de sonido sea más alto o más bajo. Un ejemplo fisiológico de un sistema controlado tónicamen te es la regulación nerviosa del d iámelro de determ inados vasos sanguíneos; en es1e proceso, cuando la señal de entrada proveniente del sistema nervioso se ve aumentada, el diámetro disminuye, y cuando la señal está disminuida, el d iámetro aumen ta (a Fj¡;. 6-ISal. El control 16nico es uno de los conceptos más di fíciles en fisiología, ya q ue 1endemos a pensar en resp uestas mi nuye, y cuando la seiial está d isminuida, el d iámetro aumenta (a Fig. 6- LSa). El control t6nic.o es uno de los conceptos más difíci les en fisiología, ya q ue tendemos a pensar en resp uestas q ue com ienzan o se detienen cuando un con Lrolador se activa o se desactiva en lugar de pensar que la respuesta, siempre en fu ncionamien to, puede aumen tar o disminuir en intensidad. Algunos s istemas corporales es tán bajo con trol antagonista. Can non escribió: "Cuando se sabe q ue un iactor puede c-amb iar el estado homeostático en una d irección, es razonable buscar un facto r o faclores que 1engan un efeclo conlrario''. Los sistemas q ue no están bajo cont rol tón ico habitual.mente se encuentran

• W. B. Cannon. Organization for physiological homeostasis. Physiological Reviews 9: 399-443, 1929.

CONTROL TÓNICO (a) El control tónico regula parámetros fisiológicos mediante la regulación por incremento o por disminución. La señal siempre está presente, pero cambia su intensidad.

Velocidad de señal disminuida

el vaso se dilata

'- 1', •

-L

r{

eambio en la Velocidad

señal

Señales ~ :+--t eléctricas Tiempo - - -de u na Una velocidad d e señal neurona mod erada tiene como resultado un vaso sanguíneo de diámetro intermedio

de

1

"\, .'

1

.,

_)

1

\. -

Tiempo Si la velocid ad de señal disminuye, el vaso sanguineo se dilata. Velocidad de señal aumentada

~

el vaso se contrae

)

""1( ~

11111111111111111 Tiem po -

Si la velo cidad de señal aumenta, el vaso sanguíneo se contrae.

CONTROL ANTAGONISTA (b) El control antagonista utiliza señales diferentes para modificar un parámetro de formas opuestas. En este ejemplo, neuronas antagonistas controlan la frecuencia cardíaca: algunas la aceleran mientras que otras la desaceleran.

La e stimulación p or los nervios simpáticos aumenta la frecuencia cardíaca. Latid os cardíacos

o Neurona simpática

1

1

2 - - Tiem po (s) -

1

Neurona p arasimpática La estimulación por los nervios parasimpáticos disminuye la frecuencia cardíaca.

Latidos

___-¡ cardíacas

J_. o

J._

1

i - - Tiempo (s) -

º

PREGUNTA ¿Cuáles son los valores de frecuencia cardíaca (en latídos/min) que se muestran en los d os ECG?

• FIGURA 6-15 Control tónico y antagonista de variables reguladas

1 2

j,_ 1

3

194

Capítulo 6 Comunicación, integración y homeostasis

las vías a larga distancia mantienen la homeostasis "¿Por qué es mala una concentración elevada de g lucosa en san· gre?~ pregu nta Marvin. ' La glucemia e levada no es mala en sí mi sma - responde la enfermera- , pero cuando permanece alta tras una noche de ayuno sugiere q ue hay algo mal en la forma en que t u cuerpo reg ula e l metabolismo de la glucosa." Cuando una persona normal absorbe los carboh idratos del alimento que ingi· rió, los niveles de glucosa en sa ngre aumentan y estimulan la libe· ración de in sulina. Cuando las células han absorbido la glucosa del alimento y los niveles de glucemia disminuyen, la secreción de otra hormona pancreática, llamada glucagón, aumenta. El glucagón eleva el nivel de glucosa en sa ngre y ayuda a mantenerlo dentro del rango homeostático. P4: La regulación homeostática de los niveles de glucosa en sangre por las hormonas in sulina y glucagón, ¿de cuál de los postulados de Cannon es un ejemplo? 175

4

4

178

191

196

198

202

bajo co/1/rol a11tago11ista, ya sea por acción de hormonas o del sistema nervioso. En las vías controladas por el s istema nervioso, las divisiones simpática y parasimpática frecuentemente tienen efectos opuestos. Por ejemplo, las señales químicas provenientes de una neurona simpática aumentan la frecuencia cardíaca, mientras que las señales químicas de w1a neurona parasimpática la disminuyen ( Fig. 6- !Sb). Cuando las señales químicas tienen efectos opuestos se d ice que son antagon istas; por ejemplo, la insulina y el glucagón son hormonas antagonistas: la insulina d ism inuye la co ncentración de gl ucosa en sangre y el gl ucagón la aumenta. Una señal química puede tener diferentes efectos en tejidos diferentes. Cannon observó correctamente que "agentes homeostáticos antagonistas en una región del cuerpo pueden ser cooperativos en otra región". Sin embargo, cuando los científicos descubrieron los receptores celulares pudieron aclararse las bases de las acc iones aparentemente contradictorias de algunas hormonas o nervios. Como usted aprendió en la primera parte de glucosa en sangre y el glucagón la aumenta. Una señal química puede tener diferentes efectos en tejidos diferentes. Cannon observó correctamente que "agentes homeostáticos antagon istas en una región del cuerpo pueden ser cooperalivos en otra región". Sin embargo, cuando los científicos descubrieron los receptores celulares pudieron aclararse las bases de las acciones aparentemente contradictorias de algunas hormonas o nervios. Como usted aprendió en la primera p.trte de este capítulo, una misma señal quím ica puede tener d iierente.s efectos dependiendo del receptor y de la vía de señalización de la célula d iana. Por ejemplo, la adrenalina contrae o dilata los vasos sanguíneos dependiendo de si el vaso tiene receptores adrenérgicos a o ~2 ( Eig 6- 11).

Tradicionalmente se ha considerado que las vías reflejas a larga distancia comprenden dos sistemas de comrol: el sistema nervioso y el sistema endoc ri no. Sin embargo, hO)' en día se sabe que las citocinas están involucradas en algunas vías a larga distancia. Durante las respuestas de estrés y de inflamación sistém ica, las citocinas actúan junto con los sistemas nervioso y endocrino para integrar la informac ión de todo el cuerpo con el fin de obtener respuestas coordinadas. Los bucles de resp uesta de todas las vías reflejas tienen tres com ponentes principales: una se11a/ de entrada, integració11 de la se11al y una setíal de salida. Estos tres componentes pueden o rgan izarse en la siguiente secuencia de siete pasos para formar un patrón que se encuentra con ligeras variaciones en todas las vías reílejas de control (• Fig. 6· 16): Estímulo ---;, sensor o recep tor---;, señal de entrada---;, centro integrador---;, señal de salida .....,.. diana .....,.. respuesta

Pasos del reflejo ESTIMULO

• --------

\

SENSOR

¡ ~ SEÑAL _ D_E....,

ENTRADA

Bucle de retroal imentación

CENTRO INTEGRADOR

l SEÑAL DE ENTRADA

Bucle de retroalimentación

CENTRO INTEGRADOR

SEÑAL DE SALIDA

La extraordinaria precisión de los postulados de Can non, actualmente confirmados por información celular y molecular, es un tributo a las hab ilidades observacionales de los científicos del siglo diecinueve y principios del siglo veinte. Revisión

________ ,,,.,

18. ;Ct2I es la diferencia entre el control tónico yel control antagonista?

19. ;Cómo puedeuna rnolérula de señalización tener efectos opuestosen dos tejidos diferent6? • FIGURA 6-16 Pasos de una vía reflej a

Vías reflejas homeostát icas

Un estímulo es el cambio o alteración que pone en marcha la vía. El estímulo puede ser un cambio en la temperatura, en el contenido de oxígeno, en la p resión a n erial o en cualquiera de las miles de va riables reguladas. Un sensor o receptor sensorial registra continuamente una variable partiettlar de su entorno. Cuando el sensor es activado po r un cambio, envia una señal de entrada (aferente) hacia el centro integrado r del reflejo. El cent ro integrador compara la señal de entrada con el valor de aj uste o valor de,seado para la variable. Si la variable se ha desplazado del rango aceptable, el cen tro integrador gene ra una señal de sal ida . La señal de salida (eferente) es una señal eléctrica o química que viaja hasta la diana. La diana o efector leffectu,, la realización de una tarea} es la célula o el tejido que lleva a cabo la respuesta adecuada para devolver la variable a su rango de valores normales Veamos con mayor detalle estos componen tes de un rellejo.

Sensores En el primer paso de un bucle de respuesta fisiológico, el estímulo activa un sensor o receptor. Nótese que ésta es una ap licación

nueva y di ferente pa ra la palabra recept.or. Como muchos otros térm inos en fisiología, la pa labra receptor puede tene r diferen tes significados Fig. 6- 17). Los receptores sensoriales de un rellejo nervioso no son recepto res proteicos que se u nen a moléculas de señal ización, como las involucradas en la tra nsducción de señales. En su luga r, los recepto res nerviosos son células, parles de células o complejos muhicelulares {como el ojo) especializados q ue respo nden a camb ios en el entorno. Existen muchos recepto res sensoriales en el cuer po, cada uno ubicado en la mejo r posición para controlar la variable que detecta. l os ojos, los oídos)' la na riz son receptores que detectan luz, sonido)' movim ien to y olores, respect ivamen te. La piel está cubierta de receptores menos complejos q ue detectan tacto, temperatura, vibración y dolo r. O tros sensores son internos: receptores de las articulaciones que envían información al encéfalo sobre la posición corporal o recepto res de presió n arterial )' de oxígeno en los vasos sanguíneos que controlan las co ndiciones del aparato circulato rio. Los receptores sensoriales involucrados en los reflejos nerviosos se dividen en receptores centrales y receptores periféricos. Los receptores centrales están ubicados dentro del encéfalo o estrechamente vinettlados a él. Un ejemplo es el quim io rrecepto r cerebral de d ióxido de carbono. Los receptores periféricos se encuentran en otras partes del cuerpo, e incluyen los receptores de la piel y los receptore,s internos recién descrip tos.

<•

RECEPTORES 1

pueden ser

Receptores proteicos intracelulares o de la membrana celular

Sensores: células o estructuras especializadas que convierten diversos estímulos en señales eléctricas

Los receptores centrales están dentro del encéfalo o cerca de él.

Los receptores periféricos están ubicados fuera del encéfalo.

,Ojos (visión}

Oídos {audición, equi librio

Quimiorreceptor (pH, gas es , sustancias químicas}

Nariz (olfato)

Osmorreceptor {osmolaridad)

195

u

Lengua {gusto)

Qui miorreceptores , osmorreceptores y termorreceptores centrales

Tennorreceptor (temperatura)

Barorreceptor (presión)

• FIGURA 6-17 Múltiples significados de la palabra receptor. La palabra receptor puede

hacer referencia a una proteína que se une a un ligando. Receptor también puede sign ificar una célula o una estructura especializada para la transducción de algún estímulo en señales eléctricas (un receptor sensorial o sensor). Los receptores sensoriales se clasifican en centrales o periféricos, dependiendo de si se encuentran dentro del e ncéfalo o fuera de él.

Propiorrecepto Otros mecanorre(posición ceptores (dolor, corporal) vibración, tacto)

196

Capitulo 6 Comunicación, integración y homeostasis

Todos los senso res tienen un umbral, el estímulo mínimo necesario para po ner en ma rcha la respuesta refleja. Si un estímulo se encuen tra por debajo del umbral, no se in icia el bucle de respuesta. Puede comprobar fáci lmente el umb ral de tm receptor sensorial tocando el dorso de su mano con un objeto punt iagudo, como un alfi ler. Si pone en contacto la pun ta del objeto con su p iel de manera suficientemente leve, podrá ver el con tacto entre la punta y su p iel pero no senti rá nada. En este caso, el estímulo (p resión ejercida por la pun ta del alfi ler) está por debajo del umbral, y los recepto res de presi,5 n de la piel no responden. Si pres iona más fuertemente, el estímulo alcanza el umbral y los receptores responden enviando una señal hacia el encéfalo, haciendo que usted s ienta el alfiler. Los reflejos endocrinos que no están asociados al sistema nervioso, no utilizan receptores sensoriales para iniciar sus vías. En su l ugar, las cél ulas endocrinas actúan al mismo tiempo como senso r )' como centro in tegrador del re flejo; por ejemplo, una célula beta pancrefü ica q ue detecta y responde directamente a los camb ios en las concentraciones de gl ucosa en sangre, es una cél ula endocrina q_ue actúa como sensor y como centro integrador [Fig. 5-27 ).

ma. Las vías de salida del sistema nervioso reciben el nombre del nervio que transpor ta la sefüi l; por ejemplo, hablamos del contro l vaga! de la frecuencia cardíaca ( vagnl es el adjetivo para el nervio vago) . En el sistema endocrino, la ruta anatómica de la señal de salida es siempre la m isma: todas las hormonas viajan por la sangre hacia sus d ianas. Las ,,fas de sal ida h ormonales se dist inguen por la naturaleza química de la señal y, por lo tanto, se las denomi na de acuerdo con la hormona que lleva el mensaje; por ejem plo, la se ri al de salida de Ltn retle_jo integrado por el pá ncreas endocri no sen\ la hormona insulina o la ho rmona glucagón, dependiendo del estím ulo y la respuesta adecuada.

Dianas Las d ianas de las vías reflejas de control son las células o los tejidos q ue llevan a cabo la respuesta. Las dianas de las vías nerviosas pueden ser cualqtúer tipo de músculo, las glándulas endocrinas o exocrinas o el tejido adiposo. Las dianas de una vía endocrina son las cél ulas que poseen el recepto r apropiado para la hormo na.

Se.ñal ,le entrada La señal de entrada varía dependiendo del tipo de

Respuestas Hay dos niveles de resp uesta para una vía reHeja de con trol. Uno es la m uy específica respuesta celular, que tiene lugar en la cél ula d iana. La respuesta sistémiai., más general, describe lo que aque-

reflejo. En una vía nerv iosa, como el contacto del alfiler del ejemplo prev io, la señal de en trada es información eléctrica y quím ica transmitida por una neurona sensorial. En un reflejo endocr ino no hay una vía de en trada debido a que el estímulo actúa di rectamente sobre la célula endocrina, la cual sirve como sensor y como cen tro integrador.

llos eventos celulares específicos implican para el organismo como un todo; por ejemplo, cuando la hormona adrenalina se u ne a receptores adrenérgicos ~2 de las paredes de ciertos vasos sanguíneos, la respuesta ce lular es la relajación del músculo liso. La respuesta sistémica a la relajación de la pared de los vasos sangu íneos es un aumen to del llujo sanguíneo a través de esos vasos.

Centro integrador El centro in tegrador de una vía refleja es la cél ula que recibe la info rmación sobre la variable regulada y puede desencadenar una respuesta adecuada. En los rellejos endocrinos, el centro integrador es la célula endocrina. En los rellejos nerviosos, el centro integrador está ub icado hab it ualmente dentro del sistema nervioso central (SNC:), el cual está com puesto po r el encéfalo y le méd ula espi nal. Si la información proviene de un ú nico estímulo, resulta relativamente sencillo para el centro integrador comparar esa información con el valo r de ajuste e iniciar una respuesta si corresponde; sin embargo, los centros integrado res realmente "justifican su existencia" cuando dos o más sefiales contrapuestas provienen desde fuen tes diferen tes. El cen tro debe evaluar cada sefütl sobre la base de su intensidad e importancia )' tiene que generar una resp uesta adecuada que integre la información proven ien te de todos los recepto res con trib uyentes. Esto es simi la r al tipo de decisión q ue usted debe tomar cuan do, una noche, sus padres lo inv itan a cenar, sus amigos lo inv itan a una fiesta, hay un programa en la televis ión que quiere ver y tiene un yentes. Esto es similar al tipo de decisión q ue usted debe tomar cuando, una noche, sus padres lo inv itan a cenar, sus amigos lo inv itan a una Gesta, hay un programa en la televisión que quiere ver y tiene tm examen de fisiología en tres días. Le co rresponde a usted jera rqu izar esos ltems en ord en de impor tancia y decidir q ué hacer.

Revi sión

20. ¿Cuál es la diferencia entrecontrol local ycontrol reffejo?

21. Nombre los siete pasos de unavía re/leja de control enel ordencorrecto.

Ahora q_ue conoce las partes b,\sicas de una vía refleja de co n crol, podemos analiza r los dos sistemas de con trol principa les, el sistema nervioso )' el sistema endocrino.

Marvin está fasci nado por la capacidad del cuerpo para controlar la glucosa."¿Cómo hace el páncreas para saber qué hormona secretar?", se pregunta . Cél ulas especiales en el pá ncreas, llama-

1'Ói-:frvi1l'~sra'r¡¡~c1ñ1!0i5•po1 fá"c~¡l~O ºª''cüéfl5l5"p'arlfei:5lmo,llr la glucosa."¿Cómo hace el páncreas para saber qué hormona secretar?", se pregunta. Células especiales e n el pá ncreas, llamadas células beta, registran un aumento en las concentraciones de glucosa en sangre después de una comida y responden liberando insulina. Esta actúa en muchos tejidos del cuerpo haciendo que capten y utilicen la glucosa.

Se1111/es de sfllida Las vías de las señales de salida son relativamen te

sencillas. En el sistema nerv ioso, la señal de salida es siempre la seña l eléctrica y quím ica transmi tida po r una neurona eferente. Debido a que todas las señales eléctrica; que viajan por el sistema nervioso son idénticas, la característica d istin tiva de la señal es la vía anatóm ica de la neurona: la ruta a través de la cual la neurona conduce su señal. Po r ejemplo, el nervio vago transporta señales ner viosas hacia el corazón, mientras que el nervio frénico lleva señales nerviosas hacia el d iaírag-

PS: En la vía refleja de la insulina que regula los niveles de glu-

cosa en sangre, ¿cuáles son el estímu lo, el sensor, e l centro integ rador, la/s diana/s y la/s respuesta/s?

175

178

191

194 .

198

202

Vías reflejas homeostát icas

Los sistemas decontrol varíanen velocidad y especificidad Las vías reilejas de conlrol fis iológicas est,1n mediadas por el sistema nervioso, el sistema endocrino o una combinación de ambos (• 4 6- 18). Un rellejo mediad o solo por el sistema nervioso o solo por el sistema endocrino es relativamen te simple, pt>ro la combinación de vías reflejas puede no serlo. En las vías m,\s complejas, las señales pasan a través de tres diferentes centros in tegradores antes de alcan zar el tejido d iana. Con tanta superposición de vías controladas po r los sistemas nervioso )' endocrino, tiene sentido considerar estos sistemas como pa rtes de un continuo y no como dos sistemas separados. ¿Por qué necesita el cuerpo d iferen tes tipos de sistemas de con trol? Para responder esta pregun ta, compa remos el contro l endocrino con el control nervioso pa ra ver cuáles son las d iJerencias. Se resumen

Reflejo endocrino simple

Cambio interno o externo

Reflejo nervioso simple

Cambio interno o externo

Cambio interno o externo

t

t

Receptor

Receptor

t

t

( Señal de entrada: neurona sensorial

neurona sensorial

t

t

t

t

Señal de salida:,, hormona

Neurona eferente

..

t

(

Diana

)

t

( Diana )

..

e

Reflejo neuroendocrino complejo

e (

cinco d iferencias principales en el • Cuadro 6-2 y se analizan a continuación.

Especificidad El control nervioso es mU)' específico, ya que cada neurona tiene células determi nadas a las cuales envía su mensaje. Anatómicamente, podemos aislar una neurona y rastrearla desde su origen hasta la diana donde termi na. El control endocrino es más general, debido a que el mensajero químico es liberado en la sangre y puede alcanzar virtua lmen te todas las células del cuerpo. Como usted aprendió en la primera mitad de este capítulo, la respuesta corporal a una ho rmona específica depen de de q ué cél ulas cuentan con receptores para esa hormo na y qué tipo de receptor tienen. Múltiples tt>jidos del cuerpo pueden responder a una ho rmona simultáneamente. Nat11mleza de fo se1111/ El sistema nervioso utiliza tan to señales eléctricas como químicas para enviar informació n a todo el cuerpo. Las señales eléctr icas viaja n largas distancias a través de neuronas, liberando señales quím icas ( neurotransmisores) que d ifunden a través de pequeñas bt>ndiduras entre la neurona y su diana. En un número limi tado de casos, las señales eléctricas pasan directamen te de célula a célula a través de uniones en hendidura . El sistema endocrino utiliza solo señales q uím icas: ho rmonas secretadas en la sangre por glánd ulas o células endocrinas. Las vías neurohormonales representan un híbrido entre los reílejos nervioso y endocrino. En una vía neuroho rmonal, una neurona genera una señal eléct rica, pero la sustancia química liberada es una neurohormona que se incorpora al torrente sanguíneo pa ra su d istribución sistémica. Revisión

22. (a) En el reflejo nef'liososimplede la Fig11ra 6;J8, ¡qué recuadro/srepresenta/n el encéfalo y la médula espinal?{b) ¿Qué recuadro!s represenWn los órganos sensoriales centrales y periféricos? (c) En el reflejo nef'lioso simple, aóada una línea de puntos que conec,e los recuadros para mostrar cómo un bude de retroafimentación negativa podría detener el reflejo.

Neurona eferente o neurohormona

Velocidad Los retlejos nerviosos son mucho más rápidos que los retlejos endocrinos. Las señales eléctr icas del sistema nervioso cub ren grandes distancias muy rápidamen te, con velocidades de hasta 120

Diana )

t Diana )

t

e

197

Seiial de salida no 2: hormona

( Diana )

t

e • FIGURA 6-18 Vías de control endocrina, nerviosa y neuroendocrina

!lejos endocrinos. Las señales eléctricas del sistema nervioso cubren grandes distancias muy rápidamen te, con velocidades de hasta 120 m /s. Los ne ttrotransm isores tamb ién generan respuestas muy rápidas, del orden de los milisegundos. Las hormonas son mucho más lentas que los reílejos nerviosos. Su distribución por el aparato ci rculatorio )' su d ifusión desde los capilares hasta los recepto res tardan considerablemen te más tiempo que las señales nerviosas. Además, las hormonas tienen un inicio de acción más len to. En los tejidos diana, la respue,~ta puede Lardar de m inutos a horas antes de poder ser medjda. ¿Por qué necesitamos los rápidos reílejos del sistema nervioso? Considere el siguien te ejemplo: un ratón se aventura fuera de su escondite y ve un gato preparado para abalanzarse sobre él y comérselo. Una señal debe viajar desde los ojos y el cerebro del ratón hacia sus patas, ordenándole correr de vuelta hacia su escond ite. Si su cerebro y sus patas estuviesen a solo 5 micrómetros de distancia (5 ~tm :e 1/ 200 mi límetros), una seña.! qtúmica lttrdaría 20 mLlisegundos (ms) en difund ir a través de ese espacio )' el ratón podría escapar. Si el cerebro y

198

Capitulo 6 Comunicación, integración y homeostasis

11

Comparación entre el control nervioso yel control endocrino Propiedad

Reflejo nervioso

Reflej o endocrino

Especificid a d

Cada neurona fina liza en una única célula d iana o e n un número limitado d e célu las d iana adyacentes.

La mayoría de las célu las d el cuerp o están expuestas a una hormona. l a respuesta d epende de qué células tie nen receptores para la hormona.

Naturaleza d e la seña l

Señal e léctrica q ue viaja a través d e una neurona; luego, neurotransmisores que transportan la señal de cé lula a cél ula . En pocos casos, las señales p asa n de cé lula a cél ula a través de uniones en hendidura.

Señales q uímicas secretad as en la sangre pa ra su distribución sistém ica.

Ve locidad

Muy rápida.

La d istribución de la señal y e l inicio de la acción son mu cho más lentos q ue e n las resp uestas nerviosas.

Duración de la acción

Habitualmente muy corta. Respuestas d e mayo r d uración son mediad as p or ne uromod ula dores.

Respuestas habitualmente más prolongad as que las respu estas nerviosas.

Codificación d e la intensid ad d el estímulo

Cada seña l es idéntica en intensid a d. La intensidad del est ímulo se corre laciona con la frecuencia d e la señal (a mayor intensidad, mayor frecu encia).

La intensidad del estímulo se corre lacio na con la cantidad d e hormona secretada.

las patas estuviesen distanciados 50 µ m ( 1/ 20 milímetros), la difusión tardaría 2 segundos y el ratón podría ser captu rado. Pero debido a que la cabeza y las patas de un ratón se encuen tran a ce11tfmetros de distancia, una señal química tardaría tres semanas en d ifundir. ¡Pobre ratón! Aun si la distribución de la seña.l química fuese acelerada con aruda del aparato circulato rio, el mensaje químico tardaría 10 segun dos hasta llegar a las patas, y el rató n se convertiría en com ida para gato. La moraleja de este cuento es que los ret1ejos que requieren una resp uesta ráp ida son mediados por el sistema nerv ioso debido a q L1e son mucho más rápidos. tas patas estuviesen aistanc1aaos :,U µ m ( l/LU m11JmetrosJ, ta a11ust0n tardaría 2 segundos y el ratón podría ser captu rado. Pero debido a que la cabeza y las patas de un ratón se encuentran a cent/metros de distancia, Lllla sel'ial quím ica tardaría tres semanas en difundir. ¡Pobre ratón! Aun si la distribución de la seña l química fuese acelerada con ayuda del aparato circulato rio, el mensaje qu ímico lardaría 10 segun dos hasta llegar a las patas, y el ratón se convertiría en com ida para gato. La moraleja de este cuento es que los reflejos que requieren una resp uesta rápida son mediados por el sistema nerv ioso debido a que son mucho más rápidos.

D11 ra.ci6n de la acción El control nervioso es de menor d uración q ue el control endocr ino. El neuro transmisor liberado por una neurona se combina con un receptor en la célula diana e inicia una respuesta. Sin embargo, la respuesta habitualmente es b reve deb ido a que el neurotransm isor es elimi nado rápidamente de las inmediaciones del recep tor por diversos mecanismos. Para ob tener una respuesta sosten ida, la neuro na debe em itir repetidamente múltiples señales. Los reflejos endocrinos tardan más en comenzar, pero tienen mayor duració n. La mayoría de las funciones corpo rales continuas )' 1)11r


Co,lificaci6n de la iutensidad del estímulo A medida q ue un estímu"Bien, solo una preg unta más - dice Marvin- . Usted dijo que las personas con diabetes tiene n niveles elevados de glucosa en sangre. Si la g lucosa está tan elevada, ¿por qué no puede entrar e n las células?" P6: ¿Por qué la glucosa no sie mpre puede difundir dentro de las

células cuando su concentración en sangre es mayor a la del líquido intracelular? P7:

¿Qué piensa usted que sucede con la velocidad de secreción de insulina cuando los niveles de glucosa en sa ngre dismin uyen? ¿Qué tipo de bucle de retroa limentación actúa?

175

178

191

194

196 •

202

lo aumenta en intensidad, los sistemas de control deben tener un mecanismo para comun icar esta información al cen tro integrador. La intensidad de la señal de cualquier neurona es constante en magnitud )', por lo tanto, no puede reflejar la in tensidad del estímulo. Por otro lado, la frecuencia de la seftal que viaja por la nemona aferente aumenta. En el sistema endocrino, la in tensidad del estímulo se refleja en la can tidad de ho rmona liberada: a mayor estímulo, mayor liberació n de hormona.

Lasvíasreflejas de control cuentan con muchos centros integradores La • Figttra 6-19 resume las variacio nes en las vías reflejas de contro l nerviosas, neuroendocrinas)' endocrinas.

• •

Vías reflejas simples y complejas Reflejo

Reflejos neuroendocrinos complejos

Reflejo neurohormonal

nervioso simple

G)

(]

Estímulo

Reflejo endocrino simple

@

G) Estímulo

Estímulo

Estímulo

Estimulo

Estímulo

E

..

Neurona sensorial

• .,,

~

Neurona •.•.,- eferente

: -

••• • •\ __./

••••

r ·¡}-r

Célula diana •

Ejemplo: el reflejo patelar

••

0=-'Vaso

A

E ,

Células endocrinas(

1a secrec1on ae 1ecne en respuesta a la succión del pezón

é

Ejemplo: Respuesta)

f

s

Sensor

~ Neurona sensorial

,

(vía de entrada) Centro integrador del SNC Centro integrador endocrino

1

~

Ejemplo: la secreción de insulina en respuesta a una señal proveniente del cerebro

0 0

Vías de salida

V••• ••

•••• •••

Neurona eferente Neurotransmisor

...

.--_,Hormona n° 2 ---A 4

LEYENDA Estímulo

Ae ' \

é

Ejemplo: la liberación de insulina cuando aumenta la glucemia

e

Ejemplo: la secreción de leche en respuesta a la succión del pezón

E

~e /

t

Neurohormona -

Ejemplo: la secreción de hormona de crecimiento

/

~

Neurohormona Hormona clásica

Célula diana (efector)

Ejemplo: este patrón ocurre con las hormonas liberadas por la adenohipófisis

200

Capitulo 6 Comunicación, integraci ón y homeostasis

En una vía relleja endocrina simple ( Fig 6- !9 ®) , la célula endo crina controla la variable regulada y actúa como sensor y como centro integrador. No hay señal de en trada. La señal de sa lida es la ho rmona, y la d iana es cualquier cél ula q ue tenga el receptor proteico adecuado. Un ejemplo de rellejo endocr ino simple es la secreción de insulina en respuesta a cambios en el n ivel de gl ucosa en sangre. Las células endocrinas que secretan insulina detecta n las concentraciones de gl ucosa en sangre utilizando la producción de ATP en el in ter ior celular corno ind icador [Fig. 5-27]. Cuando la glucemia aumenta, la p roducció n in tracelular de ATP sobrepasa el n ivel umbral y las células endocrinas responden secretando insulina en la sangre. Cualquier célula diana del cuer po q ue tenga receptores de insul ina responde a la hormona e inicia los procesos q ue llevan a la d ismin ución de la gl ucem ia. l a el imi nación del estímulo actúa en ío rma de retroal imen tación negativa,)' el bucle de respuesta se detiene cuando los niveles de glucosa en sangre caen por debajo de una concentración determinada. En un reOejo ne rvioso simple, todos los pasos de la vía están presen tes, desde el receptor hasta la d ian" {Fig 6- 19


Revisión 23, Una los siguientes términos correspondientes a las partes del reflejo pate!ar con las partes

de un reflejo neNioso simple mostradas enla figura & 19 ©: golpeen el tendón, músculos del mus!o, neuronahacia los músculos del muslo, neurona sensoria!, encéfalo y médula espinal. receptor de estiramiento, contracción muscular.

El reflejo neuroho rmonal, mostrado en la Figura 6- l 9 ®, es idéntico al rellejo nervioso excep to por el hecho de que la neurohormona li berada viaja a través de la sa ngre hacia su diana al igual que una hormo na. Un reflejo neurohormonal simple es la secreción de luc..1n1.,"- 0 l'll ·t<. l U.)V uJ,·.,. H..M'V. ~A~<.: p1..,rpv"t ·1-i l 1\.1..-.,\:, ·0'-' '1··"'·1·, o. ~,,\.Jndt ~ mona liberada viaja a través de la sangre hacia su diana al igual que una ho rmo na. Un rellejo neurohormonal simple es la secreción de leche en respuesta a la succión por parte de un bebé. La boca del bebé sobre el pezó n genera señales senso riales que viajan a través de neuronas sensoriales hasta el encéfalo {centro integrador). Una seña l eléctrica transm itida por la neurona eferente desencadena la liberación de la neuroho rmo na ox:i tocina desde el encéfa lo hacia la ci rculación. La ox.iloci na es transportada hacia las mamas, donde genera la contracció n del músculo liso de las glánd ulas ( diana). resultando en la eyecció n de la leche. )J\,.

En las vías complejas puede haber más de un centro integrador. La Figura 6- 19 muestra tres ejemplos de vías neuroendocri nas complejas. La más sencilla de estas, Figma 6-19 (;i), combi na un rellejo nervioso con tlll rellejo endocrino clásico. Un ejemplo de este patrón se puede encon trar en el contro l de la liberación de insulina. Las células beta pancreáticas controlan directamente las concentraciones de glucosa en sangre (Fig. 6- 19 @), pero también son reguladas por el sistema nervioso. Durante una com ida, la presencia de alimentos en el estómago distiende la pared del tracto digesLivo y envía seri ales de en trada hacia el encéfalo. Este, a su vez, envía señales de salida excitatorias hacia las células beta, o rdenándoles secretar insulina. Estas señales tienen lugar incl uso an tes de que el alimen to haya sido absorbido y los niveles de glucosa se h ayan elevado ( un reflejo de alimentación anterógmda). Po r lo tan to, esta vía posee dos centros integradores (el encéfalo y las células beta ).

Revi sión

24. Una los siguientes términos con !as partes correspondientes del rilejo neuroendocrino simplede !a Fiqura & 19 1:1 (!os términos pueden ser utilizados másde unavez): alimento ene!estómago despuésde una comida, encéfalo y médula espinal, células endocrinas del páncreas, receptores de estiramiento, neurona eferente hacia el pánoeas, insulina, célula adip~..a, sangre, neurona sensorial.

O tro rellejo complejo ( Fíg. 6- 19 ©) utiliza una neuroho rmona para controlar la liberación de una h ormona clásica. l a secreción de hormona de crecim iento es un ejemplo de esta via. Las vías neuroen docrinas más comp lejas, mostradas en la Figura 6- 19 @, incluyen una neurohormona y dos ho rmo nas clásicas. Este patrón es típico de algunas hormonas liberadas por la adenohipófisis, una glándula endocrina ubicada en la parte inferio r del encéfalo [ véase el Capítulo 7 para mayor detalle] . Al describ ir las vías rellejas neuroendocrinas complejas identiÍlcamos so lo un receptor y una vía de entrada, como se indica en la Figura 6- 19. En las tres vías complejas ilustradas, el encéfalo es el primer cen tro integrado r y la new·ohormona, la primera vía de sal ida. En la Figura 6-19 @, la d iana endocrina (E) de la neurohormona es el segundo centro in tegrador)' S tt hormona, la segunda vía de salida. La segunda gh\ndula endocrina en la vía ( E,) es el tercer cenlro integra. i._ 1 Jóu1a'v- 1 /

~

,

al1.

,,.Hu llu ... uúu ....\u 1<1 1 \l.L1

•u..__ lU

1\ulivílt..ivuu ....,..,- ,.)

U \ ,A ..

segundo centro in tegrador y su hormona, la segunda vía de sal ida. La segunda glándula endocrina en la vía ( E,) es el tercer cenlro integrador y su hormona, la tercera vía de salida. La diana de la última señal en la secuencia es el efector. El • Cuadro 6-3 compara los diversos pasos de los reflejos nervioso, neuroendocrino y endocrino. En lo q ue resta del texto, util izaremos los patro nes generales mostrados en la Figura 6-19 como base para clasiücar las vías rellejas com plejas. A continuación, estudiare mos en detalle algunas vías del sistema endocr ino y los papeles que cum plen estas vías en la homeostasis.

Comparación de los reflejos nervioso, neuroendocrino yendocrino

Nervioso

Neuroendocrino

Endocrino

Sensor

Receptores sensoriales especiales y somáticos

Receptores sensoriales especiales y somáticos

Célula endocrina

Señal de entrada

Neurona sensorial

Neurona sensorial

No hay

Centro integrador

Encéfalo y médula espinal

Encéfalo o médula espinal

Célula endocrina

Señal de salida

Neurona eferente (señal eléctrica y neurotransmisor)

Neurona eferente (señal eléctrica y neurohormona)

Hormona

Diana/ s

Músculos y glándulas, parte del tejido adiposo

La mayoría de las células del cuerpo

La mayoría de las células del cuerpo

Respuesta

Principalmente contracción y secreción; puede tener efectos metabólicos

Modificaciones en reacciones enzimáticas, transporte de membrana o proteínas celulares

Modificaciones en reacciones enzimáticas, transporte de me mbrana o proteínas celulares

Diabetes mellitus Marvin se sometió a pruebas adicionales y se le diag nosticó diabetes ti po 2 tempra na. Cuidando su dieta y realiza ndo ejercicio regular ha podido mantener sus niveles de glucosa en sangre bajo control. La diabetes es una epidemia creciente en los Estados Unidos, con más de 25 millones de diabéticos en ese país en 2011 (alrededor del 8% de la población). Au n más aterradora es la estimación de que otros 79 m illones de personas son consideradas "prediabéticas"; es decir, en riesgo significativo de convertirse en diabéticas. Usted aprenderá más sobre la diabetes a medida que avance en los capítulos de este libro. Para conocer más sobre la

diabetes en este momento, visite la página web de la Asociación Estadounidense de Diabetes (www.d iabetes.org) o al de los Centros de Control y Prevención de Enfermedades (www.cdc.go./diabetes). En este tema relacionado, usted aprendió sobre la homeostasis de la glucosa y cómo es mantenida por la insulina y el glucagón. La d iabetes mellitus es una enfermedad en la cual la homeostasis de la glucosa está alterada. Revise sus conocimientos sobre este tema relacionado comparando sus respuestas con la información e n el siguie nte cuadro.

Preguntas

Hechos

Integración yanálisis

1. ¿En qué tipo de diabetes es más

La insu lina es un péptido que utiliza receptores de membrana ligados a segundos mensajeros para transm it ir su señal a las células. Las personas con diabetes tipo 1 carecen de insu lina; las personas con diabetes tipo 2 tienen niveles de insulína entre normales y e levados.

Niveles normales o elevados de insulina sugieren que el problema no se encuentra en la cantidad de insulina, sino en su acción en la célula. El problema en la diabetes tipo 2 podría ser un defecto en el mecanismo de transducción de señales.

2. la insulina es una hormona prote.ica. ¿Esperaría encontrar su receptor sobre la superficie celular o dentro del citoplasma de las células diana?

Las moléculas de señalización lipófilas tienen receptores intracelulares. l as moléculas lipófobas tienen receptores en la membrana celular.

las pwteínas son lipófobas, por lo q ue las hormonas proteicas tienen receptores en la superficie celular.

3. ¿En qué tipo de diabetes es más probable q ue los receptores de insu lina estén sometidos a regu lación por incremento?

La regulación por incremento de los receptores ocu rre de forma habitual si una molécula de señalízación está presente en coAcent raciones in usualmente bajas. En la diabetes tipo 1, el páncreas no secreta insulina.

En la diabetes tipo 1, los niveles de insulina son bajos; por lo tanto, el tipo 1 tiene más probabilidades de ocasionar una reg ulación por incremento de los receptores de insulina.

probable q ue haya un defecto en la vía de señalización de la insulina en la célula diana?

202

Capitulo 6 Comunicación, integración y homeostasis

Preguntas

Hechos

Integración yanálisis

4. ¿De qué postulado de Cannon es un ejemplo la reg ulación homeostática de los niveles de glucosa en sa ngre por las hormonas insulina y glucagón?

Los postulados de Cannon describen el papel del sistema nervioso central en el mantenimiento de la homeostasis y los conceptos de actividad tóníca, control antagonista y diferentes efectos de las señales en diferentes tejidos.

La insulina disminuye los niveles de glucosa en sang re, mientras que el glucagón los eleva; por lo t anto, las dos hormonas son un ejemplo de control antagonista.

S. En la vía refleja de la insulina que regula los niveles de glucosa en sangre, ¿cuáles son el estímulo, el sensor, el centro integrador, la/s diana/s y la/s respuesta/s?

Véanse los pasos de las vías reflejas [p. 194J.

Estímulo: aumento de los niveles de glucosa en sangre; sensor: células beta pancreáticas que detectan el cambio; centro integrador: células beta; señal de salida: insulina; dianas: todos los tejidos del cuerpo que respondan a la insu lina; respuestas: captación y utilización celular de gl ucosa.

6. ¿Por qué la glucosa no siempre puede d ifundir dentro de las células cuando su concentración en sangre es mayor que la del líquido intracelular?

la g lucosa es lipófoba. La difusión simple ocurre a través de la bicapa fosfolipídica. La difusión facilitada utiliza proteínas transportadoras [p. 1491,

Debido a que la glucosa es lípófoba, no puede atravesar la membrana por difusión simple. Debe utilizar la difusión facilitada. Si una célula carece de los receptores necesarios, la difusión facilitada no puede llevarse a cabo.

7. ¿Qué piensa usted que sucede con la velocidad de secreción de insulina cuando los niveles de glucosa en sangre disminuyen? ¿Qué tipo de bucle de retroa limentación actúa?

El estímulo para la liberación de insulina es un au mento en los niveles de glucosa en sangre. En la retroalimentación negativa, la respuesta contrarresta al estímulo. En la retroalimentación positiva, la respuesta incrementa el estímulo.

Un aumento en la concentración de glucosa en sang re estimula la liberación de insulina; por lo tanto, una reducción de la glucemia debería disminuir la liberación de insulina. En este ejemplo, la respuesta (menor glucemia) contrarresta al estimulo (glucemia aumentada), entonces está actuando un bucle de retroalimentación negativa.

175

178

191

194

196

198 .

Resumen del capítulo En este capítulo se destacan dos de los principales temas en fisiología: el colltrol de lr1 l1omeostnsis y la co111u11ícnción. los sensores, centros de integración y dianas de los sistemas de control fisiológicos se describen en el contexto de las vías reflejas de control, las cuales varían desde simples hasta complejas. Los sistemas de contro l funcionales requieren una comunicación eficiente que utiliza diversas combinaciones de señales quí-

micas y eléctricas. Aquellas señales que no pueden atravesar las membranas celulares deben utilizar receptores de membrana y sístemas de transducción de señales para transmitir su información a la célula. la interacción de moléculas de señalización con los receptores proteicos ilustra otro tema importante de la fisiología, las interaccio11es moleculares.

Resumen del capítulo

Comunicación intercelular 1. Existen dos tipos básicos de señales 6siológicas: las químicas y las eléctricas. Las señales químicas son la base de la mayor parte de la comunicación dentro del cuerpo. (p. 175) 2. Existen cuatro métodos de comunicación intercelular: ( 1) transferencia citoplasmática directa a través de uniones en hendidura. (2) señalización dependiente del contacto, (3) comunicación qu[mica local y (4) comunicación a larga distancia. (p. 176: Fi¡¡, 6-1) 3. Las unione.s en hendidura son canales proteicns que conectan dos células adracentes. Cuando se encuentl'an abiertas, las señales qutmicas y eléctricas pasan directamente de una célula a la otrn. (p.175) 4 . Las señales dependientes del contacto requieren contacto directo entre moléculas de superficie de dos células. (p. 175 ) 5. La comunicación local utiliza señales paracrinas, sustancias químicas que actúan sobre células cercanas a la célula que secretó la se1ial. Una sustancia química que actúa sobre la célula que la secretó se denomina señal aut ocrina. La actividad de las moléculas de señalización paracrinas y autocrinas está limitada por la d istancia de difusión. (p. 177) 6. La comunicación a larga distancia utiliza moléculas neurocrinas y señales eléctricas del sistema nervioso y hormona~ del sistema endocrino. Solo las células que cuenten con los receptores para la hormona serán células diana. (p. 177) 7. Las citocinas son péptidos reguladores que controlan el desarrollo y la diferenciación celular y la respuesta inmune. Actúan como se1\ales locales y como señales a la rga distancia. (p. 177)

Moléculas de señalización novedosas 19. El calcio es una molécula de señalización importante que se une a la calmoduEna para alterar la actividad enzimática. También se une a otras proteínas celulares para alterar el movimiento e iniciar la exocitosis. (p. 187; Fiit. 6-11 ) 20. El óxido nítrico (NO ), el monóxido de carbono (CO ) y el sulfuro de hidrógeno (H,S) son moléculas de señalización gaseosas efimeras. El NO activa directamente la guani lilciclasa. (pp. 187-188) 21 . la cascada del ácido araquidónico genera moléculas de señalización lip1dicas tales como leucotrienos, prostaglandinas y tromboxanos. {p. 189; Fig. 6-12)

Modulación de las vías de señalización 22. La respuesta de una célula a una molécula de señalización está deter23.

24.

25.

26.

Vías de señalización 8. Las sefiales químicas se unen a receptores y alteran moléculas de señaüzación intracelulares q ue guían la respuesta. (p. 178) 9. Las moléculas de señalización lipófilas entnn hacia el interior de la célula y se combinan con receptores citoplasmáticos o nucleares. Las moléculas de señali1~Kión lipófobas y algunas moléculas lipófilas se combinan con receptores de membrana. (p. 179; Fig. 6-3) JO. Las vías de transducción de señales utilizan receptores proteicos de membrana y segundos mensajeros intracelulares para convertir la información de la se11al en una respuesta intracelular. (p. 180; Fig. 6-4 ) 11 . Algunas vías de transducción de se1iales activan proteincinasas; otras, enzimas amplificadoras que producen segundos mensajeros. (p. 181;

Eig 6-~l 12. Las vías de señalización generan cascadas intracelulares que amplifican la señal original. ( p. 182: tig 6-6) 13. Los receptores enzimáticos activan proteincinasas como la tirosincinasa (Fig. 6·7) o la enzima amplificadora guanililciclasa, la cual produce el segundo mensajero GMPc. (p. 183) 14. Las proteínas G asociadas a enzimas amplificadoras son el sistema de señalización más prevalente. Los recep tores asociados a proteú1a G también alteran canales iónicos. (p. 184: fjg 6-8) 14. Las proteínas G asociadas a enzimas amplificadoras son el sistema de señalización más prevalente. Los receptores asociados a proteína G también alteran canales iónicos. (p. 184: fjg 6-8) 15. La vía de la adenililciclasa-AMPc asociada a proteína G es la más común para las hormonas peptídicas y proteicas. (p. 184; Fig. 6·8) 16. 1::n la vía de la fosfolipasa C asociada a proteína G, la enzima amplificadora fosfolipasa C produce dos segundos mensajeros: TP, y diacil· glicerol (DAG). El IP, libera Ca2+ desde los depósitos intracelulares. El diacilglicerol activa la proteindn asa C. (p. 184; Fiit. 6-8b) 17. Los receptores tipo integrina conectan la matriz extracelular con el citoesqueleto. (p. 179; Fig. 6-3c) 18. Los canales regulados por compuerta se abren o derran para generar señales eléctricas. (p. 185; Fig. 6-9 )

203

27.

28.

minada por los receptores de la célula para esa señal. {p. 189) Los receptores pueden existi r en formas relacionadas llamad.as isoformas. Un ligando puede tener diferentes efectos cuando se une a iso· formas diferentes. (p. 190; Fig. 6-13) Un receptor puede tener múltiples ligandos. Los agonistas imitan la acción de una molécula de señalización. Los an tagonistas bloquean la vía de se1\alización. (p. 190; Fig. 6-14) Los receptores proteicos presentan especificidad, competición y saturación . (p. 190) Las células expuestas a concentraciones anormalmente altas de una señal por un período de tiempo sostenido intentan regresar su respuesta a la normalidad a través de la regulación por disminución o mediante la desensibilización. En la regulación por disminución, la célula reduce el número de receptores. En la desemibilizacíón, la célula disminuye la afinidad de unión de los receptores. La regulación por incremento es lo opuesto a la Tegulación por disminución y consiste en el aumento del número de receptores para una señal. (p. 191 ) Las células tienen mecanismos para detener las vías de se1\alización, como la eliminación de la molécula de se11alización o la degradación del complejo receptor-ligando. (p. 191 ) Muchas enfermedades han sido relacionadas con defectos en diversos aspectos de las vías de señalización, tales como receptores deficientes o inexistentes. (p. 192; Cuadro 6- l )

Vías reflejas homeostáticas 29. Walter Cannon enunció cuatro postulados básicos sobre la homeostasis: ( J ) El sistema nervioso cumple un papel importante en el mantenimieoto de las homeostasis. (2 ) Algunos parámetros se encuentran bajo cont rol tónico, lo que permite alllnentar o disminuir dicho parámetro a través de una única señal. (Fig. 6-14a). ( 3) Otros parámetrns se encuentran bajo control antagonista, en el cual una hormona o neurona aumenta el parámetro mientras que otra lo disminuye (Fig. ..6.:..l.:lb). (4) Las señales químicas pueden tener diferentes efectos en tejidos corporales diferentes, dependiendo del tipo de receptor presente en la célula diana / Fjg 6- 1<; ) (p. 195) ..6.:..l.:lb). (4) las se11ales quimicas pueden tener diferentes efectos en tejidos corporales diferentes, dependiendo del tipo de receptor presente en la célula diana / t'ig 6· J , ) (p. 195) 30. En las vías de control reflejas, la decisión de responder a un cambio es tomada por el centro integrador. Una señal química o eléctrica hacia la célula diana genera una respuesta. Las vías reflejas a larga distancia abarcan los sistemas nervioso y endocrino y citocinas. (p. 194) 3 l. El control nervioso es más rápido y más específico que el control endocrino, pero habitualmente tiene una menor duración. El control endocrino es menos específico y de inicio más lento, pero su acción dura más y habitualmente está amplificado. (p. 198; Cuadro 6-2 ) 32. Muchas vías reflejas son combinaciones complejas de mecanismos de control nervioso y endocrino. (p. 199: fig 6- 19)

204

Capit ulo 6 Comunicación, integración y homeostasis

Preguntas Nivel 1: revisión de hechos y términos l. ¿Cuáles son las dos rutas para el transporte de señales a larga distancia en el cuerpo? 2. ¿Qué dos sistemas corporales mantienen la homeostasis controlando y respondiendo a cambios en el medio? 3. ¿Qué dos tipos de señales fisiológicas utiliza el cuerpo para enviar mensajes? De estos dos tipos, ¿cuál está disponible en todas las células? 4. En una vía de señali1.ación, el ligando seüal, también llamado primer mensajero, se une a un/ a ____ , el/la cual activa y cambia ____ intracelular/es. 5. Las tres enzimas amplificadoras principales son: (a) - - - - , que produce AMPc; (b) - - - ~ que produce GMPc; y (c) _ _ __ que convierte un fosfolípido de la membrana celular en dos segundos mensajeros diferentes. 6. Una enzima llamada proteincinasa ai\ade el grupo funcional a su sustrato transfiriéndolo desde una molécula de 7. Distinga entre receptores centi·ales y periféricos. 8. Los receptores de las vías de señalización pueden encontrarse en el ____ , en el ____ o en la ____ de la célula. 9. La regulación por disminución resulta en un número ____

{¿aumentado o disminuido? ) de receptores en respuesta a una señal prolongada. 10. Liste dos maneras en que una célula puede disminuir su respuesta a una señal. 11. En un bucle de retroalimentación negativa, ¿la respuesta dirige el sistema en la misma dirección que el estímulo o en dirección opuesta?

Nivel 2: revisión de conceptos 12. Explique las relaciones de los términos en cada uno de los siguientes grupos. Dé un ejemplo fisiológico o la ubicación si corresponde. {a) uniones en hendidma, conexinas, conexón {b) autocrina, paracrina, citocina, neurocrina, hormona {c) agonista, antagonista (d) transducción, amplificación, cascada 13. Cite y compare las cuatro clases de receptores de membrana de las vías de seíiali1.ación. Dé un ejemplo de cada una. 14. ¿Quién fue Walter Cannon? Reformule sus cuatrn postulados con sus propias palabras. 15. Defina brevemente los siguientes términos y dé un ejemplo anatómico cuando sea posible: seúal de entrada, centro integrador, seüal de (aj° ~niones en hendidura, ~011;xiJ1;·s, conexón {b) autocrina, paracrina, citocina, neurocrina, hormona (c) agonista, antagonista (d) transducción, amplificación, cascada 13. Cite y compare las cuatrn clases de receptores de membrana de las vías de seiialización. IJé un ejemplo de cada una. 1 1 1. ¿Quién fue Walter Cannon' Reformule sus cuatro postulados con sus propias palabras. 15. Defina brevemente los siguientes términos )' dé un ejemplo anatómico cuando sea posible: seiial de entrada, centro integrador, señal de salida, respuesta, sensor, estimulo, diana. 16. Compare y contraste las ventajas y desventajas de los mecanismos de contrnl nervioso y endocrino.

Véanse las respuestas en el apéndiw A

17. Los siguientes reflejos, ¿son ejemplos de retroalimentación negativa o

positiva? (a ) secreción de glucagón en respuesta a una reducción de la gluce-

nua {b ) aumento de la secreción de leche en respuesta a la succión por parte del bebé (c) urgencia para vaciar la vejiga {d ) sudoración en respuesta a un aumento de la temperatura corporal 18. Identifique el tejido u órgano diana para cada uno de los ejemplos de la pregunta 17. 19. Ahora identifique el centro integrndor de los ejemplos de la pregunta 17.

Nivel 3: resolución de problemas 20. En cada una de las siguientes situaciones, identifique los componentes del reflejo. \ a) Usted está sentado tranquilamente ante su escritorio, estudiando, cuando advierte un fuerte viento que sopla en el exterior y comienza a sentir un poco de frío. Enciende la calefacción, pero recuerda la factura del mes anterior r decide, en cambio, ponerse un abrigo. Pronto deja de sentir frío. (b ) Mientras hace las compras, percibe el olor de unos bollos de canela. Le gusta mucho ese aroma, pero recuerda que no tiene hambre, ya que almorz6 hace una hora. Sigue haciendo las compras, pero 20 minutos después vuelve a la panadería; bollo de canela en mano, degusta vorazmente su dulzura con la boca llena de saliva. 21. Una investigadora estudia el musculo liso de las vías aéreas del aparato respiratorio. Cuando expone las vías aéreas al neurotransmisor acetilcolina, el musculo liso se contrae. Cuando expone las vías aéreas a la neurohormona adreaalina, aquellas se dilatan. (a) El fenómeno recién descripto es un ejemplo de control _ _ __ {b) ¿Qué distingue un neurotransmisor de una neurohormona? (c) ¿Qué mensajero qutmico es secretado en mayores concentraciones, acetilcolina o adrenalina? Justifique su respuesta. Nivel 4: problemas analíticos 22. En una cascada de señal de la rodopsina, una molécula receptora -una rodopsina- activa l 000 moléculas de transducina - la siguiente molécula de la cascada de señalización-. Cada transducina activa una fosfodiesterasa, y cada fosfodiesterasa convierte 4 000 GMPc en GMP. (b) ¿Qué' disti'ngue un neÚrotránsmisor de ltna neuróhor'moiia? (c) ¿Qué mensajero químico es secretado en mayores concentraciones, acetilcolina o adrenalina? Justifique su respuesta. Nivel 4: problemas analíticos 22. En una cascada de seíial de la rodopsina, una molécula receptora -una rodopsina- activa J 000 moléculas de transducina - la siguiente molécula de la cascada de seíialización-. Cada transdudna activa una fosfocLiesterasa, y cada fosfocLiesterasa convierte 4 000 GMPc en GMP. {a) ¿Cuál es el nombre del fenómeno descripto en este párrafo? (b) ¿La activación de una rodopsina resultará en la producción de cuántas moléculas de GMP?

Respuestas

20S

Respuestas

1

Respuestas a las preguntas de revisión

1

Página 177 J . Todos los métodos listados utilizan señales químicas, excepto las (c) uniones en hendidura. Las neurohormonas (e) y los neurotransmisores (f) se asocian con la sei\alizacíón eléctrica en las neuronas, pero son en sí mismos señales químicas. 2. Las cítocínas, las hormonas y las neurohormouas viajan por la sangre. Las cítocinas, las neurohormonas y los neurotransmisores son liberados por las neuronas. 3. La señal para abalanzarse no podría haber sido una señal paracrina debido a que los ojos están demasiado distanciados de las piernas y, además, la respuesta fue demasiado rápida como para haber ocurrido por difusión. Página 180 4. Los componentes de las vías de se11alización son: molécula de señalización, receptor, molécula/s de señal intracelular/es y proteínas diana. 5. Las localizaciones celulares de los receptores son: la membrana celular, el citosol y el núcleo. Página 181 6. Los pasos de la transducción de señales son: (1) la molécula de señalizació n se une al receptor que (2) activa una proteína, la rnal (3) produce segundos mensajeros que (4 ) generan una respuesta. 7. La amplificación convierte una molécula de señafüación (primer mensajero) en múltiples segundos mensajeros. 8. Los esteroides son lipófilos, por lo que pueden entrar en el interior de las células y unirse a receptores intracelulares. Página 187 9. Los receptores pueden ser: e.anales iónicos regulados por compuerta, receptores enzimáticos, receptores asociados a protema G o receptores tipo integrinas. 1O. Los primeros mensajeros son extracelulares; los segundos mensajeros son intracelulares. 11. (a) ligando, receptor, segundo mensajero, respuesta celular; (b) enzima amplificadora, segundo mensajero, proteincinasa, proteína fosforilada, respuesta celular J2. (a) se abre el canal de Cr: la célula se hiperpolariza, (b) se abre el ma amplificadora, segundo mensajero, proteincinasa, proteína fosforilada, respuesta celular 12. (a) se abre el canal de CI-: la célula se hiperpolariza, (b) se abre el e.anal de K-: la célula se hiperpola1iz.a, (e) se abre el c.a11al de Na• : la célula se despolariza. Página 187 13. La célula debe utilizar transporte activo para mover el Ca'+en contn de su gradiente de concentración. Página 189 14. Una sustancia que bloquea la acción de los leucotrienos podría acntar sobre el receptor de la célula diana o en rnalquier paso de la cascada. Una sutancia que bloquea la síntesis de leucotrienos inhibiría la lipoxigenasa. Página 190 15. Receptores, enzimas y transportadores son protemas. J 6. La insulina podría estar utilizando una isoforma del receptor con diferentes sistemas de segundos mensajeros en distintas células o podría estar uniéndose a dos isofonnas diferentes del receptor.

Página 191 17. Las opciones (a) y (d ) podrían disminuir la afinidad de unión. Modificar el nun1ero de receptores no afectana la afinidad de unión. Página 194 18. El control tónico abarca habintalmente un sistema de control, pero el cont rol antagonista utiliza dos. 19. Una señal puede tener dos efectos opuestos uti lizando diferentes receptores o diferentes vías de señalización. Página 196 20. En el control local, el estimulo, la integración de la señal y la respuesta tienen lugar en la célula diana o muy cerca de ella. En el contr·ol reflejo, la integración de la señal de entrada y la iniciación de la respuesta pueden suceder lejos del lugar donde ornrrió el cambio. Además, la respuesta refleja es frecuentemente sistémica y no locali zada. 21. Estimulo, sensor o receptor sensorial, señal de entrada (,ía aferente), centro integrador, sef1al de salida (vía eferente), diana o efector, respuesta (tisular y sistémica) Página 197 22. (a) El encéfalo)' la médula espinal son el "centro integrador del sistema nen~oso''. (b) EJ rernadro "Receptor" representa los órganos sensoriales. (c) La línea de puntos que representa la retroalimentación negativa va desde "Respuesta" hacia "Cambio interno o externo". Página 200 23. Golpe en la rodiUa : cambio interno o externo; músculos del muslo dianas; neurona hacia los músculos del muslo neurona eferente; neurona sensorial = sehal de entrada; encéfalo y médula espinal = centro integrndor del SNC; receptor de es-tiramiento = sensor o receptor; contracción muscular = respuesta.

=

=

Página 200 24. Alimento en el estómago = estímulo; encéfalo y médula espinal = centro integrador del SNC; celulas endocrinas del páncreas = E (centro integrador); receptores de estiramiento = receptor; neurona eferente hacia el páncreas = neurona eferente; insulina - hormona clásica; célula adiposa = célula diana; neurona sensorial = neurona aferente. La S3Egre es la ru\a a11atómica que utilizan las qormonas para Herente hacia el páncreas = neurona eferente; insulina = hormona clásica; célula adiposa = célula diana; neurona sensorial = neurona aferente. La sangre es la ruta anatómica que utilizan las hormonas para llegar a sus dianas, pero 110 es parte de la vía refleja.

~ Respuestas a las preguntas de las figuras Página 184 figura 6-8: Molécula A (activa e inactiva) = adenililciclasa; molécula ~ inactiva - ATP; molécula B activa = AMPc; molécula C (activa e inactiva) = proteincinasa A; producto = proteína fosforilada. Página 193 figma 6- ) ; · 180 latidos/ min en el ECG superior y 60 latidos/min en el ECG inferior.

Introducción al sistema endocrino Hormonas 207 Las hormonas se conocen desde tiempos antiguos 208 ¿Qué hace que una sustancia química sea una hormona? 209 Las hormonas actúan uniéndose areceptores

211

La acción hormonal debe ser detenida

Clasificación de las hormonas

212 214 216

La mayoría de las hormonas son péptidos o proteínas Las hormonas esteroideas derivan del colesterol Algunas hormonas derivan de aminoácidos

Control de la liberación hormonal

216 217 219 219 219 219 221 223 223 223

Las hormonas-se pueden clasificar según sus vías reflejas La célula endocrina es el sensor en los reflejos endocrinosmás s1mples Muchos reflejos endocrinfü involucran el sistema nervioso Las neurohormonas son secretadas en la sangre por neuronas La hipófisis está formada por dos glándulas fusionadas La neurohipófisis almacena ysecreta dos neurohormonas La adenohipófisis secreta seis hormonas Un sistema porta lleva hormonas desde el hipotálamo hasta la adenohipófisis Las hormonas de la adenohipófisis controlan el crecimiento, el metabolismo yla reproducción Los bucles de retroalimentación son diferentes en el eje hipotálamo-hipofisario

Interacciones hormonales

224 226 226

"º 226

En la sinergia, el efecto de las hormonas que interactúan es más que aditivo Una hormona facilitadora P9sibilita que otra hormona ejerza su efecto pleno Hormonas antagonistas tienen efectos opuestos Ulld I IUJIIIUlld ldllllldUUlá fJV~IUllllO

yuc uua IIUIIIIUIIQ CJCI LQ ~u CICUU

pleno Hormonas antagonistas tienen efectos opuestos

Patologías endocrinas

227 227 228 228

La hipersecreción exagera los efectos de una hormona La hiposecreción disminuye o elimina los-efectos de una hormona Los problelilas con el receptor o con los segundos mensajeros generan respuestas tisulares anormales El diagnóstico de las patologías endocrinas. depende de la complejidad del reflejo

Evolución de las hormonas 231 Laglándula pineal

D

a vid tenía s iete años de edad cuando aparecieron los primeros sín tomas. Su apetito aumentó y pa recía estar sie mpre en la coci na, buscando com ida. Sin embargo, a pesar de comer cada vez más, David perdía peso. Cuando comenzó a pedir agua en lugar de beb idas gaseosas, su madre se p reocupó, )' cuando mojó la cama tres noches segu idas, se dio cuenta de que algo iba mal. El médico confi rmó sus sospechas diagnósticas tras real izar a David algunas pruebas para determ inar su concentración de gl ucosa en sangre y en orina: tenía d iabetes mell itus. En su caso, la enfermedad se debía a una falta de insulina, una ho rmo na producida por el p,\ncreas. A David se le prescr ib ieron inyecciones de insulina, un tratamiento que deberá con tinua r po r el resto de su vida. Hace cien años, David se habría muerto no mucho después de la aparición de los primeros síntomas. El campo de la endocrinología, el estudio de las hormonas, estaba entonces en sus com ie nzos. Todavía no se había descubierto la mayoría de las hormonas, y sus funciones no eran comprendidas del todo. No existía tratam iento para la diabetes; tampoco había pastillas anticonceptivas. Los bebés nacidos con una inadecuada sec reción de ho rmona tiroidea no crecían ni se desa rrollaban normalmente. Hoy en día, eso ha camb iado. Hemos identificado una larga y creciente lista de hormonas. Las e